Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

이 작품은 Y.T에 JSPS KAKENHI 교부금 번호 18K15141에 의해 부분적으로 지원되었다.

참고: 전체 실험 흐름에 대한 개요는 그림1에 설명되어 있습니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> 그림 1: EA를 사용한 녹아웃 실험개요. 조직 배양 유래 trypomastigotes는 EA로 수확되고 분화됩니다. gRNA는 전기 기공에 의해 Cas9 발현 아마스티고테로 형질전환되고, 녹아웃 아마?...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

우리는 T. cruzi amastigotes의 축배양이 Cas9 발현 EA로 직접 gRNA를 전기로 전환해서 CRISPR/Cas9 매개 유전자 녹아웃에서 이용될 수 있다는 것을 보여주었습니다. 이와 같이, amastigote 단계에서 특히 표적 유전자의 본질성은 다른 발달 단계를 거치지 않고 평가될 수 있다.
amastigote 형질감염의 또 다른 유익한 양상은 많은 표적 유전자를 위한 시험에 있는 편의성입니다. 일단 Cas9 발?...

Trypanosoma cruzi는 라틴 아메리카1에서주로 널리 퍼진 Chagas'질병의 원인 에이전트입니다. T. cruzi는 곤충 벡터와 포유류 호스트2사이를 이동하는 독특한 라이프 사이클 단계를 가지고 있습니다. T. cruzi 혈액 을 빠는 triatomine 버그의 midgut에 epimastigote로 복제 하 고 인간 또는 동물 호스트에 증착 되기 전에 그것의 뒷글에 감염 성 메타 세포 trypomastigote로 분화. trypomastigote 물린 사이트를 통해 또는 점 막을 통해 호스트 몸으로 되 면, 기생충 호스트 세포를 침공 하 고 amastigote 라는 편모 없는 둥근 형태로 변환. amastigote는 호스트 세포 내의 복제하고 결국 trypomastigote로 분화합니다, 이는 호스트 세포에서 파열하고 다른 호스트 세포를 감염시키기 위하여 혈류를 입력합니다.
현재 이용 가능한 화학치료제, 벤즈니다졸 및 니푸르티목스는 부작용을 일으키고 질병의 만성 단계에서효과가 없기 때문에 3, T. cruzi에 대한 새로운 약물 표적을 식별하는 것이 큰 관심사이다. 최근 몇 년 동안, CRISPR/Cas9 시스템은 GRNA 및 Cas9 4를 포함하는 별도의 또는 단일 플라스미드(들)의 형질전환에의해, Cas9의 안정적인 발현에 의해 T. cruzi에서유전자 녹아웃을 효과적으로 수행할 수 있는 강력한 도구가 되었습니다. gRNA5,6,7 또는 gRNA8의전사 템플릿의 도입, 또는 미리 형성된 gRNA/Cas9 RNP 복합체의 전기화에 의해7,9. 이러한 기술 발전은 Chagas'질병의 약물 표적 연구를 가속화할 것으로 기대됩니다.
약물 개발을 진행하기 위해서는 포유류 숙주에서 기생충의 복제 단계이기 때문에 T. cruzi의amastigote에서 표적 유전자 또는 약물 후보 화합물의 효능의 본질성을 검증하는 것이 중요합니다. 그러나, 이것은 도전적인 작업, 때문에 방해 호스트 세포의 존재에 직접 조작 할 수 없습니다. 리슈마니아에서는 T. cruzi와밀접하게 관련된 원생 동물 기생충, 축아제 배양 방법이 개발되었으며 약물 스크리닝 검거 법제10,11,12, 13. 도끼 아마스티고테와 세포 내 아마스티고테스(14)사이의 화합물에 대한 감수성에 약간의 불일치가 있지만, 축배양을 유지하는 능력은 그럼에도 불구하고 연구할 귀중한 실험 도구를 제공합니다. 리슈마니아15,16의임상적으로 관련된 단계의 기본 생물학 . T. cruzi의경우, 자연적으로 발생하는 세포외 amastigotes의 존재에 관한 문헌 (EA)17 및 EA의 체외 생산17,18,19 거슬러 올라간다 수십 년 전. 또한, EA는 20의 전염성능력을 가지는 것으로 알려져 있으며, 이는 트라이포마스티고테보다 적기는 하지만, 아마스티고테 숙주 침공의 메커니즘은 최근 몇 년 동안 해명되었다(본피엠-멜로 등21). 그러나, Leishmania와는달리, EA는 T. cruzi에있는 실험 적인 공구로 이용되지 않았습니다, EA가 의무적인 세포내 기생충으로 여겨졌기 때문에, 따라서 실용적인에서 "복제 양식"으로 간주되지 않았기 때문에 감각.
최근 우리 그룹은 T. cruzi의 EA를 일시적인 축문화(22)로 활용하자고 제안했다. T. cruzi Tulahuen 균주의 아마스티고트는 37°C에서 LIT 배지에서 숙주 세포의 자유로운 복제를 최대 10일 동안 주요 열화 또는 아마티고테 유사 성질의 손실 없이 복제할 수 있다. 숙주 없는 성장 기간 동안, EA는 기존의 전기천공에 의한 외인성 유전자 발현, 트라이파노시드 화합물을 통한 약물 적정 분석, CRISPR/Cas9 매개 녹아웃에 의한 성장 표현형 모니터링에 성공적으로 활용되었다. 이 보고서에서, 우리는 시험관내에서 유래된 EA를 생산하고 녹아웃 실험에서 축산 아마스티고테를 활용하기 위한 상세한 프로토콜을 설명한다.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

