Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

우리는 친절하게 HepaRG 세포를 제공 크리스티안 트레포 교수 (INSERM U871, 리옹, 프랑스)에게 감사드립니다. 우리는 행정 도움을 리타 Appodia에 감사드립니다. 이 작품은 MIUR- 장관 델 istruzione, dell'università e 델라 ricerca (FIRB 2011-2016 RBAP10XKNC) 로마의 사피엔자 대학 (prot)에 의해 지원되었다. C26A13T8PS; 제자. C26A142MCH; 제자. C26A15LSXL).

1. 문화매체 및 시약준비
<ol><li>증식 배지: 글루타맥스, 10% 태아 소 혈청(FBS), 1% 페니실린/스트렙토마이신, 5 μg/mL 인슐린, 0.5 μM 하이드로코르티손 헤미쿠시네이트를 보충하세요.</li>
	<li>분화 매체: 글루타맥스, 10% FBS, 1% 페니실린/스트렙토미신, 5 μg/mL 인슐린, 50 μM 하이드로코르티손 헤미쿠시네이트 및 2% DMSO를 보충합니다.</li>
	<li>동결 매체: 10% DMSO로 증식 배지를 보충합니다.</li>
	<li>올레아테 ?...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

이 프로토콜은 HepaRG 세포를 분화하는 방법과 올레아테나트륨 처리에 의한 포수체 증시를 유도하는 방법을 설명한다(도1A). 실제로, 다른 인간 간세포암(HCC) 세포주와 비교하여, 헤파RG 세포주들은 성인 인간 간세포의 특징을 나타내며, 생체내 배양 된 1차 인간 간세포에 대한 귀중한 대안을 나타내는13,14 ,<sup cl...

