Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

وقد تم دعم هذا العمل جزئيا من قبل JSPS KAKENHI منحة رقم 18K15141 إلى Y.T.

ملاحظة: ويرد في الشكل 1عرض عام للتدفق التجريبي بأكمله.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> الشكل 1: نظرة عامة على تجربة خروج المغلوب باستخدام EA. يتم حصاد التربومستجوتات المشتقة من زراعة الأنسجة وتمييزها في EA. يتم...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

لقد أثبتنا أن الثقافة الفأسية لـ T. cruzi amastigotes يمكن استخدامها في ضربة قاضية للجين كريسبر/كاس9 بوساطة، وذلك عن طريق الكهربائي gRNA مباشرة إلى Cas9-التعبير عن EA. وبهذه الطريقة، يمكن تقييم ضرورة الجين المستهدف على وجه التحديد في مرحلة الماستيغوت دون المرور بمراحل تنموية أخرى.
ج?...

تريبانوسوما كروزي هو العامل المسبب لمرض شاغاس ، والذي ينتشر بشكل رئيسي في أمريكا اللاتينية1. T. كروزي لديه مراحل دورة حياة مميزة كما أنه يسافر بين ناقلات الحشرات ومضيف الثدييات2. T. كروزي يكرر كما الظهارة في midgut من علة ترياتوميمين مص الدم ويميز في trypomastigote المعدية في الجزء الخلفي قبل أن تودع على الإنسان أو الحيوان المضيف. مرة واحدة في trypomastigote يحصل في الجسم المضيف من خلال موقع لدغة أو من خلال غشاء المخاطية، والطفيلي يغزو خلية المضيف ويتحول إلى شكل جولة فلاجيلا أقل تسمى amastigote. ينسخ ال [أمستجوت] داخل المضيفة خلية و [إينرتيم] أخيرا يميّز داخل [تريبومستغوت], أيّ ينفجر من المضيفة خلية ويدخل الدم مجرى أن يصيب آخر مضيفة خلية.
منذ وكلاء العلاج الكيميائي المتاحة حاليا, benznidazole وnifurtimox, تسبب الآثار الجانبية السلبية وغير فعالة في المرحلة المزمنة من المرض3, فمن مصلحة كبيرة لتحديد أهداف المخدرات جديدة ضد T. كروزي. في السنوات الأخيرة، أصبح نظام CRISPR/Cas9 أداة قوية لأداء الجينات بالضربة القاضية بشكل فعال في T. cruzi، إما عن طريق نقل بلازميد منفصل أو واحد يحتوي على gRNA و Cas94، من خلال التعبير المستقر عن Cas9 واللاحقة إدخال gRNA5،6،7 أو قالب النسخ من gRNA8،أو عن طريق الكهربائي من مجمع gRNA /Cas9 RNP شكلت مسبقا7،9. ومن المتوقع إلى حد كبير أن يسرع هذا التقدم التكنولوجي في البحوث التي تستهدف المخدرات في مرض شاغاس.
للمضي قدما في تطوير المخدرات ، من الأهمية بمكان التحقق من أهمية الجين المستهدف أو فعالية المركبات المرشحة للأدوية في amastigote T. cruzi، كما هو مرحلة النسخ المتماثل للطفيلي في المضيف الثدييات. ومع ذلك، هذه مهمة صعبة، لأنه لا يمكن التلاعب بـ amastigotes مباشرة بسبب وجود خلية مضيف معرقلة. في ليشمانيا، وهو طفيلي بروتوزوان وثيق الصلة إلى T. cruzi، تم تطوير طريقة زراعة الماستيجوت الفأسية واستخدمت في فحص المخدرات الاختبارات10،11،12، 13.على الرغم من أن هناك بعض الاختلافات في قابلية المركبات بين الماستيغوتات الفأسوية وamastigotes داخل الخلايا14،والقدرة على الحفاظ على ثقافة الفأس مع ذلك يوفر أدوات تجريبية قيمة لدراسة البيولوجيا الأساسية للمرحلة ذات الصلة سريريا من الليشمانيا15،16. في حالة T. كروزي، والآداب فيما يتعلق بوجود amastigotes خارج الخلية التي تحدث بشكل طبيعي (EA)17 وفي إنتاج المختبر من EA17،18،19 يعود تاريخها إلى منذ عقود. وبالإضافة إلى ذلك، من المعروف أن EA لديها قدرة معدية20، وإن كان أقل من ذلك من trypomastigote، وقد تم توضيح آلية غزو المضيف amastigote في السنوات الأخيرة (استعرض من قبل Bonfim-Melo وآخرون21). ومع ذلك، على عكس ليشمانيا، لم يتم استخدام EA كأداة تجريبية في T. cruzi، ويرجع ذلك في المقام الأول إلى أن EA كان يعتبر طفيلي داخل الخلايا ملزمة ، وبالتالي لم يكن يعتبر "شكل التكرار" في عملية معني.
في الآونة الأخيرة، اقترحت مجموعتنا للاستفادة من EA من T. كروزي كثقافة axenic الزمنية22. Amastigotes من سلالة T. كروزي تولاهوين يمكن تكرار خالية من الخلايا المضيفة في وسط LIT في 37 درجة مئوية لمدة تصل إلى 10 أيام دون تدهور كبير أو فقدان خصائص تشبه amastigote. خلال فترة النمو الخالية من المضيف، تم استخدام EA بنجاح للتعبير الجيني الخارجي عن طريق الكهربة التقليدية، وفحص معايرة المخدرات مع مركبات التربانوسيدال، وخروج المغلوب كريسبر/كاس9 بوساطة تليها رصد النمط الظاهري للنمو. في هذا التقرير، ونحن نصف البروتوكول التفصيلي لإنتاج في المختبر المستمدة EA واستخدام amastigote axenic في تجارب خروج المغلوب.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

