Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

यह कार्य जेएसपीएस काकेनही अनुदान संख्या 18K15141 को वाई.टी.

नोट: संपूर्ण प्रायोगिक प्रवाह का अवलोकन चित्र 1में दर्शाया गया है।
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> चित्र 1: EA का उपयोग करके नॉकआउट प्रयोग का अवलोकन. ऊतक सं?...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

हमने दिखा दिया है कि टी Cruzi amastigotes की axnic संस्कृति CRISPR/Cas9-मध्यस्थ जीन नॉकआउट में उपयोग किया जा सकता है, gRNA सीधे Cas9-expressing EA में electroporating द्वारा. इस तरह, विशेष रूप से amastigote चरण में लक्ष्य जीन की अनिवार्यता अन्य विकासात्?...

Trypanosoma cruzi Chagas रोग है, जो मुख्य रूप से लैटिन अमेरिका1में प्रचलित है का कारक एजेंट है. टी क्रुजी की विशिष्ट जीवन चक्र अवस्थाहोती है क्योंकि यह कीट सदिश और स्तनधारी मेजबान2के बीच यात्रा करती है . टी Cruzi एक रक्त चूसने triatomine बग के midgut में एक epimastigote के रूप में प्रतिकृति और एक संक्रामक मेटासाइक्लिक trypomastigote में एक मानव या पशु मेजबान पर जमा किया जा रहा से पहले अपने हिंदगुट में differentiates. एक बार trypomastigote काटने साइट के माध्यम से या एक श्लेष्म झिल्ली के माध्यम से मेजबान शरीर में हो जाता है, परजीवी एक मेजबान सेल पर आक्रमण और एक flagella-कम दौर फार्म में बदल एक amastigote कहा जाता है. amastigote मेजबान सेल के भीतर प्रतिकृति और अंत में trypomastigote में differentiates, जो मेजबान सेल से बाहर फट और एक और मेजबान सेल को संक्रमित करने के लिए रक्त प्रवाह में प्रवेश करती है.
वर्तमान में उपलब्ध रसायन चिकित्सा एजेंटों, बेंजनिडाज़ोल और nifurtimox के बाद से, प्रतिकूल दुष्प्रभाव का कारण है और रोगकेपुराने चरण में अप्रभावी हैं 3, यह टी cruzi के खिलाफ उपन्यास दवा लक्ष्यों की पहचान करने के लिए एक महान ब्याज की है। हाल के वर्षों में, CRISPR/Cas9 प्रणाली प्रभावी ढंग से टी Cruziमें जीन नॉकआउट प्रदर्शन करने के लिए एक शक्तिशाली उपकरण बन गया है, या तो अलग या एकल प्लाज्मिड (एस) के transfection द्वारा gRNA और Cas94युक्त , Cas9 की स्थिर अभिव्यक्ति और बाद में GRNA5,6,7 या लिप्यंतर टेम्पलेट का परिचय gRNA8, या पूर्व गठित GRNA/Cas9 RNP परिसर7,9के इलेक्ट्रोपोट्रेशन द्वारा . इस तकनीकी प्रगति उच्च Chagas रोग में दवा लक्ष्य अनुसंधान में तेजी लाने के लिए प्रत्याशित है.
दवा के विकास के साथ आगे बढ़ने के लिए, यह टी Cruziके amastigote में दवा उम्मीदवार यौगिकों के लक्ष्य जीन या प्रभावकारिता की अनिवार्यता को मान्य करने के लिए महत्वपूर्ण है, क्योंकि यह स्तनधारी मेजबान में परजीवी की प्रतिकृति चरण है. हालांकि, यह एक चुनौतीपूर्ण काम है, क्योंकि amastigotes सीधे एक अवरोधक मेजबान सेल की उपस्थिति के कारण हेरफेर नहीं किया जा सकता है. लीशमैनियामें , टी क्रुजीके निकट से संबंधित प्रोटोजोअन परजीवी , एक अक्षीय अमास्टिगोटे पुलिंग विधि विकसित की गई थी और इसका उपयोग औषध जांच परख10,11,12में किया गया है, 13. यद्यपि अक्षीय अमास्टिगोट्स और इंट्रासेल्यूलर एमैस्टिगोट्स14के बीच यौगिकों के प्रति संवेदनशीलता में कुछ विसंगतियां हैं , फिर भी अक्षीय संस्कृति को बनाए रखने की क्षमता का अध्ययन करने के लिए मूल्यवान प्रयोगात्मक उपकरण प्रदान करता है लेशमैनिया15,16के नैदानिक रूप से प्रासंगिक अवस्था के बुनियादी जीव विज्ञान . टी cruziके मामले में , स्वाभाविक रूप से होने वाली extracellular amastigotes (EA)17 की उपस्थिति के बारे में साहित्य और ईए17,18,19 तारीख वापस करने के लिए इन विट्रो उत्पादन में दशकों पहले. इसके अलावा, ईए एक संक्रामक क्षमता है करने के लिए जाना जाता है20,हालांकि trypomastigote की तुलना में कम है, और amastigote मेजबान आक्रमण के तंत्र हाल के वर्षों में स्पष्ट किया गया है (Bonfim-Melo एट अल द्वारा की समीक्षा की.21). हालांकि, Leishmaniaके विपरीत, ईए टी cruziमें एक प्रयोगात्मक उपकरण के रूप में उपयोग नहीं किया गया था, मुख्य रूप से क्योंकि ईए एक अनिवार्य intracellular परजीवी के रूप में माना गया था, और इस तरह के रूप में नहीं माना गया था "प्रतिज्ञेय रूप" एक व्यावहारिक में भावना.
हाल ही में, हमारे समूह के लिए एक अस्थायी अक्षीय संस्कृति 22 के रूप में टी cruzi के ईए का उपयोग करने का प्रस्ताव22. टी Cruzi Tulahuen तनाव के Amastigotes बड़ी गिरावट या amastigote की तरह गुणों के नुकसान के बिना 10 दिनों के लिए 37 डिग्री सेल्सियस पर LIT माध्यम में मेजबान कोशिकाओं से मुक्त प्रतिकृति कर सकते हैं. मेजबान मुक्त विकास अवधि के दौरान, ईए सफलतापूर्वक पारंपरिक इलेक्ट्रोपोट्रेशन द्वारा exogenous जीन अभिव्यक्ति के लिए उपयोग किया गया था, trypanocidal यौगिकों के साथ दवा अनुमापन परख, और CRISPR/Cas9-मध्यस्थ नॉकआउट विकास phenotype निगरानी के बाद. इस रिपोर्ट में, हम विस्तृत प्रोटोकॉल का वर्णन करने के लिए इन विट्रो व्युत्पन्न ईए में उत्पादन और नॉकआउट प्रयोगों में axenic amastigote का उपयोग करें.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