간 지방 증은 간 지방 축적으로 정의 됩니다., 트리 글리세라이드 를 포함 하는 지질 방울 내에서, 적어도의 5% 간 무게의. 장기간 된 간 지질 저장은 잠재적으로 가역적인 과정, 그러나, 그것은 간 대사 기능 장애로 이어질 수 있습니다., 염증 및 비 알코올 지방 간 질환의 고급 형태 (NAFLD), 많은 부분에서 만성 간 질환의 주요 원인 세계1,2. NAFLD는 더 공격적인 비알코올성 지방간염(NASH)으로 진화할 수 있는 다인성 질환으로, 이는 차례로 간경변으로 진행될 수 있고, 환자의 작은 비율로, 간세포암종(HCC)1,3. 아니 승인 된 치료는 NAFLD에 대한 특정 치료로 현재 사용할 수 있으며 식이 요법과 라이프스타일 수정의 조합은 NAFLD 및 NASH 관리의 기둥 남아 4,5,6.
NAFLD의 병인에서 간 지방증의 발달로 이어지는 분자 메커니즘은 여전히 해명 될 남아7. 이러한 맥락에서, 마우스 모델은 인간 steatosis 질병 진행을 연구하기 위해 개발되었다. 다른 모형의 무수한 존재하고, 각각은 다른 접근을 결합하는 유전, 영양 및 화학적으로 유도한 모형을 포함하여 그것의 장단점이 있습니다. 유전자 변형 (형질 전환 또는 녹아웃) 마우스는 자발적으로 간 질환을 개발합니다. 그러나, 이러한 돌연변이는 인간에서 매우 드물며 단일 유전자(예를 들어, ob/ob 마우스)의 삭제 또는 과발현은 분자 수준8,9에서다인성 인간 질환의 병인을 모방하지 않을 수 있다는 점에 유의해야 한다. 마찬가지로, 식이 요법 이나 약리학 조작 후 쥐에 의해 취득 된 질병은 남자 8에서NAFLD의 발달과 관련된 인간의 식단의 효과를 모방하지 않을 수 있습니다. 동물 모형은, 그러나, NAFLD의 이해에 있는 발달을 촉진하고 이 접근은 현재 실험실 연구에서 가장 빈번히 이용되는 전략입니다. 그럼에도 불구하고, 동물 모델에서 얻은 결과의 인간에서의 복제는 반복적으로 실패하여, 클리닉(10)으로의 번역이 불량하게 되었다.
따라서, NAFLD의 시험관내 모델은 NAFLD 진행의 분자 메커니즘을 해명시키는 데 근본적인 역할을 할 수 있으며, 이들은 많은 수의 화합물을 스크리크하는 귀중한 도구를 나타낸다. 1 차적인 세포 배양, 불멸의 세포주 및 간 생검은 연구 목적을 위해 광범위하게 이용되었습니다11. 1 차적인 인간 간세포는 밀접하게 인간 임상 조건과 유사합니다, 그러나 기증자의 한정된 수가 있고, 1 차적인 세포 배양은 세포의 가변성 때문에 나쁜 재현성을 보여줍니다. 이러한 관찰, 윤리적 및 물류 문제와 함께, 인간의 기본 간세포의 사용은 제한되는 결과12. 따라서, 간 세포주들은 간 세포주들이 꾸준히 성장함에 따라 1차 배양에 비해 몇 가지 필수적인 장점을 가지며, 거의 무제한의 수명을 가지며, 안정적인 표현형을 가지는 편리한 대안을 나타낸다. 더욱이, 세포주 쉽게 접근할 수 있고 간 세포주 배양 조건은 1 차적인 간세포의 그것 보다는 더 간단하고 다른 실험실 중 표준화됩니다.
여기서, 우리는 지방산 나트륨 올레아테로 처리된 간 분화 HepaRG 세포로 대표되는 간 베아실 지방증의 체외 세포 기반 모델을 상세히 기술한다. HepaRG 세포주C형 간염 감염및 에드먼드슨 급I의 잘 분화된 간종양(14)에 의해 영향을 받는 여성 환자로부터 확립되었다. HepaRG 세포주 2% 디메틸 설폭사이드 (DMSO)에 노출시 분화 할 수있는 인간 이중 성 전구 세포주 두 개의 상이한 세포 표현형: 담즙 같은 및 간세포 유사 세포. 분화된 HepaRG 세포(dHepaRG)는 성인 간세포와 몇 가지 특징과 특성을 공유하고 알부민, 알돌라세비, 시토크롬 P450 2E1(CYP2E1) 및 시토크롬 P450 3A4(CYP3A4) 13과 같은 간 특이적 유전자를 안정적으로 발현할 수 있는 능력을 가지고 있습니다. (3단계)를 참조하십시오. 지방산 염나트륨 올레아테(250 μM)를 5일간 사용하여 dHepaRG 세포를 치료하면 세포질 지질 방울의 생성으로 이어지며, 지방간14,15,17,18의 효과를 모방한 것이다. 4단계). 지질 방울의 축적은 오일 레드 O 염색에 의해 쉽게 검출 될 수있다 (단계 5), 중성 트리글리세라이드와 지질 적색 오렌지를 얼룩 리소크롬 지방 수용성 염료. 지방 dHepaRG에서 지질을 효율적으로 정량화하기 위해, 여기에서 우리는 4,4-디플루오로-1,3,5,7-tetramethyl-4-보라-3a,4a-디아자-s-indacene (보디피 505/515)(단계 6), 립성 프로브로 염색 한 후 세포 불용형 분석을 보여줍니다. 세포 내 지질 체및 지질 방울 라벨에 사용 되었습니다19. 더욱이, 여기서 우리는 dHepaRG 세포에서 여러 대사 유전자의 정량적 중합효소 연쇄 반응(qPCR) (단계 7) 유전자 발현 완화에 의해 세포증을 평가하는 방법을 보여준다. 올레아테 나트륨 처리 후 지질 방울의 축적을 더욱 특성화하고 정량화하기 위해, 우리는 일관된 안티 스토크스 라만 산란 (CARS) 현미경 검사법 (단계 8)을 수행, 시각화 및 정량화를 가능하게하는 혁신적인 기술 20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

