Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

עבודה זו נתמכת בחלקו על ידי JSPS KAKENHI גרנט מספר 18K15141 כדי חתיכה

הערה: סקירה של הזרימה הניסיונית כולה מתוארת באיור 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> איור 1: מבט כולל על ניסוי ההסתרה באמצעות EA. רקמת התרבות-הטרימטיקה הנגזרת של העור הם קוצרים והבדיל לתוך EA. gRNA הוא מנוכר לתוך Ca...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

הדגמנו כי התרבות axenic של T. cruzi amastigotes יכול להיות מנוצל CRISPR/Cas9-תיווך גן בנוקאאוט, על ידי electroporating grna ישירות לתוך Cas9-המבטא EA. בדרך זו, החיוני של הגן היעד במיוחד בשלב amastigote ניתן להעריך מבלי לעבור בשלבים התפתחותיים אחרים.
עוד היבט מועיל של מעבר החצייה הוא הנוחות בבדיקות עבור מס?...

טריאנוסומה cruzi הוא הסוכן סיבתי של מחלת חגיאס, אשר נפוצה בעיקר באמריקה הלטינית1. T. cruzi יש שלבים מחזור החיים הייחודיים כפי שהוא נע בין וקטור חרק מארח יונקים2. T. cruzi משכפל כמו epimastigote ב באמצע המעיים של חרק triatomine דם מוצץ ומבדיל לתוך המעי הקדמי זיהומיות טריאואסטיגוטה בבטן לפני שהופקדו על מארח אדם או בעלי חיים. ברגע שטריאומואסטיט נכנס לגוף המארח דרך אתר העקיצה או דרך קרום רירי, הטפיל פולש לתא מארח והופך לצורה עגולה פחות שנקראת amastigote. ה-amastigote משכפל בתא המארח ובסופו של דבר מבדיל לטרימטואסטיגוטה, הפורץ מתוך התא המארח ונכנס לזרם הדם כדי להדביק תא מארח נוסף.
מאז הזמינים כיום סוכני כימותרפיה, בנזיל ו nifurטימופייביץ ', לגרום תופעות לוואי שליליות אינן יעילות בשלב כרונית של המחלה3, זה מעניין מאוד לזהות מטרות התרופה הרומן נגד T. cruzi. בשנים האחרונות, מערכת CRISPR/Cas9 הפכה כלי רב עוצמה כדי לבצע ביעילות בנוקאאוט גנים ב T. cruzi, או על ידי התפתחות של נפרד או בודד פלמיד (s) המכיל grna ו Cas94, על ידי ביטוי יציב של Cas9 ואחריו מבוא של grna5,6,7 או שעתוק תבנית של grna8, או על ידי אלקטרופורציה של הוקמה מראש grna/Cas9 rnp קומפלקס7,9. התקדמות טכנולוגית זו צפויה להאיץ את מחקר מטרות הסמים במחלת צ'אס.
כדי להמשיך בפיתוח התרופה, חיוני לאמת את החיוניות של הגן היעד או היעילות של תרכובות מועמדים לסמים ב-amastigote של T. cruzi, כפי שהוא שלב השכפול של הטפיל במארח היונקים. עם זאת, זוהי משימה מאתגרת, בגלל amastigotes לא ניתן לטפל ישירות בשל נוכחותם של תא מארח חסימתית. ב לישמניה, הקשורות באופן הדוק מאוד טפיל ל T. cruzi, השיטה האמסטימית amastigote שפותחה והיה מנוצל בסינון תרופות בחני10,11,12, 13. למרות שיש כמה אי-התאמות ברגישות לתרכובות בין האקסטיגוטים amastigotes ו תאיים מאוד14, היכולת לשמור על התרבות axenic בכל זאת מספק כלים ניסיוניים יקרי ערך ללמוד את ביולוגיה בסיסית של השלב הרלבנטי הקליני של לישמניה15,16. במקרה של T. cruzi, הספרות לגבי נוכחות של מוצרים באופן טבעי amastigotes (ea)17 ובייצור מחוץ לתחום של EA17,18,19 תאריך חזרה . לפני עשרות שנים בנוסף, EA ידוע יש יכולת מדבקת20, אם כי פחות מזה של טריאומואסטיגוטה, ואת המנגנון של הפלישה מארח amastigote כבר הובהר בשנים האחרונות (נבדקו על ידי bonfim-מלו אל.21). עם זאת, בניגוד לישמניה, EA לא היה מנוצל ככלי ניסיוני ב -T. cruzi, בעיקר בגלל EA היה נחשב כטפיל מחייב תאיים, ולכן לא נחשב בתור "הטופס replicative בצורה מעשית גיוני.
לאחרונה, הקבוצה שלנו הציע לנצל EA של T. cruzi כתרבות האקסון הזמני22. Amastigotes של T. cruzi tulahuen מאמץ יכול לשכפל חינם של תאים מארחים במדיום LIT ב 37 ° צ' עד 10 ימים ללא הידרדרות מרכזית או אובדן של תכונות כמו amastigotes. במהלך תקופת הצמיחה המארחת ללא תשלום, EA היה מנוצל בהצלחה עבור ביטוי גנים אקסוסוגני על ידי electroporation קונבנציונאלי, התרופה טיטור שיטת עם תרכובות טרינורצח, ו CRISPR/Cas9-בתיווך הנוקאאוט ואחריו בניטור הצמיחה פנוטיפ. בדו ח זה, אנו מתארים את הפרוטוקול המפורט כדי לייצר ב-EA מחוץ למבחנה ולנצל את האמסטיגוטה האקסון בניסויי הנוקאאוט.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