تريبانوسوما كروزي هو طفيلي بروتوزوان المسبب للأمراض الذي يسبب مرض شاغاس بشكل رئيسي في أمريكا اللاتينية. من أجل تحديد هدف جديد للمخدرات ضد T. cruzi، من المهم التحقق من صحة ضرورة الجينات المستهدفة في مرحلة الثدييات من الطفيلي ، وamastigote. Amastigotes من T. كروزي تكرار داخل الخلية المضيفة; وبالتالي، فإنه من الصعب إجراء تجربة خروج المغلوب دون الذهاب من خلال مراحل التنمية الأخرى. في الآونة الأخيرة، أبلغت مجموعتنا عن حالة نمو يمكن فيها للamastigote تكرار axenically لمدة تصل إلى 10 أيام دون أن تفقد خصائصها الشبيهة بamastigote. باستخدام هذه الثقافة amastigote axenic الزمنية، قدمنا بنجاح gRNAs مباشرة في Amastigote Cas9 التعبير عن التسبب في خروج المغلوب الجينات وتحليل الأنماط الظاهرية الخاصة بهم حصرا في مرحلة amastigote. في هذا التقرير، نقوم بوصف بروتوكول مفصل لإنتاج في المختبر المستمدة من الماستيغوت، والاستفادة من ثقافة الفأس في تجربة خروج المغلوب كريسبر / Cas9 بوساطة. يمكن تقييم النمط الظاهري للنمو من amastigotes بالضربة القاضية إما عن طريق عدد الخلايا من الثقافة axenic، أو عن طريق النسخ المتماثل من amastigote داخل الخلايا بعد غزو الخلية المضيفة. هذا الأسلوب يتجاوز التمايز مرحلة الطفيلي تشارك عادة في إنتاج amastigote المعدلة وراثيا أو بالضربة القاضية. استخدام ثقافة الماستيغوت الفأس الزمنية لديه القدرة على توسيع الحرية التجريبية للدراسات الخاصة بمرحلة محددة في T. cruzi.

عزل التريبوماستيغوت اتّبأ من خلال إجراء السباحة
لحصاد التربومستجوتات الطازجة من تلوث EAs القديمة عن طريق إجراء السباحة التدريجي ، يجب أن يتم احتضان كريات الخلايا لمدة 1 ساعة على الأقل. الشكل 2باء). في هذه التجربة بالذات، كانت النسبة المئوية للtrypomastigot...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

إدخال الجين بالضربة القاضية مباشرة في مرحلة Amastigote من التريبانوسوما كروزي باستخدام نظام CRISPR/Cas9

