Name: introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system
Uploaded: 2019-07-31T15:00:00
Description: Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Dette arbeidet ble støttet delvis av JSP KAKENHI Grant Number 18K15141 til Y.T.

Merk: En oversikt over hele den eksperimentelle flyten er avbildet i figur 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59962/59962fig01.jpg"> Figur 1: oversikt over knockout-eksperimentet med EA. Vev kultur-avledet trypomastigotes høstes og differensiert i EA. gRNA er transfekterte inn Cas9-uttrykker amastigotes av electroporation, og vekst fenotype av knockout amastigote er e...

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).</li><li>Clayton, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chagas+disease+101.">Chagas disease 101.</a> Nature. 465 (n7301_supp), S4-S5 (2010).</li><li>Apt, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+developing+therapeutic+agents+in+the+treatment+of+Chagas+disease.">Current and developing therapeutic agents in the treatment of Chagas disease.</a> Drug Design, Development and Therapy. 4, 243-253 (2010).</li><li>Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-induced+disruption+of+paraflagellar+rod+protein+1+and+2+genes+in+Trypanosoma+cruzi+reveals+their+role+in+flagellar+attachment.">CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment.</a> mBio. 6 (4), e01012 (2015).</li><li>Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-mediated+single-gene+and+gene+family+disruption+in+Trypanosoma+cruzi.">CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi.</a> mBio. 6 (1), e02097-e02114 (2015).</li><li>Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvements+in+the+CRISPR/Cas9+system+for+high+efficiency+gene+disruption+in+Trypanosoma+cruzi.">Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi.</a> Acta Tropica. 178, 190-195 (2018).</li><li>Burle-Caldas, G. A., Soares-Sim&#245;es, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+two+CRISPR-Cas9+genome+editing+protocols+for+rapid+generation+of+Trypanosoma+cruzi+gene+knockout+mutants.">Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants.</a> International Journal for Parasitology. 48 (8), 591-596 (2018).</li><li>Costa, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+toolbox+for+Trypanosoma+cruzi:+A+parasite+line+incorporating+a+bioluminescence-fluorescence+dual+reporter+and+streamlined+CRISPR/Cas9+functionality+for+rapid+in+vivo+localisation+and+phenotyping.">Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping.</a> PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).</li><li>Soares Medeiros, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Efficiency+Genome+Editing+in+Protozoan+Parasites+Using+CRISPR-Cas9+Ribonucleoproteins.">High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins.</a> mBio. 8 (6), (2017).</li><li>Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axenic+amastigote+system+for+drug+screening.">An axenic amastigote system for drug screening.</a> Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).</li><li>Bates, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axenic+culture+of+Leishmania+amastigotes.">Axenic culture of Leishmania amastigotes.</a> Parasitology Today. 9 (4), 143-146 (1993).</li><li>Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+luciferase+expressing+Leishmania+donovani+axenic+amastigotes+as+primary+model+for+in+vitro+screening+of+antileishmanial+compounds.">Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds.</a> Current Microbiology. 65 (6), 696-700 (2012).</li><li>N&#252;hs, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Validation+of+a+Novel+Leishmania+donovani+Screening+Cascade+for+High-Throughput+Screening+Using+a+Novel+Axenic+Assay+with+High+Predictivity+of+Leishmanicidal+Intracellular+Activity.">Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity.</a> PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).</li><li>De Rycker, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+high-throughput+high-content+intracellular+Leishmania+donovani+assay+with+an+axenic+amastigote+assay.">Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay.</a> Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).</li><li>Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+comparative+RNA+expression+profiling+of+axenic+and+intracellular+amastigote+forms+of+Leishmania+infantum.">Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.</a> Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).</li><li>Pescher, P., Blisnick, T., Bastin, P., Sp&#228;th, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteome+profiling+informs+on+phenotypic+traits+that+adapt+Leishmania+donovani+for+axenic+and+intracellular+proliferation.">Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation.</a> Cellular Microbiology. 13 (7), 978-991 (2011).</li><li>Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+surface+antigens+expressed+during+the+morphogenesis+of+vertebrate+forms+of+Trypanosoma+cruzi.">Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.</a> Experimental Parasitology. 64 (3), 474-484 (1987).