Trypanosoma cruzi는 주로 라틴 아메리카에서 Chagas' 질병을 일으키는 원인이 되는 병원성 원생 동물 기생충입니다. T. cruzi에대하여 새로운 약 표적을 확인하기 위하여는, 기생충의 포유류 단계에서 표적 유전자의 본질성을 확인하는 것이 중요합니다, amastigote. T. 크루지의 아마스티고테스는 숙주 세포 내부에 복제; 따라서, 다른 발달 단계를 거치지 않고 녹아웃 실험을 수행하는 것은 어렵다. 최근, 우리 그룹은 아마스티고테가 아마스티고테와 같은 특성을 잃지 않고 최대 10 일 동안 축으로 복제 할 수있는 성장 상태를보고했습니다. 이 시간적인 축 식 amastigote 문화를 사용하여, 우리는 성공적으로 유전자 녹아웃을 일으키는 원인이 되기 위하여 Cas9 표현 amastigote에 직접 gRNA를 소개하고 amastigote 단계에서 독점적으로 그들의 표현형을 분석했습니다. 이 보고서에서, 우리는 시험관 내에서 파생 된 세포 외 amastigotes를 생산 하는 상세한 프로토콜을 설명 하 고 CRISPR/Cas9 중재 녹아웃 실험에서 축 배양 활용. 녹아웃 amastigotes의 성장 표현형은 축세포 배양의 세포 수에 의해, 또는 숙주 세포 침략 후에 세포 내 amastigote의 복제에 의해 평가될 수 있습니다. 이 방법은 일반적으로 형질 전환 또는 녹아웃 amastigote생산에 관여하는 기생충 단계 분화를 우회합니다. 시간적 축아제아스티고트 문화의 활용은 T. cruzi에서 단계별 연구의 실험적 자유를 확장할 가능성이 있다.