هنا، ونحن نصف بروتوكول لإدخال ضربة قاضية الجينات في amastigote خارج الخلية من التريبانوسوما كروزي، وذلك باستخدام نظام كريسبر / Cas9. ويمكن متابعة النمط الظاهري للنمو إما عن طريق عد الخلايا من ثقافة الماستيغوت الفأس أو عن طريق انتشار الماستيغوت داخل الخلايا بعد غزو الخلية المضيفة.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

من الصعب استخدام مرحلة العدوى المضيفة من T.cruzi في التجارب لأن amastigote هو طفيلي داخل الخلايا الملزمة. يسمح أسلوب الاستزراع لدينا للماستيكوت بالتكرار المؤقت خارج الخلية المضيفة ، حتى نتمكن من إجراء تجارب مباشرة على هذه المرحلة ذات الصلة سريريًا من الطفيلي. وسوف يكون إثبات الإجراء يوكي أكوتسو، وهو فني من معهدنا.الحفاظ على ثقافة مُضيفة للطفليين وفقًا لاتجاهات المخطوطة. عندما يكون الطفيلي الذي يعبر عن Cas9 جاهزًا للتمايز ، اجمع المافق في أنبوب مخروطي ، وتحقق من جودة العينة تحت المجهر. إذا كان هناك عدد كبير من amastigotes خارج الخلية، تنفيذ إجراء السباحة خارج لعزل trypomastigotes.تدور أسفل خليط من تريبوماستيغوست وmamastigotes لمدة خمس عشرة دقيقة كما 2، 100 مرة G.ثم تجاهل معظم supernatant، وترك 0.5 إلى 1 ملليلتر من المتوسطة في الأنبوب. فضفاضة غطاء الأنبوب، واحتضان بيليه في 37 درجة مئوية لمدة ساعة إلى ساعتين، والتي سوف تسمح ل trypomastigotes النشطة للسباحة من بيليه. بعد الحضانة، نقل سوبرناتور مع trypomastigotes إلى أنبوب microcentuge 1.5 ملليلتر.تدور عليه، وإعادة تعليق بيليه مع 5 ملليلتر من DMEM. نقل الطفيلي إلى قارورة ثقافة T-25 ، واحتضان القارورة عند درجة حرارة 37 درجة مئوية تحت 5 ٪ من ثاني أكسيد الكربون في حاضنة مرطبة. سيتمايز حوالي 95٪ من الطفيليات إلى amastigotes بعد 24 ساعة.جهاز طرد مركزي ثقافة amastigotes خارج الخلية لمدة 15 دقيقة في 2، 100 مرة G، والتخلص من الفائق. resuspend بيليه مع العازلة الكهربائية التي تحتوي على ملحق حل إلى كثافة الخلية النهائية من 10 مرات إلى الخلايا 8 في المليلتر. Aliquot 100 ميكرولترات من الطفيليات resuspended في 1.5 لتر microcentrifuge الأنابيب.ثم إضافة خمسة إلى 10 ميكروغرام من الجيش الملكي النيبالي دليل، ومزيج بلطف عن طريق الأنابيب. نقل الخليط إلى 2 ملليمتر فجوة الكهربائية cuvette، وتطبيق نبض مع جهاز الكهربائي. ثم، نقل محتويات cuvette في قارورة T-25، التي تحتوي على خمسة ملليلترات من متوسطة LIT مسبقًا، اترك الغطاء فضفاضًا، واحتضان القارورة عند 37 درجة مئوية تحت 5٪ من ثاني أكسيد الكربون.مراقبة نمو الخلية إما عن طريق استمرار زراعة أكسل أو كما amastigotes داخل الخلايا بعد عدوى الخلية المضيفة. إذا رصد نمو الخلية كما amastigotes axenic، يهز بلطف قارورة لإعادة تعليق amastigotes خارج الخلية في الحل، ومزيج 20 ميكرولترات من الثقافة مع ميكرولتر واحد من محلول يوديد بروبديسيوم في أنبوب microcentrifuge. من المهم عدم ترك قارورة الثقافة خارج الحاضنة لفترة أطول من اللازم لأن درجة الحرارة هي واحدة من العوامل التي تمكن من انتشار الفأس من amastigote.تطبيق العينة على قياس الهيموسيت، ومراقبته تحت المجهر الفلوري. ثم عد عدد amastigotes قابلة للحياة التي لا تلطخها مادة اليوديد بروبديسيوم. لمراقبة نمو خلايا خروج المغلوب كما amastigotes داخل الخلايا, البذور تستضيف الخلايا 3T3 في لوحة 12-well مع DMEM.بعد يوم واحد من الكهربائي جمع amastigotes خروج المغلوب عن طريق الطرد المركزي، والتخلص من supernatant، وإعادة تعليق الطفيليات مع ملليلتر اثنين من DMEM. إزالة الوسيطة من ثقافة الخلية المضيفة وإضافة amastigotes resuspended. احتضان لوحة في 37 درجة مئوية تحت 5٪ ثاني أكسيد الكربون لمدة يومين، والتي سوف تسمح amastigotes لإنشاء عدوى.بعد اليومين، وغسل بعيدا amastigotes خارج الخلية خارج الخلايا المضيف مع DMEM، وإضافة DMEM الطازجة. مواصلة الحضانة لمدة يومين إضافيين، ومن ثم تصور نواة الخلايا المضيفة وmamastigotes داخل الخلايا. وقد ثبت أن T.Cruzi amastigotes المصابة مع دليل الجيش الملكي النيبالي ضد الجين الأساسي TCCGM1 تظهر عيب كبير في النمو مقارنة مع مجموعة التحكم.عند رصد النمو كعضوس داخل الخلايا، فإن جزء النوى المضيفة المرتبطة نوى T.Cruzi أقل بكثير في مجموعة الضربة القاضية TcCGM1 مقارنة بالسيطرة. على العكس من ذلك، transfection من رنا دليل ضد واحد من بروتينات قضيب paraflagellar TcPAR1 لا يؤثر بشكل كبير على نمو الخلايا بعد أربعة أيام من زراعة أكسين أو تمنع نمو amastigotes داخل الخلايا. ومع ذلك ، خمسة أيام بعد العدوى ، وعدد من trypomastigotes التي تخرج من الخلية المضيفة هو أقل بكثير في TcPAR1 خروج المغلوب المشتركة الثقافة مقارنة مع السيطرة المشتركة الثقافة.وعلاوة على ذلك، بدا أن التجربات المختلفة داخل الخلية المضيفة في مجموعة التحكم أكثر نشاطاً من تلك الموجودة في مجموعة خروج المغلوب. ويمكن أيضا أن تستخدم هذه الطريقة لدراسة آثار الجينات الخارجية على مرحلة amastigote بدلا من RNA دليل transfecting في amastigote كاس9 التعبير عن, يمكنك نقل البلازميد في amastigote من نوع البرية للتعبير عن الجينات الخارجية.

