Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Dette arbejde blev delvist støttet af JSPS KAKENHI Grant nummer 18K15141 til Y.T.

Bemærk: En oversigt over hele forsøgs strømmen er afbildet i figur 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> Figur 1: oversigt over udskærings eksperimentet med EA. Vævskultur-afledte trypomastigoter høstes og differentieres i EA. grna omdannes til Cas9-udtrykker amastigoter ved elektroporation, og vækst fænotype af knockout amastigote evalueres...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

Vi viste, at den axeniske kultur af T. cruzi amastigotes kan udnyttes i crispr/Cas9-mediated gen knockout, ved at elektro porating grna direkte ind i Cas9-udtrykker EA. På denne måde kan den væsentlighed af målgenet specifikt i amastigote fase evalueres uden at gå gennem andre udviklingsmæssige stadier.
En anden gavnlig aspekt af amastigote transfektering er den bekvemmelighed i test for et stort antal målgener. Når Co-kulturen af Cas9-udtrykker T. cruzi og vært patt...

Trypanosoma cruzi er det udløsende middel for Chagas ' sygdom, som primært er udbredt i Latin Amerika1. T. cruzi har karakteristiske stadier i livscyklussen, når den bevæger sig mellem en insekt vektor og en pattedyr-vært2. T. cruzi replikater som en epimastigote i ileum af en blod-sugende triatomine bug og differentierer til en infektiøs metacyclic trypomastigote i sin hindgut, før de deponeres på et menneske eller dyr vært. Når trypomastigote kommer ind i værtskroppen gennem bid-stedet eller gennem en slimhinde, invaderer parasitten en værtscelle og forvandler sig til en flagella-mindre runde form kaldet en amastigote. Den amastigote replikater i værtscellen og til sidst differentierer i trypomastigote, som sprænger ud af værtscellen og kommer ind i blodet for at inficere en anden værtscelle.
Da der i øjeblikket findes kemoterapeutika, benznidazol og nifurtimox, forårsage bivirkninger og er ineffektive i den kroniske fase af sygdommen3, det er af stor interesse at identificere nye Drug mål mod T. cruzi. I de seneste år, crispr/Cas9 system er blevet et kraftfuldt værktøj til effektivt at udføre gen knockout i T. cruzi, enten ved transfektering af separate eller enkelt plasmid (s) indeholdende grna og Cas94, ved stabile udtryk for Cas9 og efterfølgende indførelse af grna5,6,7 eller transskription skabelon af grna8, eller ved elektroporation af den præ-formede grna/Cas9 RNP kompleks7,9. Denne teknologiske avancement er meget forventet at fremskynde drug target forskning i Chagas ' sygdom.
For at fortsætte med narkotika udvikling, er det afgørende at validere den væsentlighed af målgenet eller effekten af Drug kandidat forbindelser i amastigote af T. cruzi, da det er replikation fase af parasitten i pattedyr vært. Dette er imidlertid en udfordrende opgave, fordi amastigoter ikke kan manipuleres direkte på grund af tilstedeværelsen af en obstruktiv værtscelle. I leishmania, en nært beslægtet protozo parasitten til T. cruzi, en axeniske amastigote dyrkning metode blev udviklet og er blevet udnyttet i Drug screening assays10,11,12, 13. selv om der er nogle uoverensstemmelser i modtagelighed for forbindelser mellem axeniske amastigotes og intracellulære amastigotes14, evnen til at opretholde den axeniske kultur ikke desto mindre giver værdifulde eksperimentelle værktøjer til at studere grundlæggende biologi af den klinisk relevante fase af leishmania15,16. I tilfælde af T. cruzi, litteratur om tilstedeværelsen af naturligt forekommende ekstracellulære amastigotes (EA)17 og in vitro-produktion af EA17,18,19 dato tilbage til årtier siden. Desuden er EA kendt for at have en smitsom kapacitet20, omend mindre end trypomastigote, og mekanismen i amastigote Host invasion er blevet belyst i de seneste år (anmeldt af Bonfim-Melo et al.21). Men i modsætning til leishmania, var EA ikke blevet udnyttet som et eksperimentelt værktøj i T. cruzi, primært fordi EA var blevet betragtet som en forpligte intracellulær parasit, og derfor ikke var blevet betragtet som "replikerende form" i en praktisk Følelse.
For nylig, vores gruppe foreslog at udnytte EA af T. cruzi som en tidsmæssig axeniske kultur22. Amastigotes af T. cruzi tulahuen stamme kan replikere gratis af Host celler i lit medium ved 37 °c i op til 10 dage uden større forringelse eller tab af amastigote-lignende egenskaber. I løbet af den værts frie vækstperiode blev EA med held udnyttet til eksogen genekspression ved konventionel elektroporation, lægemiddel titrering med trypanocide forbindelser og CRISPR/Cas9-medieret udskæring efterfulgt af vækst fænotype overvågning. I denne rapport beskriver vi den detaljerede protokol til at producere in vitro-afledte EA og til at udnytte den axeniske amastigote i knockout eksperimenter.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