</li><li>Pan, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+cruzi:+intracellular+stages+grown+in+a+cell-free+medium+at+37+C.">Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C.</a> Experimental Parasitology. 45 (2), 215-224 (1978).</li><li>Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+Trypanosoma+cruzi+trypomastigote+to+amastigote+transformation+by+low+pH.">The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH.</a> Parasitology. 110 (05), 547 (1995).</li><li>Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigotes+of+Trypanosoma+cruzi+sustain+an+infective+cycle+in+mammalian+cells.">Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.</a> Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).</li><li>Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastigote+Synapse:+The+Tricks+of+Trypanosoma+cruzi+Extracellular+Amastigotes.">Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes.</a> Frontiers in Microbiology. 9, 1341 (2018).</li><li>Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utilization+of+proliferable+extracellular+amastigotes+for+transient+gene+expression,+drug+sensitivity+assay,+and+CRISPR/Cas9-mediated+gene+knockout+in+Trypanosoma+cruzi.">Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi.</a> PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).</li><li>Fernandes, J. F., Castellani, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+characteristics+and+chemical+composition+of+Trypanosoma+cruzi.">Growth characteristics and chemical composition of Trypanosoma cruzi.</a> Experimental Parasitology. 18 (2), 195-202 (1966).</li><li>Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+for+Functional+Analysis+of+Flagellar+Proteins+in+African+Trypanosomes.">Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes.</a> Methods in Cell Biology. 93, 21-57 (2009).</li><li>van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+in+&#8216;intracellular&#8217;+buffer+increases+cell+survival.">Electroporation in &#8216;intracellular&#8217; buffer increases cell survival.</a> Nucleic Acids Research. 20 (11), 2902-2902 (1992).</li><li>Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+gene+delivery+to+Trypanosoma+cruzi+epimastigotes+through+nucleofection.">Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection.</a> Parasitology International. 66 (3), 236-239 (2017).</li><li>Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amastin+mRNA+abundance+in+Trypanosoma+cruzi+is+controlled+by+a+3&#8217;-untranslated+region+position-dependent+cis-element+and+an+untranslated+region-binding+protein.">Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3&#8217;-untranslated region position-dependent cis-element and an untranslated region-binding protein.</a> The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).</li><li>Shaw, A. K., Kalem, M. C., Zimmer, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Gene+Expression+Is+Responsive+to+Starvation+Stress+and+Developmental+Transition+in+Trypanosoma+cruzi.">Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi.</a> mSphere. 1 (2), (2016).</li><li>Chao, D., Dusanic, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+studies+of+the+isolation+of+metacyclic+trypomastigotes+of+Trypanosoma+cruzi+by+DEAE+ion+exchange+chromatography.">Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography.</a> Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).</li><li>Nogueira, N., Bianco, C., Cohn, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+selective+lysis+and+purification+of+Trypanosoma+cruzi.">Studies on the selective lysis and purification of Trypanosoma cruzi.</a> The Journal of Experimental Medicine. 142 (1), 224-229 (1975).</li><li>Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+steady-state+transcriptome+of+the+four+major+life-cycle+stages+of+Trypanosoma+cruzi.">The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi.</a> BMC Genomics. 10, 370 (2009).</li><li>Rico, E., Jeacock, L., Kov&#225;&#345;ov&#225;, J., Horn, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+high-efficiency+CRISPR-Cas9-targeted+gene+editing+and+precision+base+editing+in+African+trypanosomes.">Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes.</a> Scientific Reports. 8 (1), 7960 (2018).</li><li>Fu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+RNA-guided+genome+editing+in+human+cells+via+delivery+of+purified+Cas9+ribonucleoproteins.">Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.</a> Genome Research. 24 (6), 1012-1019 (2014).</li><li>Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+roles+of+mitochondrial+calcium+uniporter+complex+subunits+in+growth+and+infectivity+of+Trypanosoma+cruzi.">Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi.</a> mBio. 8 (3), e00574-e00617 (2017).</li></ol>

Vi demonstrerte at axenic kulturen i T. cruzi amastigotes kan benyttes i CRISPR/Cas9-mediert gen knockout, ved electroporating gRNA direkte inn Cas9-uttrykker EA. På denne måten kan essentiality av målet genet spesielt i amastigote stadiet evalueres uten å gå gjennom andre utviklingstrinn.
En annen fordelaktig aspekt ved amastigote transfeksjoner er bekvemmeligheten i testing for et stort antall mål gener. Når co-kulturen i Cas9-uttrykker T. cruzi og vert pattedyr cell...