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

باستخدام تقنية PCR-نيون الشعرية جل الكهربائي إلى التركيب الوراثي كريسبر / Cas9 بوساطة خروج المغلوب المسوخ في تنسيق عالية الإنتاجية

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

منهجية موحدة لدراسة المحدثة للطفرات في الموقع كدالة لإصلاح نقطة تحور تحفزها كريسبر/Cas9 وسودن في الخلايا البشرية

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection كريسبر/Cas9 البروتين في أجنة سمك السلور القناة، Ictalurus punctatus، لتحرير الجينات

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

بروتوكول لإنتاج ناقلات لينتيفيرال إينتيجراسي التي تفتقر لخروج المغلوب كريسبر/Cas9-بوساطة الجينات في تقسيم الخلايا

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

كفاءة الإنتاج وتحديد كريسبر/Cas9-المنشأة الضربة القاضية الجينات في "النظام النموذجي" دانيو rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

تعطيل الجينات ذات كفاءة عالية من الخلايا السلف مورين والبشرية المكونة للدم قبل كريسبر/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

البروتين الذاتية في الإنسان التي يسببها الخلايا الجذعية Pluripotent باستخدام كريسبر/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 Ribonucleoprotein بوساطة تحرير الجينات الدقيقة عن طريق أنبوب الكهربائي

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

توليد تعديلات جينية محددة باستخدام CRISPR-CAS9 في الخلايا الجذعية البشرية متعددة القوى

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

التحقيق في الدور النسخي لـ RUNX1 كاتم الصوت من قبل كريسبر/كاس9 ريبونوكليوبروتين في خلايا سرطان الدم النقوي الحاد

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...