ट्रिपैनोसोमा क्रूजी एक रोगजनक प्रोटोज़ोअन परजीवी है जो मुख्य रूप से लैटिन अमेरिका में चागास रोग का कारण बनता है। टी Cruziके खिलाफ एक उपन्यास दवा लक्ष्य की पहचान करने के लिए, यह परजीवी के स्तनधारी चरण में लक्ष्य जीन की अनिवार्यता को मान्य करने के लिए महत्वपूर्ण है, amastigote. टी Cruzi के Amastigotes मेजबान सेल के अंदर दोहराने; इस प्रकार, यह अन्य विकासात्मक चरणों के माध्यम से जाने के बिना एक नॉकआउट प्रयोग का संचालन करने के लिए मुश्किल है। हाल ही में, हमारे समूह में एक विकास की स्थिति है जिसमें amastigote अप करने के लिए अपने amastigote की तरह गुणों को खोने के बिना 10 दिनों के लिए axenically दोहराने कर सकते हैं की सूचना दी. इस लौकिक अक्षीय amastigote संस्कृति का उपयोग करके, हम सफलतापूर्वक जीन knockouts कारण और amastigote चरण में विशेष रूप से उनके phenotypes का विश्लेषण करने के लिए Cas9-expressing amastigote में सीधे GRNAs शुरू की. इस रिपोर्ट में, हम एक विस्तृत प्रोटोकॉल का वर्णन करने के लिए इन विट्रो व्युत्पन्न extracellular amastigotes में उत्पादन, और एक CRISPR/Cas9-मध्यस्थ नॉकआउट प्रयोग में axenic संस्कृति का उपयोग करने के लिए. नॉकआउट amastigotes के विकास phenotype या तो कुल्हाड़ी संस्कृति के सेल मायने रखता है द्वारा मूल्यांकन किया जा सकता है, या मेजबान सेल आक्रमण के बाद intracellular amastigote की प्रतिकृति द्वारा. इस विधि परजीवी चरण भेदभाव सामान्य रूप से एक ट्रांसजेनिक या एक नॉकआउट amastigote उत्पादन में शामिल नजरअंदाज कर दिया। अस्थायी अक्षीय अमास्टिगोटसंस्कृति का उपयोग टी क्रुजी में चरण-विशिष्ट अध्ययनों की प्रयोगात्मक स्वतंत्रता का विस्तार करने की क्षमता है।