טריאנוסומה cruzi היא מחלת פתוזוזה טפיל הגורם המחלה של חגיאס בעיקר באמריקה הלטינית. כדי לזהות מטרה התרופה הרומן נגד T. cruzi, חשוב לאמת את החומריות של הגן היעד בשלב היונקים של הטפיל, amastigote. Amastigotes של T. cruzi לשכפל בתוך התא המארח; לפיכך, קשה לבצע ניסוי מנוקאאוט מבלי לעבור בשלבים התפתחותיים אחרים. לאחרונה, הקבוצה שלנו דיווחה על מצב גדילה שבו amastigote יכול לשכפל באופן מאקסיבי עד 10 ימים מבלי לאבד מאפיינים כמו amastigote שלה. באמצעות התרבות הרקתית הטמפורלית הזאת, הצגנו בהצלחה gRNAs ישירות לתוך Cas9 ביטוי amastigote כדי לגרום הסתרה גנים וניתח פנוטיפים שלהם באופן בלעדי בשלב amastigote. בדוח זה, אנו מתארים פרוטוקול מפורט כדי לייצר בעלי מיסוי מתורבת, amastigotes הנגזרים, ולהשתמש בתרבות axenic ב-CRISPR/Cas9-מתווך ניסוי הסתרה. פנוטיפ הצמיחה של בנוקאאוט amastigotes יכול להיות מוערך גם על ידי ספירות התא של התרבות axenic, או על ידי השכפול של amastigotes תאיים לאחר הפלישה תא מארח. שיטה זו עוקפת את השלב הטפיל בידול בדרך כלל מעורב בהפקת הטרנסגניים או amastigote נוק. הניצול של התרבות הרקתית הטמפורלית יש את הפוטנציאל להרחיב את החופש הניסיוני של מחקרים ספציפיים לבמה ב -T. cruzi.

בידוד של טרימטואסטיוליטים על ידי הליך השחייה
כדי לקצור טריאומואסטיגוטים טריים מזהמים הישן על ידי הליך לשחות-out, כדורי תא צריך להיות מודבטים לפחות עבור 1 h. הדגירה של כדורי עבור יותר 2 h אינו מגדיל באופן משמעותי את מספר טריאומואסטיגוטים שחייה בתמיסה ( איור 2...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

היכרות גנטית הסתרה ישירות לתוך השלב Amastigote של טריאנוסומה cruzi באמצעות מערכת CRISPR/Cas9

