Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

हम prof. ईसाई Trepo (INSERM U871, Lyon, फ्रांस), जो कृपया HepaRG कोशिकाओं प्रदान धन्यवाद. हम प्रशासनिक मदद के लिए रीता Appodia के आभारी हैं. इस काम को MIUR- Ministero dell'istruzione, dell'universit] ई डेला ricerca (FIRB 2011-2016 RBAP10XKNC) और Sapienza रोम विश्वविद्यालय (प्रोट) द्वारा समर्थित किया गया था. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

1. संस्कृति मीडिया और अभिकर्मकों की तैयारी
<ol><li>प्रसार माध्यम: GlutaMAX के साथ पूरक विलियम ई माध्यम, 10% भ्रूण गोजातीय सीरम (FBS), 1% पेनिसिलिन /</li>
	<li>विभेदमाध्यम: पूरक विलियम के ई माध्यम के साथ GlutaMAX, 10% FBS, 1% पेनिसिलिन /</li>
	<li>ब...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

इस प्रोटोकॉल में वर्णन किया गया है कि हेपाआरजी कोशिकाओं में अंतर कैसे करें और सोडियम ओलेट उपचार द्वारा वेसिकुलर स्टेटोसिस को कैसे प्रेरित करें (चित्र 1क)। वास्तव में, अन्य मानव hepatotocellular ?...