Trypanosoma cruzi er den utløsende Agent for Chagas ' sykdom, som er utbredt hovedsakelig i Latin-Amerika1. T. cruzi har særegne livssyklus faser som det reiser mellom en insekt vektor og en pattedyr vert2. T. cruzi replikerer idet en epimastigote inne midttarm av en blod-amme triatomine tege og skiller i en infeksjon metacyclic trypomastigote i sin baktarm tidligere tilværelse deponert opp på en human eller dyr vert. Når trypomastigote kommer inn i verts kroppen gjennom bite stedet eller gjennom en slimhinnen, invaderer parasitten en vert celle og forvandles til en flagella-mindre rund form kalt en amastigote. Amastigote replikerer innenfor verten cellen og til slutt skiller inn i trypomastigote, som sprekker ut av verten cellen og går inn i blodstrømmen å infisere en annen vert celle.
Siden tiden tilgjengelig kjemoterapeutiske agenter, benznidazole og nifurtimox, forårsake ugunstige bivirkninger og er ineffektive i den kroniske fasen av sykdommen3, er det av stor interesse å identifisere romanen narkotika mål mot T. cruzi. I de senere årene har CRISPR/Cas9 systemet blitt et kraftig verktøy for å effektivt utføre gen knockout i T. cruzi, enten ved transfeksjoner av separate eller enkelt plasmider (er) som inneholder GRNA og Cas94, av stabilt uttrykk for Cas9 og påfølgende innføring av gRNA5,6,7 eller transkripsjon mal av gRNA8, eller ved electroporation av pre-formet gRNA/Cas9 RNP kompleks7,9. Denne teknologiske utviklingen er svært forventet å akselerere stoffet målet forskning i Chagas ' sykdom.
For å fortsette med stoffet utvikling, er det avgjørende å validere essentiality av målet genet eller effekten av stoffet kandidat forbindelser i amastigote av T. cruzi, som det er replikering stadium av parasitten i pattedyr verten. Dette er imidlertid en utfordrende oppgave, fordi amastigotes ikke kan manipuleres direkte på grunn av tilstedeværelsen av en obstruktiv verts celle. I Leishmania, en nært beslektet protozoan parasitt til T. cruzi, en axenic amastigote dyrking metoden ble utviklet og har blitt benyttet i narkotika screening analyser10,11,12, 13. selv om det er noen avvik i mottakelighet for forbindelser mellom axenic amastigotes og intracellulære amastigotes14, evnen til å opprettholde axenic kulturen likevel gir verdifulle eksperimentelle verktøy for å studere grunnleggende biologi av klinisk relevant stadium av Leishmania. I tilfelle av T. cruzi, litteratur om tilstedeværelsen av naturlig forekommende ekstracellulære amastigotes (EA)17 og in vitro produksjon av EA17,18,19 dato tilbake til ti år siden. I tillegg er EA kjent for å ha en smittsom evne20, riktignok mindre enn trypomastigote, og mekanismen for amastigote verts invasjon har blitt belyst de siste årene (gjennomgått av Bonfim-Melo et al.21). Men i motsetning Leishmania, hadde EA ikke blitt utnyttet som et eksperimentelt verktøy i T. cruzi, først og fremst fordi EA hadde blitt betraktet som en forplikte intracellulære parasitt, og dermed ikke hadde blitt betraktet som "replicative form" i en praktisk Følelse.
Nylig foreslo vår gruppe å bruke EA av T. cruzi som en timelig axenic kultur22. Amastigotes av T. cruzi Tulahuen belastning kan gjenskape fri for verts celler i lit medium ved 37 ° c i opptil 10 dager uten større forringelse eller tap av amastigote egenskaper. Under verts fri vekstperioden ble EA med hell utnyttet for eksogene genuttrykk ved konvensjonell electroporation, legemiddel titrering analysen med trypanocidal forbindelser, og CRISPR/Cas9-mediert knockout etterfulgt av vekst fenotype overvåking. I denne rapporten beskriver vi den detaljerte protokollen for å produsere in vitro-avledet EA og å utnytte axenic amastigote i knockout-eksperimenter.