간 지방 세포는 간세포에 트리글리세라이드 함유 지질 방울의 축적에서 발생하는 대사 기능 장애를 나타냅니다. 과도한 지방 축적은 잠재적으로 가역적이고 비 알코올 성 지방 간염 (NASH) 및 결국 간경변 및 간세포 암종 (HCC)으로 진화 할 수있는 비 알코올 성 지방 간 질환 (NAFLD)으로 이어집니다. NASH에 진행과 간세포에서 지질 축적을 연결 하는 분자 메커니즘, 돌이킬 수 없는 간 손상, 섬유 증, 간 경 변, 그리고 심지어 HCC 는 여전히 불분명 남아. 이를 위해, 몇몇 생체외 및 생체내 모형은 NAFLD를 일으키는 원인이 되는 병리학 적인 프로세스를 해명하기 위하여 개발되었습니다. 본 연구에서, 우리는 지방산 염 나트륨 올레아테로 처리된 DMSO 분화 인간 간 HepaRG 세포로 구성된 간 소포증의 유도를 위한 세포 모델을 기술한다. 실제로, 나트륨 올레아테 처리 된 HepaRG 세포는 세포질에 지질 방울을 축적하고 스테토시스의 전형적인 특징을 보여줍니다. 이러한 시험관내 인간 모델은 생체내 마우스 모델뿐만 아니라 1차 인간 간세포에 대한 귀중한 대안을 나타낸다. 우리는 또한 오일 레드 O 염색, 세포 불변 보디피 측정, qPCR에 의한 대사 유전자 발현 분석 및 일관된 항 스토크스를 포함한 HepaRG 세포의 지방 축적의 정량화 및 평가를 위한 여러 가지 방법의 비교를 제시합니다. 라만 산란 (CARS) 현미경 검사법. CARS 이미징은 재료 과학 응용 분야에서 잘 알려진 화학 분석 기술인 라만 분광법의 화학적 특이성과 정밀한 정밀성을 허용하는 고속, 고해상도 비선형 광학 현미경의 이점을 결합합니다. 지질 축적 및 지질 방울 역학의 정량화. 혈관 성 증의 유도를위한 효율적인 시험관 내 모델의 설립, 지질 축적의 정량화 및 특성화에 대한 정확한 방법과 함께, 통해 NAFLD의 조기 진단의 개발로 이어질 수 분자 마커의 식별, 새로운 치료 전략의 생성에.

이 프로토콜은 나트륨 올레아테 처리에 의해 DMSO 분화 된 헤파RG 세포에서 소포 골수를 유도하고 특성화하는 효율적인 방법을 설명합니다 (도1A).
HepaRG 세포의 분화. 효율적으로 분화를 유도하기 위해 증식 세포는 증식 배지에서 저밀도(2.5 x 104 세포/cm2)로 시드되어야 합니다. 낮은 밀도에서 시드 할 때, 세포는 ?...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

본 연구에서는, 지방산 염 나트륨 올레아테를 사용하여 분화된 HepaRG 세포에서 간 용술증을 유도하기 위한 상세한 프로토콜을 설명하고, 일관된 항스톡스를 포함한 지질 축적의 검출 및 정량화를 위한 방법을 채택한다. 라만 산란 (CARS) 현미경 검사법, 세포 형광 분석, 오일 레드 O 염색, 및 qPCR.