हेपेटिक स्टेएटोसिस को इंट्राहेपेटिक वसा संचय के रूप में परिभाषित किया गया है, ट्राइग्लिसराइड युक्त लिपिड बूंदों के भीतर, जिगर के वजन का कम से कम 5%। लंबे समय तक यकृत लिपिड भंडारण एक संभावित प्रतिवर्ती प्रक्रिया है, हालांकि, यह जिगर चयापचय रोग, सूजन और nonalcoholic फैटी लीवर रोग के उन्नत रूपों के लिए नेतृत्व कर सकते हैं (NAFLD), के कई भागों में पुरानी जिगर की बीमारी का प्रमुख कारण दुनिया1,2. NAFLD एक बहुकारक रोग है कि अधिक आक्रामक गैर शराबी steatohepatitis (NASH) के लिए विकसित हो सकता है, जो बारी में सिरोसिस के लिए प्रगति कर सकते हैं और, रोगियों का एक छोटा सा प्रतिशत में, hepatotocellular कार्सिनोमा (एचसीसी)1,3. वर्तमान में एनएएफएलडी के लिए एक विशिष्ट उपचार के रूप में कोई अनुमोदित चिकित्सा उपलब्ध नहीं है और आहार और जीवन शैली में संशोधनों का संयोजन NAFLD और नैश प्रबंधन4,5,6 का स्तंभ बना हुआहै.
एनएएफएलडी के रोगजनन में यकृत स्तरावता के विकास के लिए अग्रणी आणविक तंत्र अभी भी स्पष्ट रूप से स्पष्ट हैं7. इस संदर्भ में, मानव स्थिति रोग प्रगति का अध्ययन करने के लिए माउस मॉडल विकसित किए गए हैं। विभिन्न मॉडलों के असंख्य मौजूद है, और हर एक अपने फायदे और नुकसान है, आनुवंशिक सहित, पोषण और रासायनिक प्रेरित मॉडल विभिन्न दृष्टिकोण के संयोजन. आनुवंशिक रूप से संशोधित (ट्रांसजेनिक या नॉकआउट) चूहों को सहज रूप से जिगर की बीमारी का विकास होता है। तथापि, यह ध्यान दिया जाना चाहिए कि ये उत्परिवर्तन मनुष्यों में बहुत दुर्लभ हैं और किसी एकल जीन (उदा., ob/ob माउस) के अधिक-अभिव्यक्ति में आणविक स्तर8,9पर बहुकारक मानव रोग के ईटियोलॉजी की नकल नहीं कर सकता है। इसी तरह, आहार या औषधीय हेरफेर के बाद चूहों द्वारा प्राप्त रोग मानव 8 मेंNAFLD के विकास के साथ जुड़े आहार के प्रभाव की नकल नहीं कर सकते हैं. पशु मॉडल, तथापि, NAFLD की समझ में विकास की सुविधा है और इस दृष्टिकोण वर्तमान में प्रयोगशाला अनुसंधान में सबसे अक्सर इस्तेमाल किया रणनीति है. फिर भी, पशु मॉडल में प्राप्त परिणामों के मनुष्यों में प्रतिकृति बार बार विफल रहा है, क्लिनिक में गरीब अनुवाद के कारण10.
इसलिए, NAFLD के इन विट्रो मॉडल NAFLD प्रगति के आणविक तंत्र स्पष्ट करने में एक मौलिक भूमिका निभा सकते हैं, और वे यौगिकों की एक बड़ी संख्या स्क्रीन करने के लिए एक मूल्यवान उपकरण का प्रतिनिधित्व करते हैं. प्राथमिक कोशिका संस्कृतियों, अमर कोशिका लाइनों और जिगर बायोप्सी बड़े पैमाने पर अनुसंधान प्रयोजनों के लिए इस्तेमाल किया गया है11. प्राथमिक मानव hepatocytes बारीकी से मानव नैदानिक स्थितियों के समान है, लेकिन वहाँ दाताओं की एक सीमित संख्या है, और प्राथमिक सेल संस्कृतियों कोशिकाओं की परिवर्तनशीलता के कारण गरीब reproducibility दिखा. इन प्रेक्षणों के साथ-साथ नैतिक और संभारतंत्रीय मुद्दों के कारण मानव प्राथमिक हेपाटासाइट्स का उपयोग सीमित12हुआ है। इस प्रकार, यकृत सेल लाइनों एक सुविधाजनक विकल्प का प्रतिनिधित्व करते हैं, प्राथमिक संस्कृति पर कई आवश्यक लाभ होने, के रूप में यकृत सेल लाइनों तेजी से बढ़ने, एक लगभग असीमित जीवन-विस्तार है, और एक स्थिर phenotype है. इसके अलावा, सेल लाइनों आसानी से सुलभ हैं और यकृत सेल लाइनों की संस्कृति की स्थिति प्राथमिक hepatocytes के उन लोगों की तुलना में सरल कर रहे हैं और विभिन्न प्रयोगशालाओं के बीच मानकीकृत कर रहे हैं.
यहाँ, हम विस्तार से जिगर vesicular steatosis के एक इन विट्रो सेल आधारित मॉडल का वर्णन, फैटी एसिड सोडियम oleate के साथ इलाज hepatic विभेदित HepaRG कोशिकाओं द्वारा प्रतिनिधित्व किया. HepaRG सेल लाइन हेपेटाइटिस सी संक्रमण से प्रभावित एक महिला रोगी और एक एडमंडसन ग्रेड मैं अच्छी तरह से अलग जिगर ट्यूमर14से स्थापित किया गया था. HepaRG सेल लाइन एक मानव द्विशक्तिजनक जनक कोशिका लाइन दो अलग सेल phenotypes की ओर 2% dimethyl sulfoxide (DMSO) के संपर्क में अंतर करने में सक्षम है: पित्त की तरह और hepatocyte की तरह कोशिकाओं. विभेदित हेपाआरजी कोशिकाओं (dHepaRG) वयस्क hepatocytes के साथ कुछ सुविधाओं और गुणों का हिस्सा है और इस तरह के Albumin, AldolaseB, Cytochrome P450 2E1 ( CYP2E1) के रूप में जिगर विशिष्ट जीन stably व्यक्त करने की क्षमता के अधिकारी13 (चरण 3).। 5 दिनों के लिए फैटी एसिड नमक सोडियम ओलेट (250 डिग्री सेल्सियस) के साथ dHepaRG कोशिकाओं का उपचार साइटोप्लाज्मिक लिपिड बूंदों की पीढ़ी के लिए नेतृत्व, फैटी लीवर के प्रभाव की नकल14,15,17,18 ( चरण 4). लिपिड बूंदों का संचय आसानी से तेल लाल ओ धुंधला द्वारा पता लगाया जा सकता है (कदम 5), एक lysochrome वसा में घुलनशील डाई कि तटस्थ ट्राइग्लिसराइड्स और लिपिड लाल नारंगी दाग. फैटी dHepaRG में लिपिड को कुशलता से परिमाणित करने के लिए, यहां हम 4,4-difluoro-1,3,5,7-tetraethyl-4-bora-3a,4a-diaza-s-indacene (py Bodi 505/515) (step Bodicent) (step 6) के साथ धुंधला करने के बाद साइटोफ्लोरीमीट्रिक विश्लेषण वर्णन करते हैं। इंट्रासेल्यूलर लिपिड निकायों के लिए और लिपिड बूंदों19लेबल करने के लिए इस्तेमाल किया गया है। इसके अलावा, यहाँ हम बताते हैं कि कैसे मात्रात्मक polymerase श्रृंखला प्रतिक्रिया द्वारा steatosis का मूल्यांकन करने के लिए (QPCR) (चरण 7) जीन अभिव्यक्ति dHepaRG कोशिकाओं में कई चयापचय जीन के विनियमन. सोडियम ओलेट उपचार के बाद लिपिड बूंदों के संचय की और विशेषता और मात्रा निर्धारित करने के लिए, हमने सुसंगत एंटी-स्टोक्स रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी (चरण 8) का प्रदर्शन किया, एक अभिनव तकनीक जो दृश्य और परिमाणीकरण में सक्षम बनाती है 20,21लेबलिंग के बिना लिपिड बूंदें .