Trypanosoma cruzi er en patogen protozo parasisite, der forårsager Chagas ' sygdom hovedsagelig i Latin Amerika. For at identificere en ny drug target mod T. cruzi, er det vigtigt at validere væsentlighed af målgenet i pattedyrs fase af parasitten, den amastigote. Amastigotes af T. cruzi replikere inde i værtscellen; Derfor er det vanskeligt at gennemføre et knockout eksperiment uden at gå gennem andre udviklingsmæssige stadier. For nylig, vores gruppe rapporterede en vækst tilstand, hvor amastigote kan replikere axenisk i op til 10 dage uden at miste sin amastigote-lignende egenskaber. Ved at bruge denne temporale axeniske-amastigote-kultur introducerede vi med succes grnas direkte i den Cas9-udtrykte amastigote for at forårsage genknockouts og analyserede deres fænotyper udelukkende i amastigote scenen. I denne rapport, vi beskriver en detaljeret protokol til at producere in vitro afledte ekstracellulære amastigotes, og at udnytte den axeniske kultur i en crispr/Cas9-mediated knockout eksperiment. Den vækst fænotype knockout amastigotes kan evalueres enten ved celletal af den axeniske kultur, eller ved replikation af intracellulære amastigote efter vært celle invasion. Denne metode omgår parasitten fase differentiering normalt involveret i at producere en transgene eller en knockout amastigote. Udnyttelsen af den tidsmæssige axeniske-amastigote-kultur har potentialet til at udvide den eksperimentelle frihed for stadie specifikke studier i T. cruzi.

Isolering af trypomastigotes ved svømme proceduren
For at høste friske trypomastigotter fra kontaminerende gamle EAs ved svømnings procedure, skal celle pellets inkuberet i det mindste for 1 h. inkuberet pellets i mere end 2 h øger ikke signifikant antallet af trypomastigotes svømning i opløsningen ( Figur 2b). I dette særlige eksperiment var procentdelen af trypomastigote i den oprindelige blanding 38%, og procentsatsen efter svømningen v...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Introduktion af et gen knockout direkte i den Amastigote fase af Trypanosoma cruzi ved hjælp af Crispr/Cas9 system

Her beskriver vi en protokol til at introducere en gen knockout i den ekstracellulære amastigote af Trypanosoma cruzi, ved hjælp af crispr/Cas9 system. Væksten fænotype kan følges op enten ved celletælling af axeniske amastigote kultur eller ved spredning af intracellulære amastigotes efter vært celle invasion.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