तैरना बाहर प्रक्रिया से trypomastigotes के अलगाव
तैरना बाहर प्रक्रिया से पुराने EAs दूषित से ताजा trypomastigotes फसल के लिए, सेल छर्रों कम से कम के लिए incubated की जरूरत है 1 ज. से अधिक के लिए छर्रों incubating काफी समाधा?...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

एक जीन नॉकआउट का परिचय सीधे Trypanosoma cruzi के Amastigote चरण में CRISPR/Cas9 प्रणाली का उपयोग

यहाँ, हम एक प्रोटोकॉल का वर्णन करने के लिए Trypanosoma cruzi के extracellular amastigote में एक जीन नॉकआउट परिचय, CRISPR / विकास phenotype या तो axenic amastigote संस्कृति की सेल गिनती द्वारा या मेजबान सेल आक्रमण के बाद intracellular amastigotes के प्रसार के द्वारा पीछा किया जा सकता है.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

प्रयोगों में टीक्रूसी के मेजबान संक्रमण चरण का उपयोग करना मुश्किल है क्योंकि एमासाटिमोट एक अनिवार्य इंट्रासेलुलर परजीवी है। हमारी खेती तकनीक एमास्टाबोट को मेजबान सेल के बाहर अस्थायी रूप से दोहराने की अनुमति देती है, इसलिए हम परजीवी के इस चिकित्सकीय प्रासंगिक चरण पर सीधे प्रयोग कर सकते हैं। प्रक्रिया का प्रदर्शन युकी अकुत्सु, हमारे संस्थान से एक तकनीशियन होगा ।पांडुलिपि निर्देशों के अनुसार एक मेजबान परजीवी सह-संस्कृति बनाए रखें। जब Cas9-व्यक्त परजीवी भेदभाव के लिए तैयार है, तो सुपरनिट को एक शंकु नली में इकट्ठा करें, और माइक्रोस्कोप के नीचे नमूना गुणवत्ता की जांच करें। यदि एक्स्ट्रासेलर एमासाटिमोटों की एक महत्वपूर्ण संख्या है, तो ट्राइपोमाटाइबोट को अलग करने के लिए तैरने की प्रक्रिया करें।2, 100 बार जी. तो अधिकांश सुपरनेट को त्याग दें, ट्यूब में माध्यम के 0.5 से 1 मिलीलीटर छोड़ दें। शिथिल ट्यूब टोपी, और एक से दो घंटे के लिए ३७ डिग्री सेल्सियस पर गोली इनक्यूबेट, जो सक्रिय trippomastigotes गोली से बाहर तैरने के लिए अनुमति देगा । इनक्यूबेशन के बाद, ट्राइपोमाटाइबोट के साथ सुपरनेट को 1.5 मिलीलीटर माइक्रोसेंट्रफ्यूज ट्यूब में स्थानांतरित करें।इसे नीचे स्पिन करें, और 5 मिलीलीटर डीएमईएम के साथ गोली को फिर से खर्च करें। परजीवी को टी-25 संस्कृति फ्लास्क में स्थानांतरित करें, और एक आर्द्रीकृत इनक्यूबेटर में 5% कार्बन डाइऑक्साइड के तहत 37 डिग्री सेल्सियस पर फ्लास्क को इनक्यूबेट करें। लगभग 95% परजीवी 24 घंटे के बाद एमासाटिमो में अंतर करेंगे।2, 100 बार जी पर 15 मिनट के लिए बाह्रात्म एमासटिमोटों की संस्कृति को अपकेंद्रित्र करें, और सुपरनेट को त्यागें। इलेक्ट्रोपॉरेशन बफर युक्त गोली को फिर से खर्च करें, जो मिलीलीटर प्रति 8वीं कोशिकाओं को एक गुना 10 के अंतिम कोशिका घनत्व के पूरक समाधान प्रदान करता है। 1.5 लीटर माइक्रोसेंट्रफ्यूज ट्यूबों में पुनर्नक्षित परजीवी के 100 माइक्रोलीटर अलीकोट।फिर गाइड आरएनए के पांच से 10 माइक्रोग्राम जोड़ें, और धीरे से पाइपिंग द्वारा मिश्रण । मिश्रण को दो मिलीमीटर गैप इलेक्ट्रोपॉजेशन क्यूवेट में स्थानांतरित करें, और इलेक्ट्रोपॉरेशन डिवाइस के साथ पल्स लागू करें। फिर, क्यूवेट सामग्री को टी-25 फ्लास्क में स्थानांतरित करें, जिसमें प्रीवार्म्ड लिट माध्यम के पांच मिलीलीटर होते हैं, टोपी को ढीला छोड़ देते हैं, और 5% कार्बन डाइऑक्साइड के तहत 37 डिग्री सेल्सियस पर फ्लास्क को इनक्यूबेट करते हैं।