Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Agradecemos al profesor Christian Trepo (INSERM U871, Lyon, Francia), quien amablemente proporcionó células HepaRG. Estamos agradecidos a Rita Appodia por su ayuda administrativa. Este trabajo fue apoyado por MIUR- Ministero dell'istruzione, dell'universitá e della ricerca (FIRB 2011-2016 RBAP10XKNC) y la Universidad Sapienza de Roma (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

1. Preparación de medios y reactivos culturales
<ol><li>Medio proliferante: suplemento medio E de William con GlutaMAX, suero bovino 10% fetal (FBS), 1% penicilina/estreptomicina, 5 g/ml y hemisuccinato de hidrocortisona de 0,5 m.</li>
	<li>Medio de diferenciación: suplemento medio E de William con GlutaMAX, 10% FBS, 1% penicilina/estreptomicina, insulina de 5 g/ml, hemisuccinato de hidrocortisona de 50 oM y 2% DMSO.</li>
	<li>Medio de congelación: suplemento proliferando medio con 10% DMSO.</li>
	<li>Oleato de sodi...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

Este protocolo describe cómo diferenciar las células HepaRG y cómo inducir esteatosis vesicular mediante el tratamiento con oleato sódico (Figura1A). De hecho, en comparación con otras líneas celulares de carcinoma hepatocelular humano (HCC), la línea celular HepaRG presenta características de hepatocitos humanos adultos, lo que representa una valiosa alternativa a los hepatocitos humanos primarios cultivados ex vivo13,<sup class="x...