כאן, אנו מתארים פרוטוקול להחדיר נוקאאוט גן לתוך amastigote החילוץ של טריאנוסומה cruzi, באמצעות מערכת CRISPR/Cas9. פנוטיפ הצמיחה ניתן לעקוב גם על ידי ספירת התאים של התרבות האמסטימית axenic או על ידי התפשטות amastigote תאיים לאחר הפלישה התא מארח.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

קשה להשתמש בשלב הזיהום המארח של T.cruzi בניסויים כי amastigote הוא טפיל תאי חובה. טכניקת הכת שלנו מאפשרת ל-amastigote לשכפל באופן זמני מחוץ לתא המארח, כדי שנוכל לבצע ניסויים ישירות בשלב זה הרלוונטי מבחינה קלינית של הטפיל. הדגמת ההליך תהיה יוקי Akutsu, טכנאי מהמכון שלנו.לשמור על תרבות טפיל מארחת על פי הוראות כתב היד. כאשר הטפיל המבטא Cas9 מוכן להבחנה, לאסוף את העל-טבעי לתוך צינור חרוט, ולבדוק איכות מדגם תחת מיקרוסקופ. אם יש מספר משמעותי של מסטיגוטים חוץ תאיים, לבצע הליך לשחות החוצה כדי לבודד את טריפומסטיגוטים.לסובב את התערובת של טריפומסטיגוטים וצברים במשך רבע שעה כמו 2, 100 פעמים G.Then להשליך את רוב העל טבעי, משאיר 0.5 כדי 1 מיליליטר של בינוני בצינור. מכסים באופן רופף את הצינור, ו דגירה את גלולה ב 37 מעלות צלזיוס במשך שעה עד שעתיים, אשר יאפשר trypomastigotes פעיל לשחות מתוך גלולה. לאחר הדגירה, מעבירים את העל-טבעי עם הטריפומסטיגוטים לצינור מיקרוצנטריפוגה 1.5 מיליליטר.לסובב אותו, ולתלות מחדש את גלולה עם 5 מיליליטר של DMEM. מעבירים את הטפיל לבקבוק תרבות T-25, ומדגרים את הבקבוק ב-37 מעלות צלזיוס מתחת ל-5% פחמן דו-חמצני באינקובטור לח. כ-95% מהטפילים יתבדלו לתוספים לאחר 24 שעות.צנטריפוגה התרבות של מסטיגוטים חוץ תאיים במשך 15 דקות ב 2, 100 פעמים G, ולהשליך את העל טבעי. תן מחדש את גלולה עם מאגר אלקטרופולציה המכיל פתרון תוספת שסופקו צפיפות התא הסופי של אחד פעמים 10 לתאים 8 למיליליטר. Aliquot 100 microliters של טפילים resuspended לתוך צינורות מיקרוצנטריפוגה 1.5 ליטר.לאחר מכן הוסיפו 5 עד 10 מיקרוגרם של מדריך RNA, ומערבבים בעדינות על ידי צינורות. מעבירים את התערובת לתוספת אלקטרופורציה של שני מילימטרים, ומחילים דופק עם מכשיר האלקטרופולציה. לאחר מכן, מעבירים את תכולת הקובטה לבקבוק T-25, המכיל חמישה מיליליטר של מדיום LIT לפני המלחמה, משאירים את הכובע רופף, ומדירים את הבקבוק ב-37 מעלות צלזיוס מתחת ל-5% פחמן דו-חמצני.לפקח על צמיחת התא או על ידי המשך של culturing צירי או כמו מצבות תאיים לאחר זיהום התא המארח. אם ניטור צמיחת התא כמו amastigotes axenic, בעדינות לנער את הבקבוק כדי לעכל את הצברים חוץ תאיים לתוך הפתרון, ולערבב 20 microliters של התרבות עם מיקרוליטר אחד של פתרון propidium יודיד בצינור microcentrifuge. חשוב לא להשאיר את בקבוק התרבות מחוץ לאנקובטור למשך זמן רב מהנדרש מכיוון שהטמפרטורה היא אחד הגורמים המאפשרים התפשטות צירית של אמסטיגוטה.יש למרוח את הדגימה על המוציטומטר, ולצפות בה תחת מיקרוסקופ פלואורסצנטי. ואז לספור את מספר amastigotes קיימא כי אינם מוכתמים על ידי יודיד פרופידיום. כדי לפקח על הצמיחה של תאי נוקאאוט כמו מצבור תאי, זרע לארח 3T3 תאים בצלחת 12 באר עם DMEM.יום אחד לאחר האלקטרופוזיה לאסוף את צובר הנוקאאוט על ידי צנטריפוגה, להשליך את supernatant, ו resuspend הטפילים עם שני מיליליטר של DMEM. הסר את המדיום מתרבות התאים המארחים והוסף את הצברים המתווים מחדש. הדגירה את הצלחת ב 37 מעלות צלזיוס תחת 5% פחמן דו חמצני במשך יומיים, אשר יאפשר את הממסטיגוטים להקים זיהום.לאחר יומיים, לשטוף את הצברים חוץ-תאיים מחוץ לתאים מארחים עם DMEM, ולהוסיף DMEM טרי. המשיכו את הדגירה במשך יומיים נוספים, ולאחר מכן דמיינו את הגרעינים של התאים המארחים ואת המחסות התאיות. הוכח כי T.Cruzi amastigotes מנוכה עם מדריך RNA נגד הגן החיוני TcCGM1 להראות פגם צמיחה משמעותי בהשוואה לקבוצת ביקורת.בעת ניטור הצמיחה כמו מצבור תאיים, השבר של גרעיני המארח הקשורים T.Cruzi גרעיני הוא נמוך באופן משמעותי בקבוצת נוקאאוט TcCGM1 בהשוואה לשליטה. להיפך, transfection של מדריך RNA נגד אחד חלבוני מוט paraflagellar TcPAR1 אינו משפיע באופן משמעותי על צמיחת התאים לאחר ארבעה ימים של culturing צירי או לעכב את הצמיחה של מצבות תאיים. עם זאת, חמישה ימים לאחר ההדבקה, מספר טריפומסטיגוטים העולים מהתא המארח נמוך משמעותית בתרבות הנוקאאוט TcPAR1 בהשוואה לתרבות השליטה.יתר על כן, טריפומסטיגוטים מובחנים בתוך התא המארח בקבוצת הביקורת נראו פעילים יותר מאלה בקבוצת הנוקאאוט. שיטה זו יכולה לשמש גם כדי ללמוד את ההשפעות של גנים אקסוגניים על הבמה amastigote במקום לשנות מדריך RNA לתוך Cas9-ביטוי amastigote, אתה יכול לשנות את הפלסמיד לתוך צבר מסוג בר להביע גן אקסוגני.