<table>
	<tbody>
		<tr>
			<td>20% formalin solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>068-03863</td>
			<td>fixing cells</td>
		</tr>
		<tr>
			<td>25 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3100-025</td>
			<td></td>
		</tr>
		<tr>
			<td>75 cm2 double seal cap culture flask</td>
			<td>AGC Techno Glass</td>
			<td>3110-075</td>
			<td></td>
		</tr>
		<tr>
			<td>All-in One Fluorescence Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for Control)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = GGACGGCACCTTCATCTACAAGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcCGM1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = TAGCCGCGATGGAGAGTTTATGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 crRNA (for TcPAR1)</td>
			<td>IDT</td>
			<td>custom made</td>
			<td>target sequence = CGTGGAGAACGCCATTGCCACGG</td>
		</tr>
		<tr>
			<td>Alt-R CRISPR-Cas9 tracrRNA</td>
			<td>IDT</td>
			<td>1072532</td>
			<td>to anneal with crRNA</td>
		</tr>
		<tr>
			<td>Amaxa Nucleofector device</td>
			<td>LONZA</td>
			<td>AAN-1001</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>Basic Parasite Nucleofector Kit 2</td>
			<td>LONZA</td>
			<td>VMI-1021</td>
			<td>electroporation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A3294</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>Burker-Turk disposable hemocytometer</td>
			<td>Watson</td>
			<td>177-212C</td>
			<td>cell counting</td>
		</tr>
		<tr>
			<td>Coster 12-well Clear TC-Treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3513</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>044-29765</td>
			<td>culture medium</td>
		</tr>
		<tr>
			<td>Fetal bovine serum, Defined</td>
			<td>Hyclone</td>
			<td>SH30070.03</td>
			<td>heat-inactivate before use</td>
		</tr>
		<tr>
			<td>G-418 Sulfate Solution</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>077-06433</td>
			<td>selection of transformant</td>
		</tr>
		<tr>
			<td>Hemin chloride</td>
			<td>Sigma-Aldrich</td>
			<td>H-5533</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td>staining of nuclei</td>
		</tr>
		<tr>
			<td>Liver infusion broth, Difco</td>
			<td>Becton Dickinson</td>
			<td>226920</td>
			<td>component of LIT medium</td>
		</tr>
		<tr>
			<td>MES</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>349-01623</td>
			<td>component of the medium for in-vitro amastigogenesis</td>
		</tr>
		<tr>
			<td>PBS (&#8211;)</td>
			<td>FUJIFILM Wako Pure Chemical</td>
			<td>166-23555</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864-10ML</td>
			<td>staining of dead cells</td>
		</tr>
		<tr>
			<td>RPMI 1646</td>
			<td>Sigma-Aldrich</td>
			<td>R8758</td>
			<td>medium for metacyclogenesis</td>
		</tr>
	</tbody>
</table>

introducing a gene knockout directly into the amastigote stage of trypanosoma cruzi using the crispr/cas9 system

Trypanosoma cruzi er en patogene protozoan parasitt som forårsaker Chagas ' sykdom hovedsakelig i Latin-Amerika. For å identifisere en roman medikament mål mot T. cruzi, er det viktig å validere essentiality av målet genet i pattedyr stadium av parasitten, amastigote. Amastigotes av T. cruzi replikere inne i verten cellen; Dermed er det vanskelig å gjennomføre et knockout eksperiment uten å gå gjennom andre utviklingstrinn. I den seneste tid, våre gruppe rapportere en oppblomstringen forfatning i hvilket det amastigote kanne duplisere axenically for til 10 dager uten mister dens amastigote-like eiendom. Ved å bruke denne timelige axenic amastigote kulturen introduserte vi med hell gRNAs direkte inn i Cas9-uttrykker amastigote for å forårsake gen Knockouts og analysert deres fenotyper utelukkende i amastigote fasen. I denne rapporten beskriver vi en detaljert protokoll for å produsere in vitro avledet ekstracellulære amastigotes, og å utnytte den axenic kulturen i et CRISPR/Cas9-mediert knockout eksperiment. Veksten fenotype av knockout amastigotes kan evalueres enten av celle tellinger av axenic kulturen, eller ved replikering av intracellulære amastigote etter vert celle invasjon. Denne metoden omgår parasitten scenen differensiering normalt involvert i å produsere en transgene eller en knockout amastigote. Utnyttelse av den timelige axenic amastigote kulturen har potensiale til å utvide den eksperimentelle friheten til scene spesifikke studier i T. cruzi.