Det er svært at bruge værten infektion fase af T.cruzi i eksperimenter, fordi amastigote er en forpligte intracellulære parasit. Vores dyrkningsteknik gør det muligt for amastigote midlertidigt at replikere uden for værtscellen, så vi kan udføre eksperimenter direkte på denne klinisk relevante fase af parasitten. Demonstration af proceduren vil være Yukie Akutsu, en tekniker fra vores institut.Opretholde en vært parasit co-kultur i henhold til manuskriptet retninger. Når Cas9-udtryk parasitten er klar til differentiering, indsamle supernatant i et konisk rør, og kontrollere for prøven kvalitet under et mikroskop. Hvis der er et betydeligt antal ekstracellulære amastigotes, udføre en swim-out procedure for at isolere trypomastigotes.Spin ned blandingen af trypomastigotes og amastigotes i femten minutter som 2, 100 gange G.Derefter kassere det meste af supernatant, forlader 0,5 til 1 milliliter medium i røret. Hætten af røret løst, og inkuber pellet ved 37 grader Celsius i en til to timer, hvilket vil gøre det muligt for de aktive trypomastigotes at svømme ud af pellet. Efter inkubationen overføres supernatanten med trypomastigotes til et 1,5 milliliter mikrocentrifugerør.Spin det ned, og resuspend pellet med 5 milliliter DMEM. Parasitten overføres til en T-25-kulærkolbe, og kolben inkuberes ved 37 grader Celsius under 5 % kuldioxid i en befugtet inkubator. Omkring 95% af parasitterne vil differentiere sig i amastigotes efter 24 timer.Centrifuge kulturen af ekstracellulære amastigotes i 15 minutter ved 2, 100 gange G, og kassér supernatant. Pelletsuspendrer pellet med elektroporationsbuffer, der indeholder den medfølgende supplementopløsning til en endelig celletæthed på en gang 10 til 8. Aliquot 100 mikroliter af de resuspenderede parasitter i 1,5 liters mikrocentrifuge rør.Derefter tilsættes fem til 10 mikrogram Guide RNA, og bland forsigtigt ved pipettering. Overfør blandingen til en to millimeter hul elektroporation cuvette, og anvende en puls med elektroporation enhed. Cuvetteindholdet overføres derefter til en T-25-kolbe, der indeholder fem milliliter forvarmet LIT-medium, lad hætten være løs, og kolben inkuberes ved 37 grader Celsius under 5 %kuldioxid.Overvåge cellevæksten enten ved fortsættelse af aksenisk dyrkning eller som intracellulære amastigotter efter værtscelleinfektion. Hvis cellevæksten overvåges som aksetniske amastigotes, rystes kolben forsigtigt for at opbruge de ekstracellulære amastigotter i opløsningen og blandes 20 mikroliter af kulturen med en mikroliter propidiumdodidopløsning i et mikrocentrifugerør. Det er vigtigt ikke at lade kulingskolben være uden for inkubatoren i længere tid end nødvendigt, fordi temperaturen er en af de faktorer, der muliggør amastigote- spredning af amastigter.Påfør prøven på et hæmocytometer, og observere det under en fluorescens mikroskop. Derefter tælle antallet af levedygtige amastigotes, der ikke er plettet af propidium iodid. For at overvåge væksten af knockout celler som intracellulære amastigotes, frø vært 3T3 celler i en 12-brønd plade med DMEM.En dag efter elektroporation indsamle knockout amastigotes ved centrifugering, kassere supernatant, og resuspend parasitter med to milliliter DMEM. Fjern mediet fra værtscellekulturen, og tilføj de resuspenderede amastigotes. Inkuber pladen ved 37 grader Celsius under 5% kuldioxid i to dage, hvilket vil gøre det muligt for amastigotes at etablere en infektion.Efter de to dage, vaske væk ekstracellulære amastigotes uden for værtsceller med DMEM, og tilsæt frisk DMEM. Fortsæt inkubationen i yderligere to dage, og visualiser derefter kernen i værtscellerne og de intracellulære amastigotter. Det er blevet påvist, at T.Cruzi amastigotes transfekteret med Guide RNA mod det væsentlige gen TcCGM1 viser en betydelig vækstdefekt sammenlignet med en kontrolgruppe.Ved overvågning af vækst som intracellulære amastigotes er den andel af værtskerner, der er forbundet med T.Cruzi-kerner, signifikant lavere i TcCGM1 knockout-gruppen sammenlignet med kontrollen. Tværtimod påvirker transinfektion af Guide RNA mod et af paraflagellar rodproteinerne TcPAR1 ikke cellevæksten væsentligt efter fire dages aksenisk dyrkning eller hæmmer væksten af intracellulære amastigoter. Men, fem dage efter infektion, antallet af trypomastigotes, der dukker op ud af værtscellen er betydeligt lavere i TcPAR1 knockout co-kultur i forhold til kontrol co-kultur.Desuden syntes de differentierede trypomastigotes inde i værtscellen i kontrolgruppen mere aktive end dem i udskæringsgruppen. Denne metode kan også bruges til at undersøge virkningerne af udefrakommende gener på amastigote fase i stedet for transfecting Guide RNA i Cas9-udtryk amastigote, kan du transfect plasmid i en vild-type amastigote at udtrykke en udefrakommende gen.

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

Under anvendelse af et fluorescerende PCR-kapillær gelelektroforese Teknik til genotype CRISPR / Cas9-medieret Knockout Mutanter i et format med høj kapacitet

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

En standardmetode til at undersøge ejendommen mutagenicitet som en funktion af punkt Mutation reparation katalyseret af CRISPR/Cas9 og SsODN i humane celler

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Mikroinjektion af CRISPR/Cas9 Protein i kanal havkat, Ictalurus punctatus, embryoner til Gene Editing

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

En protokol til produktion af Integrase-mangelfuld Lentiviral vektorer for CRISPR/Cas9-medieret gen Knockout i dividere celler

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Effektiv produktion og identifikation af CRISPR/Cas9-genereret gen Knockouts i Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Højeffektive gen afbrydelse af Murine og menneskelige hæmatopoietisk stamceller ved CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

Endogene Protein Tagging i menneskelige induceret pluripotente stamceller ved hjælp af CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 ribonucleoprotein-medieret præcis Genredigering ved Rørelektroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Generation af definerede genomiske modifikationer med CRISPR-CAS9 i humane pluripotente stamceller

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Undersøgelse af den transkriptionelle rolle af en RUNX1 intronic LYDDÆMPER af crispr/Cas9 ribonucleoprotein i akutte myeloid leukæmiceller

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...