분화된 HepaRG 세포에서 베아토시스 유도 및 특성화

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

이 프로토콜은 분화 된 HepaRG 세포와 지질 축적의 검출 및 정량화를위한 방법에 간 성구 세포증을 유도하는 방법을 설명합니다. 이 체외 인간 세포 모델은 생체 내 마우스 모델과 1 차적인 인간 간세포에 대한 귀중한 대안을 나타냅니다. 해동 될 때까지 37도 섭씨 욕조에 담그어 헤파RG 세포의 저통로 배치를 녹여 서 녹입니다.확산 배지의 10 밀리리터를 포함하는 15 밀리리터 튜브로 세포를 급속하게 전송합니다. 5 분 동안 원심 분리 후, 상체를 버리고 확산 매체의 5 밀리리터에서 세포를 다시 중단합니다. 세포를 계산하고 평방 센티미터 당 250, 000 세포를 플레이트하기 위해 희석하십시오.세포를 100mm 세포 배양 접시에 접시에 접시를 매고 2 ~ 3 일마다 배지를 갱신하십시오. 세포는 약 24 시간의 두 배 시간으로 증식합니다. HepaRG 세포가 80%의 인플루엔자에 도달하면 0.05%의 트립신 용액으로 3-5분 간 배양을 통해 분리합니다.이전과 같이 5 분 동안 증식 매체 및 원심 분리기에서 세포를 수집합니다. 상체를 버리고 확산 매체의 5 밀리리터로 세포를 다시 중단합니다. 다시 말하지만, 세포를 계산하고 평방 센티미터 당 250, 000 세포를 플레이트하기 위해 희석하십시오.이 단계에서는 이러한 단계를 반복하여 실험을 시작하기 위해 적절한 수의 세포에 도달하여 세포를 증폭시합니다. HepaRG 세포를 냉동 보존하려면 0.05 %의 트립신 용액으로 3 ~ 5 분 배양을 통해 도금 후 24 시간을 세포를 분리하십시오. 이전과 같이 5 분 동안 증식 매체 및 원심 분리기에서 세포를 수집합니다.상체를 버리고, 동결 매체의 배치당 1 밀리리터로 세포를 재연하고, 액체 질소의 배치를 냉동 보존한다. 제로 일째에, 종자 HepaRG 세포에서 250, 평방 센티미터 당 000 세포는 확산 배지의 적당한 양량으로 배양 처리 된 접시로. 두 가지 요리는 각 분석체에 대해 도금되어야하며, 하나는 제어 셀용과 올레아테 처리 된 세포를 위해 하나.둘째 날과 4일째에, 배지를 적절한 양의 증식 배지로 변경하고 결합에 도달할 때까지 세포가 성장하도록 합니다. 7일째에, 세포는 100% 혼잡해야 합니다. 1X PBS로 한 번 씻어내다.그런 다음 1X PBS를 제거하고 적절한 분화 매체를 추가합니다. 8일, 9일, 12, 15일, 18일에는 1X PBS로 세포를 한 번 세척한 후 적절한 분화 배지를 첨가한다. 21일째에, 현미경의 밑에 HepaRG 세포를 관찰하고 세포가 분화된 배양물이다는 것을 확인하십시오.대조군으로서, 분화 마커 유전자의 유전자 발현 분석을 수행하기 위해 하나의 대조군 접시를 수확한다. 21일째에, 분화한 HepaRG 세포는 액체 질소에서 냉동 보존될 수 있다. 21일, 완전한 분화 배지의 적절한 부피로 올레아테를 희석하여 최종 농도250 마이크로몰라를 섭취한다.차량 제어 처리를 만들기 위해 차별화 매체의 또 다른 알리쿼트에 1~400의 비율로 99%의 메탄올을 추가합니다. 1X PBS로 세포를 한 번 씻고 차량 또는 올레아테 나트륨 배지를 추가합니다. 23일일과 25일에는 갓 준비된 매체의 적절한 부피로 매체를 변경한다.26일째에, 광학 현미경 검사법에 의해 세포를 관찰한다. 지질 방울은 올레아트 나트륨 처리 된 세포에 축적되고 세포질에서 반투명 방울로 쉽게 볼 수 있습니다. 오일 레드 O 염색을 수행하려면 먼저 1X PBS로 한 번 세포를 세척하고 1X PBS를 완전히 제거합니다.4%의 파라포름알데히드를 넣고 실온에서 15분 동안 배양합니다. 파라포름알데히드를 제거하고 1X PBS로 두 번 세척합니다. PBS를 제거한 후 실온에서 5분 동안 60%의 이소프로파놀로 세포를 배양합니다.이소프로파놀을 제거하고 실온에서 세포가 완전히 건조하게 하십시오. 이제 오일 레드 O 작업 용액을 세포에 추가하고 실온에서 30 분 동안 배양하십시오. 각 샘플에 필요한 작업 용액의 양은 세포를 배양하는 데 사용되는 미디어의 양에 해당합니다.오일 레드 O 용액을 제거하고 즉시 이중 증류수를 추가합니다. 이중 증류수로 세포를 4번 세척한 후 현미경으로 이미지를 획득하여 분석을 수행합니다. 오일 레드 O 염료를 엘ute하려면 모든 물을 제거하고 건조할 수 있습니다.그런 다음 100%의 이소프로판올 1밀리리터를 넣고 실온에서 부드럽게 흔들리며 10분 동안 배양합니다. 에례 오일 레드 O 염료가 여러 번 이소프로파놀을 피펫하여 모든 오일 레드 O가 용액에 있는지 확인합니다. 솔루션을 큐벳으로 전송합니다.