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

हेपेटिक स्टेटासिस एक चयापचय रोग का प्रतिनिधित्व करता है जो ट्राइग्लिसराइड के संचय से परिणाम देता है जिसमें हेपेटोसाइट्स में लिपिड बूंदें होती हैं। अत्यधिक वसा संचय गैर शराबी फैटी लीवर रोग (NAFLD) की ओर जाता है, जो संभावित रूप से प्रतिवर्ती है और गैर शराबी steatohepatitis (NASH) और अंत में सिरोसिस और hepatotocellular कार्सिनोमा (एचसीसी) में विकसित हो सकता है। नैश, अपरिवर्तनीय जिगर की क्षति, फाइब्रोसिस, सिरोसिस, और यहां तक कि एचसीसी की प्रगति के साथ हेपाटोसाइट्स में लिपिड संचय को जोड़ने वाले आणविक तंत्र अभी भी स्पष्ट नहीं है। यह अंत करने के लिए, कई इन विट्रो और विवो मॉडल में NAFLD कारण रोग प्रक्रियाओं को स्पष्ट करने के लिए विकसित किया गया है. वर्तमान अध्ययन में, हम जिगर vesicular steatosis है कि DMSO-अलग मानव यकृत HepaRG कोशिकाओं फैटी एसिड नमक सोडियम oleate के साथ इलाज के होते हैं के प्रेरण के लिए एक सेलुलर मॉडल का वर्णन. वास्तव में, सोडियम ओलेट-उपचारित हेपाआरजी कोशिकाओं कोशिकाद्रव्य में लिपिड बूंदों जमा और स्टेटोसिस की विशिष्ट विशेषताएं दिखा. यह इन विट्रो मानव मॉडल में विवो चूहों मॉडल के रूप में के रूप में अच्छी तरह से प्राथमिक मानव hepatocytes के लिए एक मूल्यवान विकल्प का प्रतिनिधित्व करता है. हम भी परिमाणीकरण और HepaRG कोशिकाओं में वसा संचय के मूल्यांकन के लिए कई तरीकों की तुलना प्रस्तुत, तेल लाल ओ धुंधला सहित, cytofluorimetric Bodipy माप, चयापचय जीन अभिव्यक्ति विश्लेषण द्वारा QPCR, और सुसंगत विरोधी स्टोक्स रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी। CARS इमेजिंग रमन स्पेक्ट्रोस्कोपी की रासायनिक विशिष्टता को जोड़ती है, एक रासायनिक विश्लेषण तकनीक सामग्री विज्ञान अनुप्रयोगों में अच्छी तरह से जाना जाता है, उच्च गति के लाभों के साथ, उच्च संकल्प गैर रेखीय ऑप्टिकल microscopies सटीक अनुमति देने के लिए लिपिड संचय और लिपिड छोटी बूंद गतिशीलता का परिमाणीकरण। vesicular steatosis के प्रेरण के लिए एक कुशल इन विट्रो मॉडल की स्थापना, परिमाणीकरण और लिपिड संचय की विशेषता के लिए एक सटीक विधि के साथ, के माध्यम से NAFLD के प्रारंभिक चरण निदान के विकास के लिए नेतृत्व कर सकते हैं आणविक मार्करों की पहचान, और नए उपचार रणनीतियों की पीढ़ी के लिए.