Isolering av trypomastigotes ved svømme-ut prosedyren
Å høste frisk trypomastigotes fra forurense gamle EAs av svømme-ut fremgangsmåte, cellen pellets nød å bli inkubert det vil si for 1 h. incubating det pellets om mere enn 2 h er ikke viktig forhøye antallet av trypomastigotes svømmer inne oppløsningen ( Figur 2b). I dette eksperimentet var prosentandelen av trypomastigote i den første blandingen 38%, og prosenten etter at svømme-out...

Watch this Scientific Journal Video about Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System at JoVE.com

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Vi presenterer en Gene knockout direkte inn i Amastigote Stage av Trypanosoma cruzi bruker CRISPR/Cas9 system

Her beskriver vi en protokoll for å innføre et gen knockout inn i ekstracellulære amastigote av Trypanosoma cruzi, ved hjelp av CRISPR/Cas9 systemet. Veksten fenotype kan følges opp enten ved celle telling av axenic amastigote kultur eller ved spredning av intracellulære amastigotes etter verten celle invasjon.

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

Det er vanskelig å bruke vertsinfeksjonsstadiet til T.cruzi i eksperimenter fordi amastigote er en obligatorisk intracellulær parasitt. Vår kulteringsteknikk gjør at amastigote midlertidig kan replikere utenfor vertscellen, slik at vi kan utføre eksperimenter direkte på dette klinisk relevante stadiet av parasitten. Demonstrere prosedyren vil være Yukie Akutsu, en tekniker fra vårt institutt.Opprettholde en vert parasitt co-kultur i henhold til manuskriptet retninger. Når den Cas9-uttrykkende parasitten er klar for differensiering, samle supernatanten i et konisk rør, og se etter prøvekvalitet under et mikroskop. Hvis det er et betydelig antall ekstracellulære amastigotes, utfør en svømme-out prosedyre for å isolere trypomastigotes.Spinn ned blandingen av trypomastigotes og amastigotes i femten minutter som 2, 100 ganger G.Deretter kast det meste av det supernatante, og la 0,5 til 1 milliliter medium i røret. Hell røret løst, og inkuber pelleten ved 37 grader Celsius i en til to timer, noe som vil tillate de aktive trypomastigotes å svømme ut av pellet. Etter inkubasjonen, overfør supernatanten med trypomastigotes til et 1,5 milliliter mikrocentrifugerør.Spinn den ned, og resuspend pellet med 5 milliliter DMEM. Overfør parasitten til en T-25 kulturkolbe, og inkuber kolben ved 37 grader Celsius under 5% karbondioksid i en fuktet inkubator. Rundt 95% av parasittene vil differensiere til amastigotes etter 24 timer.Sentrifuge kulturen av ekstracellulære amastigotes i 15 minutter ved 2, 100 ganger G, og kast supernatant. Resuspend pellet med elektroporasjon buffer som inneholder gitt supplement løsning til en endelig celle tetthet på en ganger 10 til 8th celler per milliliter. Aliquot 100 mikroliter av de resuspended parasittene i 1,5 liters mikrocentrifuge rør.Tilsett deretter fem til 10 mikrogram Guide RNA, og bland forsiktig ved pipettering. Overfør blandingen til en to millimeter gap elektroporasjon cuvette, og påfør en puls med elektroporasjonsenheten. Deretter overfører du cuvetteinnholdet til en T-25 kolbe, som inneholder fem milliliter forhåndswarmed LIT medium, la hetten være løs og inkubere kolben ved 37 grader Celsius under 5% karbondioksid.Overvåk celleveksten enten ved videreføring av aksenisk kultering eller som intracellulære amastigotes etter vertscelleinfeksjon. Hvis du overvåker celleveksten som akseniske amastigotes, rist forsiktig kolben for å gjenbruke ekstracellulære amastigoteer inn i løsningen, og bland 20 mikroliter av kulturen med en mikroliter propidiumjodidløsning i et mikrocentrifugerør. Det er viktig å ikke forlate kulturkolben utenfor inkubatoren lenger enn nødvendig fordi temperaturen