सेल के विकास की निगरानी या तो एक्सनिक संस्कृति की निरंतरता से या मेजबान सेल संक्रमण के बाद इंट्रासेलुलर एमासाटिमो के रूप में। यदि एक्सनीक एमासाटिमो के रूप में सेल विकास की निगरानी करते हैं, तो धीरे-धीरे एक्सपेरिमेंट में एक्सपेरिमेंट अलास्मटिमोइ को फिर से ढर्रादार करने के लिए फ्लास्क को हिलाएं, और एक माइक्रोसेंट्रिफ्यूज ट्यूब में प्रोपिडियम आयोडाइड समाधान के एक माइक्रोलीटर के साथ संस्कृति के 20 माइक्रोलीटर मिलाएं। यह महत्वपूर्ण है कि संस्कृति फ्लास्क को इनक्यूबेटर के बाहर आवश्यक से अधिक समय तक न छोड़ें क्योंकि तापमान उन कारकों में से एक है जो एपेस्ट्रिक प्रसार को सक्षम बनाता है।एक हीमोसाइटोमीटर पर नमूना लागू करें, और यह एक फ्लोरेसेंस माइक्रोस्कोप के तहत निरीक्षण करें। फिर प्रोपिडियम आयोडाइड से दाग नहीं रहे हैं कि व्यवहार्य amastigotes की संख्या गिनती। इंट्रासेलुलर एमासिगोट के रूप में नॉकआउट कोशिकाओं के विकास की निगरानी करने के लिए, बीज डीएमईएम के साथ 12-अच्छी प्लेट में 3T3 कोशिकाओं की मेजबानी करता है।इलेक्ट्रोपाउशन के एक दिन बाद नॉकआउट एमासटिमोटों को अपकेंद्रित्र द्वारा इकट्ठा करें, सुपरनाटेंट को त्यागें, और परजीवी को डीएमईएम के दो मिलीलीटर के साथ फिर से खर्च करें। मेजबान सेल संस्कृति से माध्यम निकालें, और पुनर् निलंबित amastigotes जोड़ें। दो दिनों के लिए 5% कार्बन डाइऑक्साइड के तहत ३७ डिग्री सेल्सियस पर थाली इनक्यूबेट, जो amastigotes एक संक्रमण स्थापित करने के लिए अनुमति देगा ।दो दिनों के बाद, डीएमईएम के साथ मेजबान कोशिकाओं के बाहर एक्स्ट्रासेलर एमासटिमोटों को धोएं, और ताजा डीएमईएम जोड़ें। इनक्यूबेशन को अतिरिक्त दो दिनों के लिए जारी रखें, और फिर मेजबान कोशिकाओं और इंट्रासेलुलर एमासटिमोटों के नाभिक की कल्पना करें। यह प्रदर्शित किया गया है कि आवश्यक जीन TCCGM1 के खिलाफ गाइड आरएनए के साथ संक्रमित T.Cruzi amastigotes एक नियंत्रण समूह के साथ तुलना में एक महत्वपूर्ण विकास दोष दिखाते हैं ।इंट्रासेलुलर एमास्टिगोट्स के रूप में विकास की निगरानी करते समय, नियंत्रण की तुलना में टीसीसीजीएम1 नॉकआउट समूह में टी क्रूज़ी नाभिक से जुड़े मेजबान नाभिक का अंश काफी कम है। इसके विपरीत, पैराफ्लेगेलर रॉड प्रोटीन टीसीपीआर 1 में से एक के खिलाफ गाइड आरएनए का ट्रांसफेक्शन एक्सनीक कल्चरिंग के चार दिनों के बाद सेल विकास को काफी प्रभावित नहीं करता है या इंट्रासेलुलर एमासटिगोट के विकास को बाधित करता है। हालांकि, संक्रमण के पांच दिन बाद, मेजबान सेल से बाहर निकलने वाले ट्राइपोमाटाइबोटों की संख्या नियंत्रण सह-संस्कृति की तुलना में टीसीपीआर 1 नॉकआउट सह-संस्कृति में काफी कम है।इसके अलावा, नियंत्रण समूह में मेजबान सेल के अंदर विभेदित ट्राइपोमाटाइबोट्स नॉकआउट समूह में लोगों की तुलना में अधिक सक्रिय दिखाई दिए। इस विधि का उपयोग एमास्टिगोट चरण पर एक्सोजेनस जीन के प्रभावों का अध्ययन करने के लिए भी किया जा सकता है, बजाय कि कैस् 9-एक्सप्रेसिंग एमाटाइबोट में गाइड आरएनए को ट्रांसफेक्ट करने के लिए, आप एक एक्सोजेनस जीन को व्यक्त करने के लिए प्लाज्मिड को जंगली प्रकार के एमाटाइबोटे में ट्रांसफेक्ट कर सकते हैं।