La esteatosis hepática se define como acumulación de grasa intrahepática, dentro de las gotas lipídicas que contienen triglicéridos, de al menos el 5% del peso hepático. El almacenamiento prolongado de lípidos hepáticos es un proceso potencialmente reversible, sin embargo, puede conducir a disfunción metabólica hepática, inflamación y formas avanzadas de enfermedad del hígado graso no alcohólico (NAFLD), la causa predominante de la enfermedad hepática crónica en muchas partes de el mundo1,2. La NAFLD es una enfermedad multifactorial que puede evolucionar a la esteatohepatitis no alcohólica (NASH) más agresiva, que a su vez puede progresar a cirrosis y, en un pequeño porcentaje de pacientes, al carcinoma hepatocelular (HCC)1,3. Actualmente no se dispone de terapia aprobada como tratamiento específico para el NAFLD y la combinación de modificaciones de dieta y estilo de vida sigue siendo el pilar de la gestión de NAFLD y NASH4,5,6.
Los mecanismos moleculares que conducen al desarrollo de esteatosis hepática en la patogénesis de la NAFLD todavía están por esclarecer 7 . En este contexto, se han desarrollado modelos de ratón para estudiar la progresión de la enfermedad de la esteatosis humana. Existe una gran variedad de modelos diferentes, y cada uno tiene sus ventajas y desventajas, incluyendo modelos genéticos, nutricionales y químicamente inducidos que combinan diferentes enfoques. Los ratones genéticamente modificados (transgénicos o noqueadores) desarrollan espontáneamente enfermedad hepática. Sin embargo, cabe señalar que estas mutaciones son muy raras en los seres humanos y la deleción o la sobreexpresión de un solo gen (por ejemplo, ratón ob/ob) pueden no imitar la etiología de la enfermedad humana multifactorial a nivel molecular8,9. Del mismo modo, la enfermedad adquirida por los ratones después de la manipulación dietética o farmacológica puede no imitar los efectos de las dietas humanas asociadas con el desarrollo de NAFLD en el hombre8. Sin embargo, los modelos animales han facilitado la evolución de la NAFLD y este enfoque es actualmente la estrategia más utilizada en la investigación de laboratorio. Sin embargo, la replicación en humanos de los resultados obtenidos en modelos animales ha fracasado repetidamente, causando una mala traducción a la clínica10.
Por lo tanto, los modelos in vitro de NAFLD pueden desempeñar un papel fundamental en la esclarecimiento de los mecanismos moleculares de la progresión de la NAFLD, y representan una herramienta valiosa para examinar un gran número de compuestos. Cultivos celulares primarios, líneas celulares inmortalizadas y biopsias hepáticas se han utilizado ampliamente con fines de investigación11. Los hepatocitos humanos primarios se asemejan mucho a las condiciones clínicas humanas, pero hay un número limitado de donantes, y los cultivos celulares primarios muestran una reproducción deficiente debido a la variabilidad de las células. Estas observaciones, junto con cuestiones éticas y logísticas, han dado lugar a que el uso de hepatocitos primarios humanos sea limitado12. Por lo tanto, las líneas de células hepáticas representan una alternativa conveniente, teniendo varias ventajas esenciales sobre el cultivo primario, ya que las líneas celulares hepáticas crecen constantemente, tienen una vida útil casi ilimitada, y tienen un fenotipo estable. Además, las líneas celulares son fácilmente accesibles y las condiciones de cultivo de las líneas celulares hepáticas son más simples que las de los hepatocitos primarios y están estandarizadas entre diferentes laboratorios.
Aquí, describimos en detalle un modelo in vitro basado en células de esteatosis vesicular hepática, representado por células HepaRG diferenciadas hepáticas tratadas con el oleato de sodio de ácido graso. La línea celular hepargal se estableció a partir de una paciente afectada por la infección por hepatitis C y un tumor hepático bien diferenciado de grado I de Edmondson14. La línea celular HepaRG es una línea celular progenitora bipotente humana capaz de diferenciarse al exponerse al 2% de sulfóxido de dimetil (DMSO) hacia dos fenotipos celulares diferentes: células biliares y células similares a hepatocitos. Las células HepaRG diferenciadas (dHepaRG) comparten algunas características y propiedades con hepatocitos adultos y poseen la capacidad de expresar de forma estable genes específicos del hígado como la albúmina, AldolaseB, el citocromo P450 2E1 (CYP2E1) y el citocromo P450 3A4 (CYP3A4)13 (paso 3). El tratamiento de las células dHepaRG con el oleato sódico de sal de ácido graso (250 m) durante 5 días conduce a la generación de gotas lipídicas citoplásmáticas, imitando los efectos del hígado graso14,15,17,18 ( paso 4). La acumulación de gotas lipídicas puede ser fácilmente detectada por la tinción de aceite rojo O (paso 5), un tinte soluble en grasa lisocromo que mancha triglicéridos neutros y lípidos rojo-naranja. Para cuantificar eficientemente los lípidos en dHepaRG graso, aquí ilustramos el análisis citofluorimétrico después de la tinción con 4,4-difluoro-1,3,5,7-tetrametil-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (paso 6), una sonda fluorescente lipofílica que localiza a cuerpos de lípidos intracelulares y se ha utilizado para etiquetar las gotas de lípidos19. Además, aquí mostramos cómo evaluar la esteatosis mediante la reacción cuantitativa en cadena de la polimerasa (qPCR) (paso 7) desregulación de la expresión génica de varios genes metabólicos en células dHepaRG. Para caracterizar y cuantificar aún más la acumulación de gotas de lípidos después del tratamiento con oleato sódico, realizamos una microscopía coherente de dispersión anti-Stokes Raman (CARS) (paso 8), una técnica innovadora que permite la visualización y cuantificación de gotas de lípidos sin etiquetar20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