er en av faktorene som muliggjør aksenisk spredning av amastigote.Påfør prøven på et hemocytometer, og observer den under et fluorescensmikroskop. Tell deretter antall levedyktige amastigoteer som ikke er farget av propidiumjodid. For å overvåke veksten av knockout celler som intracellulære amastigotes, frø vert 3T3 celler i en 12-brønns plate med DMEM.En dag etter elektroporasjon samle knockout amastigotes ved sentrifugering, kaste supernatant, og resuspend parasittene med to milliliter DMEM. Fjern mediet fra vertscellekulturen, og legg til de gjenbrukte amastigotes. Inkuber platen ved 37 grader Celsius under 5% karbondioksid i to dager, noe som vil tillate amastigotes å etablere en infeksjon.Etter de to dagene, vask bort de ekstracellulære amastigotes utenfor vertsceller med DMEM, og legg til fersk DMEM. Fortsett inkubasjonen i ytterligere to dager, og visualiser deretter kjernene i vertscellene og de intracellulære amastigotes. Det har blitt vist at T.Cruzi amastigotes transfected med Guide RNA mot det essensielle genet TcCGM1 viser en betydelig vekstfeil sammenlignet med en kontrollgruppe.Ved overvåking av vekst som intracellulære amastigotes, er fraksjonen av vertskjerner forbundet med T.Cruzi-kjerner betydelig lavere i TcCGM1 knockout-gruppen sammenlignet med kontrollen. Tvert imot påvirker ikke transfection av Guide RNA mot et av paraflagellarstangproteinene TcPAR1 signifikant cellevekst etter fire dager med aksenisk kultering eller hemmer veksten av intracellulære amastigoteer. Men fem dager etter infeksjon er antall trypomastigotes som kommer ut av vertscellen betydelig lavere i TcPAR1 knockout-co-kultur sammenlignet med kontrollkokulturen.Videre virket de differensierte trypomastigotes inne i vertscellen i kontrollgruppen mer aktive enn de i knockout-gruppen. Denne metoden kan også brukes til å studere effekten av eksogene gener på amastigote stadium i stedet for å transfecting Guide RNA til Cas9-uttrykkende amastigote, kan du transfect plasmid til en vill-type amastigote å uttrykke en eksogen genet.

Research

JoVE Journal

Genetics

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

Ved hjelp av en Fluorescent PCR-kapillar-gelelektroforese teknikken for å genotype CRISPR / Cas9-mediert knockout-mutanter i en high-throughput-format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

En Standard metode for å undersøke stedet genetisk virkning som en funksjon av punkt mutasjon reparasjon katalysert av CRISPR/Cas9 og SsODN i menneskeceller

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Microinjection CRISPR/Cas9 protein i kanalen Gråsteinbit, Ictalurus punctatus, embryo for Gene Editing

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

En protokoll for produksjon av Integrase dårlig Lentiviral vektorer for CRISPR/Cas9-mediert Gene Knockout i dele celler

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Effektiv produksjon og identifikasjon av CRISPR/Cas9-generert Gene Knockouts i modellsystem Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Svært effektiv Gene avbrudd i Murine og menneskelig blodkreft stamfar celler av CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

Endogene Protein merking i menneskelig indusert Pluripotent stilk celler med CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 Ribonucleoprotein-mediert presis Genredigering av tube electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Generering av definerte genomisk modifikasjoner bruke CRISPR-CAS9 i Human Pluripotent stamceller

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Gransking av Transcriptional rolle en RUNX1 Intronic lyddemper av CRISPR/Cas9 Ribonucleoprotein i akutt myelogen leukemi celler

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...