스윔 아웃 절차에 의한 트라이포마스티고트 격리
수영 아웃 절차에 의해 오래된 EA를 오염에서 신선한 trypomastigotes를 수확하려면, 세포 펠릿은 적어도 인큐베이션 할 필요가 1 시간. 2 시간 이상 에 대한 펠릿을 배양하는 것은 크게 용액에서 수영 trypomastigotes의 수를 증가하지 않습니다 ( 그림2B)를 참조하십시오. 이 특정 실험에서, 초기 혼합물...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

CRISPR/Cas9 시스템을 사용하여 트리파노소마 크루지의 아마스티고테 스테이지에 유전자 녹아웃 직접 도입

여기에서, 우리는 CRISPR/Cas9 시스템을 사용하여, Trypanosoma cruzi의 세포외 amastigote로 유전자 녹아웃을 소개하는 프로토콜을 기술합니다. 성장 표현형은 축세포 배양의 세포 계수 또는 숙주 세포 침입 후 세포 내 아마스티고테의 증식에 의해 추적될 수 있다.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

amastigote는 의무적인 세포내 기생충이기 때문에 실험에서 T.cruzi의 호스트 감염 단계를 사용하는 것은 어렵습니다. 우리의 배양 기술은 amastigote가 일시적으로 호스트 세포의 외부에 복제할 수 있게 해주므로, 우리는 기생충의 임상적으로 관련있는 단계에서 직접 실험을 수행할 수 있습니다. 절차를 시연하는 것은 우리 연구소의 기술자 인 유키 아쿠츠 (Yukie Akutsu)가 될 것입니다.원고 의 지시에 따라 호스트 기생충 공동 문화를 유지합니다. Cas9 발현 기생충이 분화 할 준비가되면, 상체관을 원상 관으로 수집하고 현미경으로 샘플 품질을 확인하십시오. 세포 외 amastigotes의 상당수가 있는 경우에, 트립pomastigotes를 격리하기 위하여 수영 절차를 수행하십시오.2, 100 회 G.로 15 분 동안 trypomastigotes와 amastigotes의 혼합물을 스핀 다운 튜브에 매체의 0.5 ~ 1 밀리리터를 떠나, 슈퍼 나탄의 대부분을 폐기. 느슨하게 튜브를 캡, 활성 trypomastigotes 펠릿에서 수영 할 수 있도록 1 ~ 2 시간 동안 섭씨 37도에서 펠릿을 배양. 인큐베이션 후, 1.5 밀리리터 미세 원심 분리기 튜브로 trypomastigotes와 상체를 전송합니다.그것을 아래로 회전, DMEM의 5 밀리리터와 펠릿을 다시 중단. 기생충을 T-25 배양 플라스크로 옮기고, 가습된 인큐베이터에서 5%의 이산화탄소 하에서 플라스크를 섭씨 37도에서 배양한다. 기생충의 약 95%는 24시간 후에 amastigotes로 분화할 것입니다.원심 분리는 세포 외 amastigotes의 문화를 2, 100 배 G에서 15 분 동안, 그리고 상체를 폐기합니다. 밀리리터당 8세포에 10배의 최종 세포 밀도에 대한 보충 용액을 제공하는 전기포기 버퍼로 펠릿을 재연한다. 1.5 리터 미세 원심 분리튜브로 재중단 된 기생충의 Aliquot 100 마이크로 리터.그런 다음 5~10마이크로그램의 가이드 RNA를 추가하고 파이펫팅으로 부드럽게 섞습니다. 혼합물을 2밀리미터 갭 전기기큐벳으로 옮기고, 전기기공 장치와 펄스를 적용한다. 그런 다음, cuvette 내용을 T-25 플라스크로 옮기고, 5밀리리터의 사전 온진 LIT 매체를 포함하고, 캡을 느슨하게 두고, 5% 이산화탄소 하에서 플라스크를 섭씨 37도에서 배양한다.축 의 배양의 연속 또는 호스트 세포 감염 후 세포 내 amastigotes로 세포 성장을 모니터링. 축축 아마스티고스로 세포 성장을 모니터링하는 경우, 플라스크를 부드럽게 흔들어 세포 외 암미고를 용액으로 재일시 중단하고, 문화의 마이크로리터 20개를 마이크로센트리튬 요오드 용액1마이크로리터와 혼합하여 마이크로센트리푸시지 튜브에 넣습니다. 온도가 아마스티고테의 축축증을 가능하게 하는 요인 중 하나이기 때문에 문화 플라스크를 필요 이상으로 인큐베이터 외부에 두지 않는 것이 중요합니다.이 샘플을 혈류계에 적용하여 형광 현미경으로 관찰합니다. 그런 다음 프로피듐 요오드에 의해 얼룩지지 않는 가능한 아마스티고의 수를 계산합니다. 세포 내 amastigotes로 녹아웃 세포의 성장을 모니터링하려면, DMEM과 12 웰 플레이트에서 시드 호스트 3T3 세포.전기기분기 후 하루 는 원심분리에 의해 녹아웃 amastigotes를 수집, 상체를 폐기하고, DMEM의 두 밀리리터와 기생충을 다시 중단. 숙주 세포 배양에서 배지를 제거하고 다시 중단된 amastigotes를 추가합니다. 2일 동안 이산화탄소 5% 미만의 섭씨 37도에서 플레이트를 배양하여 아마스티고트가 감염을 확립할 수 있도록 합니다.이틀 후, DMEM을 가진 호스트 세포 밖에서 세포 외 아마스티고를 씻어 내고 신선한 DMEM을 추가하십시오. 추가 2 일 동안 인큐베이션을 계속 한 다음 숙주 세포 및 세포 내 amastigotes의 핵을 시각화합니다. TcGM1에 대한 가이드 RNA와 전염된 T.Cruzi amastigotes가 대조군에 비해 상당한 성장 결함을 보이는 것으로 입증되었다.세포 내 amastigotes로 성장을 모니터링 할 때, T.Cruzi 핵과 관련된 숙주 핵의 분수는 대조군에 비해 TcCGM1 녹아웃 그룹에서 상당히 낮습니다. 반대로, 파라플래그엘라로드 단백질 TcPAR1에 대한 가이드 RNA의 트랜스포메이션은 4일간의 축절 배양 후 세포 성장에 크게 영향을 미치거나 세포내 amastigotes의 성장을 억제하지 않는다. 그러나, 5일 후 감염, 숙주 세포에서 나오는 트라이포마스티고트의 수는 대조군에 비해 TcPAR1 녹아웃 공동배양에서 현저히 낮다.더욱이, 대조군내 호스트 셀 내부의 차별화된 트라이포마스티고스가 녹아웃 그룹의 사람들보다 더 활발하게 나타났다. 이 방법은 또한 가이드 RNA를 Cas9 발현 아마스티고테로 이식하는 대신 amastigote 단계에 외인성 유전자의 효과를 연구하는 데 사용될 수 있으며, 플라스미드를 야생형 아마스티고드로 전환하여 외인성 유전자를 발현할 수 있다.