La esteatosis hepática representa una disfunción metabólica que resulta de una acumulación de gotas lipídicas que contienen triglicéridos en hepatocitos. La acumulación excesiva de grasa conduce a una enfermedad del hígado graso no alcohólico (NAFLD), que es potencialmente reversible y puede evolucionar a esteatohepatitis no alcohólica (NASH) y, finalmente, a cirrosis y carcinoma hepatocelular (HCC). Los mecanismos moleculares que vinculan la acumulación de lípidos en hepatocitos con la progresión a NASH, daño hepático irreversible, fibrosis, cirrosis, e incluso HCC todavía no está claro. Para ello, se han desarrollado varios modelos in vitro e in vivo para dilucidar los procesos patológicos que causan la NAFLD. En el presente estudio, describimos un modelo celular para la inducción de esteatosis vesicular hepática que consiste en células HepaRG hepáticas humanas diferenciadas por DMSO tratadas con el oleato de sodio de sal de ácido graso. De hecho, las células HepaRG tratadas con oleato sódico acumulan gotas lipídicas en el citoplasma y muestran características típicas de la esteatosis. Este modelo humano in vitro representa una alternativa valiosa a los modelos de ratones in vivo, así como a los principales hepatocitos humanos. También presentamos una comparación de varios métodos para la cuantificación y evaluación de la acumulación de grasa en células HepaRG, incluyendo la tinción de aceite rojo O, la medición de Bodipy citofluorimétrica, el análisis de la expresión génica metabólica por qPCR y los anti-Stokes coherentes Microscopía de dispersión Raman (CARS). La imagen CARS combina la especificidad química de la espectroscopia Raman, una técnica de análisis químico bien conocida en aplicaciones de ciencia de materiales, con los beneficios de las microscopías ópticas no lineales de alta velocidad y alta resolución para permitir una precisión precisa cuantificación de la acumulación de lípidos y la dinámica de gotas de lípidos. El establecimiento de un modelo in vitro eficiente para la inducción de esteatosis vesicular, junto con un método preciso para la cuantificación y caracterización de la acumulación de lípidos, podría conducir al desarrollo de un diagnóstico en etapa temprana de NAFLD a través de la identificación de marcadores moleculares, y a la generación de nuevas estrategias de tratamiento.

Este protocolo describe un método eficaz para inducir y caracterizar la esteatosis vesicular en células HepaRG diferenciadas por DMSO mediante tratamiento con oleato sódico (Figura1A).
Diferenciación de células HepaRG. Para inducir eficientemente la diferenciación, las células que proliferan deben ser sembradas a baja densidad (2,5 x 104 células/cm2)en el medio de proliferación. Cuando se sembran ...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

En este estudio, describimos un protocolo detallado para inducir esteatosis vesicular hepática en células HepaRG diferenciadas con el oleato de sodio de sal de ácido graso y empleamos métodos para la detección y cuantificación de la acumulación de lípidos, incluyendo anti-Stokes coherentes Microscopía de dispersión Raman (CARS), análisis citofluorimétrico, tinción O de color rojo aceite y qPCR.

Inducir y caracterizar la esteatosis vesicular en células hepa-repartidas diferenciadas