यह प्रोटोकॉल सोडियम ओलेट उपचार द्वारा DMSO-अलग HepaRG कोशिकाओं में vesicular steatosis को प्रेरित करने और उसकी विशेषता के लिए एक कुशल विधि का वर्णन करता है (चित्र 1ए)।
हेपाआरजी कोशिकाओं का व?...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

इस अध्ययन में, हम फैटी एसिड नमक सोडियम oleate के साथ विभेदित HepaRG कोशिकाओं में जिगर vesicular steatosis inducing के लिए एक विस्तृत प्रोटोकॉल का वर्णन और लिपिड संचय का पता लगाने और परिमाणीकरण के लिए तरीकों को रोजगार, सुसंगत विरोधी स्टोक्स सहित रमन प्रकीर्णन (सीएआरएस) माइक्रोस्कोपी, साइटोफ्लोरीमीट्रिक विश्लेषण, तेल लाल हे धुंधला, और क्यूपीसीआर।

विभेदित हेपाआरजी कोशिकाओं में वेसिकुलर स्टेटोसिस को प्रेरित और विशेषता

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

यह प्रोटोकॉल यह बताता है कि लिपिड संचय का पता लगाने और मात्राकरण के लिए विभेदित हेपैर्ग कोशिकाओं और तरीकों में यकृत वेसिकुलर स्टीटोसिस को कैसे प्रेरित किया जाए। यह इन विट्रो मानव सेल मॉडल वीवो चूहों मॉडल और प्राथमिक मानव हेपेटोसाइट्स के लिए एक मूल्यवान विकल्प का प्रतिनिधित्व करता है। गल एक नाइट्रोजन क्रायोप्रीवित हेपआरजी कोशिकाओं के कम मार्ग बैच उन्हें एक ३७ डिग्री सेल्सियस स्नान में विसर्जित करके जब तक झड़ ।कोशिकाओं को तेजी से 15 मिलीलीटर ट्यूब में स्थानांतरित करें जिसमें 10 मिलीलीटर का प्रसार मध्यम होता है। पांच मिनट तक अपकेंद्रित्र करने के बाद, सुपरनेट को त्यागें और कोशिकाओं को पांच मिलीलीटर के प्रसार माध्यम में फिर से खर्च करें। प्रति वर्ग सेंटीमीटर 250, 000 कोशिकाओं को प्लेट करने के लिए कोशिकाओं और पतला की गणना करें।100 मिलीमीटर सेल संस्कृति व्यंजन पर कोशिकाओं प्लेट और हर दो या तीन दिनों में माध्यम नवीनीकृत। कोशिकाएं लगभग 24 घंटे के दोगुने समय के साथ पैदा होती हैं। एक बार हेपआरजी कोशिकाएं 80% तक पहुंच ती हैं, तो उन्हें 0.05% ट्राइप्सिन समाधान के साथ तीन से पांच मिनट की इनक्यूबेशन के माध्यम से अलग कर देती हैं।कोशिकाओं को पहले की तरह पांच मिनट के लिए मध्यम और अपकेंद्रित्र में एकत्र करें। सुपरनेट को त्यागें और कोशिकाओं को पांच मिलीलीटर प्रसार माध्यम के साथ फिर से खर्च करें। फिर, कोशिकाओं की गणना करें और 250, 000 कोशिकाओं को प्रति वर्ग सेंटीमीटर प्लेट करने के लिए पतला करें।इस स्तर पर, प्रयोग शुरू करने के लिए उचित संख्या में कोशिकाओं तक पहुंचने के लिए इन चरणों को दोहराकर कोशिकाओं को बढ़ाना। हेपसर्ज कोशिकाओं को क्रायोप्रिजर्व करने के लिए, कोशिकाओं को 0.05% ट्राइप्सिन समाधान के साथ तीन से पांच मिनट के इनक्यूबेशन के माध्यम से चढ़ाना के 24 घंटे बाद अलग करें। कोशिकाओं को पहले की तरह पांच मिनट के लिए मध्यम और अपकेंद्रित्र में एकत्र करें।सुपरनैंट को त्यागें, कोशिकाओं को ठंड माध्यम के प्रति बैच एक मिलीलीटर में फिर से खर्च करें, और तरल नाइट्रोजन में बैचों को क्रायोप्रेरिज करें। दिन शून्य पर, बीज हेपआरजी कोशिकाओं को 250, 000 कोशिकाओं प्रति वर्ग सेंटीमीटर पर प्रसार माध्यम की उचित मात्रा के साथ संस्कृति-उपचारित व्यंजनों में। प्रत्येक परख के लिए दो व्यंजन चढ़ाया जाना चाहिए, एक नियंत्रण कोशिकाओं के लिए और एक ओलेट-इलाज कोशिकाओं के लिए ।