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

CRISPR을 유전자형하기 위해 형광 PCR-모세관 젤 전기 영동 기술을 사용 / 높은 처리량 형식으로 녹아웃 돌연변이를 Cas9 매개

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

연구

유전학

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

점 돌연변이 수리 CRISPR/Cas9 및 SsODN 인간 세포에 의해 촉매의 기능으로 현지 변이 검사 하는 표준 방법론

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

CRISPR/Cas9 단백질의 유전자 편집에 대 한 채널 메기, Ictalurus punctatus, 배아로 microinjection

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

CRISPR/Cas9-중재 유전자 녹아웃 셀 분할에 대 한 Integrase 불충분 한 Lentiviral 벡터의 생산을 위한 프로토콜

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

효율적인 생산 및 모델 시스템 Danio rerio 에 유전자 녹아웃 식별의 CRISPR/Cas9 생성

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

인간에서 태그 생 단백질 유도 만능 줄기 세포를 사용 하 여 CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 리보뉴클레오단백질-튜브 전기포공에 의한 정밀 유전자 편집

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

인간 다능성 줄기 세포에서 CRISPR-CAS9를 사용하여 정의된 게놈 수정 생성

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

급성 골수성 백혈병 세포에서 CRISPR/Cas9 리보뉴클레오단백질에 의한 RUNX1 내성 소음기의 전사 적 역할 조사

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...