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

Este protocolo describe cómo inducir la esteatosis vesicular hepática en células HepaRG diferenciadas y métodos para la detección y cuantificación de la acumulación de lípidos. Este modelo de células humanas in vitro representa una alternativa valiosa a los modelos de ratones in vivo y a los hepatocitos humanos primarios. Descongelar un lote crioconservado de nitrógeno de células de paso bajo de células HepaRG sumergiéndolas en un baño de 37 grados Celsius hasta que se descongelaron.Transfiera rápidamente las células a un tubo de 15 mililitros que contenga 10 mililitros de medio proliferante. Después de centrifugar durante cinco minutos, deseche el sobrenadante y resuspend las células en cinco mililitros de medio proliferante. Contar las células y diluir con el fin de platear 250.000 células por centímetro cuadrado.Plato de las células en platos de cultivo celular de 100 milímetros y renovar el medio cada dos o tres días. Las células proliferan con un tiempo de duplicación de alrededor de 24 horas. Una vez que las células HepaRG alcanzan el 80% de confluencia, desprendedlas a través de una incubación de tres a cinco minutos con una solución de 0,05% de trippsina.Recoger las células en medio proliferador y centrifugar durante cinco minutos como antes. Desechar el sobrenadante y resuspender las células con cinco mililitros de medio proliferante. Una vez más, contar las células y diluir con el fin de platear 250.000 células por centímetro cuadrado.En esta etapa, amplificar las células repitiendo estos pasos para alcanzar un número adecuado de células para iniciar experimentos. Para criopreservar las células hepaRG, desprenda las células 24 horas después del enchapado a través de una incubación de tres a cinco minutos con una solución de 0,05% de trippsina. Recoger las células en medio proliferador y centrifugar durante cinco minutos como antes.Desechar el sobrenadante, resuspender las células en un mililitro por lote de medio de congelación y criopreservar los lotes en nitrógeno líquido. En el día cero, las células HepaRG de semillas a 250.000 células por centímetro cuadrado en platos tratados con cultivo con un volumen adecuado de medio de proliferación. Hay que planchar dos platos para cada ensayo, uno para las células de control y otro para las células tratadas con oleato.En el día dos y cuarto, cambie el medio con un volumen adecuado de medio de proliferación y deje que las células crezcan hasta que alcancen la confluencia. En el séptimo día, las células deben ser 100%confluentes. Lave las células una vez con 1X PBS.A continuación, retire el 1X PBS y agregue un volumen adecuado de medio de diferenciación. En los días ocho, nueve, 12, 15 y 18, lave las células una vez con 1X PBS antes de agregar un volumen adecuado de medio de diferenciación. En el día 21, observe las células HepaRG bajo un microscopio y asegúrese de que las células son cultivos diferenciados confluentes.Como control, cosecha un plato de control para realizar análisis de expresión génica de genes marcadores de diferenciación. En el día 21, las células HepaRG diferenciadas se pueden crioconservarse en nitrógeno líquido. En el día 21, diluir el oleato sódico con un volumen adecuado de medio de diferenciación completa a una concentración final de 250 micromolares.Añadir 99%metanol en una proporción de uno a 400 en otra alícuota de medio de diferenciación para hacer el tratamiento de control del vehículo. Lave las células una vez con 1X PBS y agregue el medio de oleato de vehículo o sodio. El día 23 y el día 25, cambie el medio con el volumen adecuado de medio recién preparado.El día 26, observe las células por microscopía óptica. Las gotas de lípidos se acumulan en las células tratadas con oleato de sodio y son fácilmente visibles como gotas translúcidas en el citoplasma. Para realizar la tinción de Aceite Rojo O, primero lave las células una vez con 1X PBS y retire el 1X PBS completamente.Añadir 4%paraformaldehído e incubar durante 15 minutos a temperatura ambiente. Retire el paraformaldehído y lave las células dos veces con 1X PBS. Después de retirar el PBS, incubar las células con 60%isopropanol durante cinco minutos a temperatura ambiente.Retire el isopropanol y deje que las células se sequen completamente a temperatura ambiente. Ahora agregue la solución de trabajo Oil Red O a las células e incubar a temperatura ambiente durante 30 minutos. El volumen de solución de trabajo necesario para cada muestra corresponde al volumen de medios utilizados para el cultivo de las células.Retire la solución Oil Red O y agregue inmediatamente agua doble destilada. Después de lavar las células cuatro veces con agua de doble destilación, adquiera imágenes bajo el microscopio para su análisis. Para elecer el tinte Oil Red O, retire toda el agua y deje secar.Luego, agregue un mililitro de 100%isopropanol e incubar durante 10 minutos con un suave temblor a temperatura ambiente. Pipetear el isopropanol con aceite eluido O tinte arriba y abajo varias veces, asegurando que todo el aceite rojo O está en la solución. Transfiera la solución a una cubeta.Mida la densidad óptica a 500 nanómetros por espectrofotometría y utilice 100%isopropanol como blanco. Lave las células una vez con 1X PBS. Luego, incubar con 100 nanomolares de Bodipy diluidos en 1X PBS en la oscuridad durante 40 minutos a 37 grados Celsius.Se debe incluir un control no manchado en las mediciones de citometría de flujo. Retire la solución de tinción y lave las células una vez con 1X PBS. Luego, lave las células de nuevo y retire el PBS por completo.Añadir 4%paraformaldehído e incubar durante 15 minutos a temperatura ambiente. Retire el paraformaldehído y lave las muestras tres veces durante cinco minutos en PBS. Las celdas se pueden mantener en 1X PBS a cuatro grados Celsius o se pueden obtener imágenes inmediatamente.Para el almacenamiento, envuelva con Parafilm y cubra con papel de aluminio para evitar que las células se sequen. Para verificar la inducción eficiente de la esteatosis, las células hepatRnóricas tratadas con oleato y control se tiñeron con el tinte Oil Red O. Después de la tinción, las gotas de lípidos son fácilmente visibles como gotas rojas.La tinción se puede cuantificar mediante la medición espectrofotométrica del tinte Oil R O eluido con isopropanol. La absorción del aceite eluido Rojo O de las células es directamente proporcional a la acumulación de gotas lipídicas citoplasmáticos. La concentración de oleato de sodio y el tiempo de exposición se determinaron mediante el ensayo de viabilidad celular colorimétrica MTT.El producto Formosan se cuantifica por su absorbancia a 490 nanómetros y es directamente proporcional al número de células vivas en cultivo. El tratamiento con oleato de sodio se comparó con el tratamiento con palmitato de sodio. El fármaco apoptótico doxorubicina fue utilizado como un control.Para cuantificar el aumento del contenido de lípidos celulares después del tratamiento con oleato de sodio, se utilizó la tinción con tinte Bodipy para etiquetar las gotas lipídicas. Utilizando el análisis citofluorométrico, es posible cuantificar el contenido de triglicéridos por intensidad fluorescente media de Bodipy, que es mayor en las células tratadas con oleato en comparación con las células de control. Esto indica una acumulación eficiente de grasa después del tratamiento con oleato.De hecho, las imágenes de células teñidas de Bodipy muestran gotas de lípidos fluorescentes de color verde brillante en células tratadas con oleato que no son visibles en las células de control. Para caracterizar aún más la acumulación de gotas de lípidos después del tratamiento con oleato de sodio, la microscopía CARS se puede realizar como se describe en el protocolo de texto que permite la cuantificación de gotas lipídicas sin etiquetado. Este modelo basado en células puede aumentar el conocimiento de los mecanismos moleculares involucrados en la enfermedad del hígado graso no oncótico y podría conducir al desarrollo de nuevos marcadores para el diagnóstico temprano y nuevas estrategias de tratamiento.