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

एक उच्च throughput प्रारूप में / Cas9 की मध्यस्थता नॉकआउट म्यूटेंट CRISPR जीनोटाइप के लिए एक फ्लोरोसेंट पीसीआर केशिका जेल वैद्युतकणसंचलन तकनीक का उपयोग करते हुए

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

एक मानक पद्धति पर जांच करने के लिए साइट Mutagenicity के एक समारोह के रूप में बिंदु उत्परिवर्तन मरंमत Catalyzed द्वारा CRISPR/Cas9 और SsODN मानव कोशिकाओं में

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection CRISPR/Cas9 प्रोटीन की चैनल कैटफ़िश, Ictalurus punctatus, जीन संपादन के लिए भ्रूण

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

CRISPR/Cas9 के लिए Integrase-कमी Lentiviral वैक्टर के उत्पादन के लिए एक प्रोटोकॉल-विभाजन कोशिकाओं में मध्यस्थता जीन नॉकआउट

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

मॉडल प्रणाली ढाणियो rerio में कुशल उत्पादन और CRISPR/Cas9 जनित जीन नॉकआउट की पहचान

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Murine और मानव टेम जनक कोशिकाओं के अत्यधिक कुशल जीन व्यवधान CRISPR द्वारा Cas9/

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

अंतर्जात प्रोटीन टैगिंग में मानव प्रेरित Pluripotent स्टेम कोशिकाओं का उपयोग CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 Ribonucleoप्रोटीन-मध्यस्थ सटीक जीन संपादन द्वारा ट्यूब इलेक्ट्रोपोरेशन

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

मानव Pluripotent स्टेम सेल में CRISPR-CAS9 का उपयोग कर परिभाषित जीनोमिक संशोधनों का उत्पादन

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

तीव्र माइलॉयड ल्यूकेमिया कोशिकाओं में CRISPR/Cas9 Ribonucleoप्रोटीन द्वारा एक RUNX1 Intronic साइलेंसर की ट्रांसक्रिप्शनल भूमिका की जांच

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...