दूसरे दिन और दूसरे दिन, प्रसार माध्यम की उचित मात्रा के साथ माध्यम को बदलें और कोशिकाओं को तब तक बढ़ने दें जब तक कि वे संगम तक न पहुंच जाएं । सात दिन पर, कोशिकाओं को १००% ढुलमुल होना चाहिए । कोशिकाओं को एक बार 1X पीबीएस के साथ धोएं।फिर, 1X पीबीएस को हटा दें और विभेदन माध्यम की उचित मात्रा जोड़ें। आठ, नौ, 12, 15 और 18 दिनों में, विभेदन माध्यम की उचित मात्रा जोड़ने से पहले 1X पीबीएस के साथ एक बार कोशिकाओं को धोएं। 21 दिन, एक माइक्रोस्कोप के तहत हेपार्ग कोशिकाओं का निरीक्षण करें और यह सुनिश्चित करें कि कोशिकाएं विभेदित संस्कृतियों को संकुचित कर रही हैं।एक नियंत्रण के रूप में, एक नियंत्रण पकवान काटने के लिए भेदभाव मार्कर जीन के जीन अभिव्यक्ति विश्लेषण प्रदर्शन करते हैं । 21 दिन में, विभेदित हेपआरजी कोशिकाओं को तरल नाइट्रोजन में क्रायोप्रेयर किया जा सकता है। 21 दिन, 250 माइक्रोमोलर की अंतिम एकाग्रता के लिए पूर्ण भेदभाव माध्यम की उचित मात्रा के साथ सोडियम ओलेट को पतला करें।वाहन नियंत्रण उपचार बनाने के लिए भेदभाव माध्यम के एक और aliquot में एक से ४०० के अनुपात में ९९% मेथनॉल जोड़ें । कोशिकाओं को एक बार 1X पीबीएस के साथ धोएं और वाहन या सोडियम ओलेट माध्यम जोड़ें। 23 और दिन 25 पर, हौसले से तैयार माध्यम की उचित मात्रा के साथ माध्यम बदलें ।26 दिन, ऑप्टिकल माइक्रोस्कोपी द्वारा कोशिकाओं का निरीक्षण करें। लिपिड बूंदें सोडियम ओलेट उपचारित कोशिकाओं में जमा होती हैं और साइटोप्लाज्म में पारदर्शी बूंदों के रूप में आसानी से दिखाई देती हैं। ऑयल रेड ओ धुंधला करने के लिए, सबसे पहले कोशिकाओं को 1X पीबीएस के साथ एक बार धोएं और 1X पीबीएस को पूरी तरह से हटा दें।कमरे के तापमान पर 15 मिनट के लिए 4% पैराफॉर्मल्डिहाइड और इनक्यूबेट जोड़ें। पैराफॉर्मलडिहाइड निकालें और कोशिकाओं को 1X पीबीएस के साथ दो बार धोएं। पीबीएस को हटाने के बाद, कमरे के तापमान पर पांच मिनट के लिए 60% आइसोप्रोपैनॉल के साथ कोशिकाओं को इनक्यूबेट करें।आइसोप्रोपनॉल निकालें और कोशिकाओं को कमरे के तापमान पर पूरी तरह से सूखने दें। अब कोशिकाओं के लिए तेल लाल हे काम समाधान जोड़ें और 30 मिनट के लिए कमरे के तापमान पर इनक्यूबेट । प्रत्येक नमूने के लिए आवश्यक कार्य समाधान की मात्रा कोशिकाओं को निकालने के लिए उपयोग की जाने वाली मीडिया की मात्रा से मेल खाती है।ऑयल रेड ओ सॉल्यूशन निकालें और तुरंत डबल डिस्टिल्ड पानी डालें। कोशिकाओं को डबल-डिस्टिल्ड पानी से चार बार धोने के बाद, विश्लेषण के लिए माइक्रोस्कोप के नीचे छवियों को प्राप्त करें। तेल लाल ओ डाई को elute करने के लिए, सभी पानी को हटा दें और सूखने दें।फिर, 100% आइसोप्रोपैनॉल का एक मिलीलीटर जोड़ें और कमरे के तापमान पर कोमल मिलाते हुए 10 मिनट के लिए इनक्यूबेट करें। पिपेट आइसोप्रोपेनॉल के साथ एल्यूटेड ऑयल रेड ओ डाई को कई बार ऊपर और नीचे करें, यह सुनिश्चित करते हुए कि सभी तेल लाल ओ समाधान में हैं। समाधान को एक क्यूवेट में स्थानांतरित करें।