분광측약에 의해 500 나노미터에서 광학 밀도를 측정하고 100%이소프로판올을 빈값으로 사용합니다. 1X PBS로 한 번 씻어내다. 그런 다음, 보디피의 100 나노 몰러와 함께 1X PBS에서 37섭씨에서 40분 동안 희석합니다.유동 세포측정측정에 스테인드 컨트롤이 포함되어야 합니다. 염색 용액을 제거하고 1X PBS로 한 번 셀을 세척합니다. 그런 다음 세포를 다시 씻고 PBS를 완전히 제거하십시오.4%의 파라포름알데히드를 넣고 실온에서 15분 동안 배양합니다. 파라포름알데히드를 제거하고 PBS에서 5분 동안 샘플을 세 번 세척합니다. 셀은 섭씨 4도에서 1X PBS로 보관하거나 즉시 이미지화할 수 있습니다.보관을 위해 파라필름으로 감싸고 알루미늄 호일로 덮어 세포가 건조되는 것을 방지합니다. 스테토시스의 효율적인 유도를 확인하기 위해, oleate 처리 및 제어 HepaRG 세포는 오일 레드 O 염료로 염색하였다. 염색 후, 지질 방울은 쉽게 붉은 방울로 볼 수 있습니다.염색은 이소프로판올로 용출된 오일 R O 염료의 분광측정 측정에 의해 정량화될 수 있다. 세포로부터 용출된 오일 레드 O의 흡수성은 세포질 지질 액적 축적에 직접 비례한다. 나트륨 oleate 농도 및 노출 시간은 MTT 착색 세포 생존성 분석에 의해 결정되었다.Formosan 제품은 490 나노미터의 흡광도에 의해 정량화되며 배양시 살아있는 세포의 수에 정비례합니다. 나트륨 oleate 치료는 나트륨 팔미타트 치료에 비교되었다. 아포톡톡스 약물 독소루비신은 대조군으로 사용되었다.올레아테 나트륨 치료 후 세포 지질 함량의 증가를 정량화하기 위해, 보디피 염료로 염색하는 것은 지질 방울을 라벨에 사용되었다. 세포형경화 분석을 이용하여, 대조군 세포에 비해 올레아테 처리된 세포에서 더 높은 보디피에 의한 트리글리세라이드 함량을 정량화할 수 있다. 이것은 oleate 처리 후에 효율적인 지방 축적을 나타냅니다.실제로 Bodipy 염색 된 세포의 이미지는 대조군 세포에서 볼 수없는 올레아테 처리 된 세포에서 밝은 녹색 형광 지질 방울을 보여줍니다. 올레아테 나트륨 치료 후 지질 방울의 축적을 더욱 특성화하기 위해, CARS 현미경검사는 라벨없이 지질 방울 정량화를 가능하게 하는 텍스트 프로토콜에 설명된 대로 수행될 수 있다. 이 세포 기지를 둔 모형은 비 온코틱 지방 간 질병에 관련되은 분자 기계장치의 지식을 증가할 수 있고 조기 진단 및 새로운 처리 전략을 위한 새로운 마커의 발달로 이끌어 낼 수 있었습니다.

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

인간 치과 펄프의 줄기 세포의 분리, 특성화 및 비교 차별화 두 가지 방법을 사용하여 영구 치아에서 파생

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

연구

의학

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

쥐에서 동맥 경화 수스 Myointimal 증식을 유도 : 두 개의 유효한 모델의 소개

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

쥐 심근 경색을 유도 최소 침습 수술

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

녹내장 유도 절차<em&gt; 생체</em&gt; 쥐 모델 및 전체 마운트 망막 준비

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

면역 반응의 생체 내에 다중 광자 이미징을위한 마우스 귀 피부에 유도 허혈 - 재관류 손상

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

포스 콜린 유발 장내 Organoids에 붓기 일 :<em&gt; 체외</em&gt; 분석 낭포 성 섬유증 환자의 약물 반응을 평가하기위한

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

의 최적화 분석<em&gt; 생체</em&gt; 및<em&gt; 체외</em&gt; 간 지방증

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

직접 경포당증 주입에 의해 마우스에 있는 심각한 폐 상해를 유도하는

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

마우스의 힌들보에서 보조 림프부종을 유도하기위한 개정 된 방법

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...