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

באמצעות טכניקה ג&#39;ל אלקטרופורזה פלורסנט PCR-נימי הגנוטיפ קריספר / Cas9 בתיווך נוק מוטאנטים בתוך פורמט תפוקה גבוהה

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

מתודולוגיה סטנדרטי כדי לבדוק באתר המוטגניות כפונקציה של תיקון נקודת מוטציה על ידי CRISPR/Cas9 ו- SsODN בתאי אדם

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection CRISPR/Cas9 החלבון לתוך ערוץ שפמנון, Ictalurus punctatus, העוברים עבור ג'ין עריכה

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

פרוטוקול עבור הייצור של וקטורים Lentiviral חשוכת-Integrase עבור CRISPR/Cas9-מתווכת נוקאאוט גנטי חלוקת תאים

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

ייצור יעיל והסתרות שנוצרו על-ידי זיהוי של CRISPR/Cas9 ג'ין, מערכת מודל רזבורה rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

שיבוש גנטי יעילים ביותר מאתר ואנושי Hematopoietic ובתאים מאת CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

חלבון אנדוגני תיוג-אנוש המושרה בתאי גזע Pluripotent באמצעות CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 ריבונואופפרוטאין-תיווך מדויק לעריכה גנטית על ידי אלקטרופורציה

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

הדור של שינויים גנומית מוגדרים באמצעות CRISPR-CAS9 בתאי גזע האדם Pluripotent

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

חקירת התפקיד הטרנססאני של משתיק הRUNX1 נית על ידי CRISPR/Cas9 Ribonucleoprotein בתאי לוקמיה מיאלואיד חריפה

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...