स्पेक्ट्रोफोटोमेट्री द्वारा 500 नैनोमीटर पर ऑप्टिकल घनत्व को मापें और खाली के रूप में 100% आइसोप्रोपैनॉल का उपयोग करें। कोशिकाओं को एक बार 1X पीबीएस के साथ धोएं। फिर, 1X पीबीएस में 1X पीबीएस में 37 डिग्री सेल्सियस पर 40 मिनट के लिए पतला बॉडीपी के 100 नैनोमोलर के साथ इनक्यूबेट।प्रवाह साइटोमेट्री माप में एक अन दाग नियंत्रण शामिल किया जाना चाहिए। धुंधला समाधान निकालें और 1X PBS के साथ एक बार कोशिकाओं को धो लें। इसके बाद कोशिकाओं को फिर से धो लें और पीबीएस को पूरी तरह से हटा दें।कमरे के तापमान पर 15 मिनट के लिए 4% पैराफॉर्मल्डिहाइड और इनक्यूबेट जोड़ें। पैराफॉर्मलडिहाइड निकालें और पीबीएस में पांच मिनट के लिए तीन बार नमूनों को धोएं। कोशिकाओं को 1X पीबीएस में चार डिग्री सेल्सियस पर रखा जा सकता है या तुरंत इमेज डे किया जा सकता है।भंडारण के लिए, पैराफिल्म के साथ लपेटें और कोशिकाओं को सूखने से रोकने के लिए एल्यूमीनियम पन्नी के साथ कवर करें। स्टेटोसिस के कुशल प्रेरण को सत्यापित करने के लिए, ओलेट-उपचारित और नियंत्रण हेपआरजी कोशिकाओं को तेल लाल ओ डाई से सना हुआ था। धुंधला होने के बाद लिपिड की बूंदें लाल बूंदों के रूप में आसानी से दिखाई देती हैं।आइसोप्रोपैनॉल के साथ तेल आर ओ डाई के स्पेक्ट्रोफोटोमेट्रिक माप द्वारा धुंधला मात्रा निर्धारित किया जा सकता है। कोशिकाओं से eluted तेल लाल ओ का अवशोषण सीधे साइटोप्लाज्मिक लिपिड बूंद संचय के आनुपातिक है। सोडियम ओलिट एकाग्रता और एक्सपोजर समय एमटीटी कोलोरिमेट्रिक सेल व्यवहार्यता परख द्वारा निर्धारित किया गया था।Formosan उत्पाद ४९० नैनोमीटर पर अपने अवशोषण द्वारा मात्रा निर्धारित है और सीधे संस्कृति में रहने वाले कोशिकाओं की संख्या के आनुपातिक है । सोडियम ओलेएट उपचार की तुलना सोडियम पामिटेट उपचार से की गई। एपोटोटिक दवा डॉक्सोरुबिसिन का उपयोग नियंत्रण के रूप में किया जाता था।सोडियम ओलेट उपचार के बाद सेलुलर लिपिड सामग्री की वृद्धि की मात्रा निर्धारित करने के लिए, लिपिड बूंदों को लेबल करने के लिए बॉडीपी डाई के साथ धुंधला किया गया था। साइटोफ्लोरोमेट्रिक विश्लेषण का उपयोग करके, बॉडीपी मतलब फ्लोरोसेंट तीव्रता द्वारा ट्राइग्लिसराइड सामग्री की मात्रा निर्धारित करना संभव है, जो नियंत्रण कोशिकाओं की तुलना में ओलेट-इलाज कोशिकाओं में अधिक है। यह ओलिट उपचार के बाद कुशल वसा संचय को इंगित करता है।दरअसल, बॉडीपी-दाग कोशिकाओं की छवियां ओलेट-इलाज कोशिकाओं में उज्ज्वल हरे फ्लोरोसेंट लिपिड बूंदों को दिखाती हैं जो नियंत्रण कोशिकाओं में दिखाई नहीं देती हैं। सोडियम ओलेट उपचार के बाद लिपिड बूंदों के संचय को आगे बढ़ाने के लिए, कार्स माइक्रोस्कोपी को टेक्स्ट प्रोटोकॉल में वर्णित किया जा सकता है जो लेबलिंग के बिना लिपिड बूंदों की मात्रा को सक्षम बनाता है। यह सेल-आधारित मॉडल गैर-ऑन्कोटिक फैटी लिवर रोग में शामिल आणविक तंत्र के ज्ञान को बढ़ा सकता है और जल्दी निदान और नए उपचार रणनीतियों के लिए नए मार्कर के विकास का कारण बन सकता है।