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Diferenciación de aislamiento, caracterización y comparativo de las células madre derivadas de la Pulpa Dental de los dientes permanentes mediante dos métodos diferentes

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Investigación

Medicina

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Inducir miointimal Hiperplasia Versus aterosclerosis en ratones: una introducción de dos modelos válidos

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Mínimo procedimiento quirúrgico invasivo de inducir infarto de miocardio en ratones

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

El estudio de cáncer de páncreas Tallo Características de las células para el desarrollo de nuevas estrategias de tratamiento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma de inducir en un Procedimiento<em&gt; En Vivo</em&gt; Modelo de rata y Todo el montaje-Retina Preparación

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

La inducción de la lesión por isquemia-reperfusión en la piel de la oreja del ratón para intravital n fotones de imágenes de la respuesta inmune

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Inducida por la forskolina Hinchazón en organoides intestinal: Una<em&gt; In Vitro</em&gt; Ensayo para evaluar la respuesta de drogas en pacientes con fibrosis quística

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Análisis optimizada de<em&gt; En Vivo</em&gt; y<em&gt; In Vitro</em&gt; La esteatosis hepática

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Inducir lesión pulmonar aguda en ratones por instilación directa de lipopolisacárido intratraal

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

Un método revisado para inducir el linfedema secundario en la extremidad posterior de los ratones

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...