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

मानव दंत लुगदी स्टेम सेल के अलगाव विशेषता, और तुलनात्मक भेदभाव दो अलग अलग तरीकों का उपयोग करके स्थायी दांत से व्युत्पन्न

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

चूहे में Atherosclerosis बनाम Myointimal Hyperplasia उत्प्रेरण: दो मान्य मॉडल का एक परिचय

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

चूहे में रोधगलन उत्प्रेरण के मिनिमल इनवेसिव शल्य प्रक्रिया

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

अग्नाशय के कैंसर नई उपचार रणनीतियों के विकास के लिए सेल के लक्षण स्टेम का अध्ययन

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

ग्लूकोमा उत्प्रेरण एक के ि<em&gt; Vivo</em&gt; चूहे मॉडल और साबुत माउंट रेटिना तैयारी

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

प्रतिरक्षा प्रतिक्रिया के intravital multiphoton इमेजिंग के लिए माउस कान त्वचा में उत्प्रेरण ischemia-reperfusion चोट

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin प्रेरित आंतों में सूजन Organoids: एक<em&gt; इन विट्रो</em&gt; सिस्टिक फाइब्रोसिस रोगियों में दवा प्रतिक्रिया का आकलन करने के लिए परख

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

के अनुकूलित विश्लेषण<em&gt; Vivo</em&gt; और<em&gt; इन विट्रो</em&gt; यकृत steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

प्रत्यक्ष इंट्राट्रेकल लिपोपॉलीसैकराइड आसवन द्वारा चूहे में तीव्र फेफड़ों की चोट को प्रेरित करना

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

चूहे के हिंडमेंड में माध्यमिक लिम्फेमा को प्रेरित करने के लिए एक संशोधित विधि

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...