Name: a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene
Uploaded: 2019-09-16T13:00:00
Description: Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

وقد تم دعم هذا البحث بمنح من مشروع إدارة الطوارئ التابع للجنة الوطنية للعلوم والطوارئ (المنحة رقم 81741004)، والمؤسسة الوطنية للعلوم الطبيعية في الصين (المنحة رقم 81860272)، وخطة البحوث الرئيسية لمؤسسة العلوم والتكنولوجيا الإقليمية في غوانغشي ( رقم المنحة AB16380219)، ومنحة مؤسسة ما بعد الدكتوراه الصينية (منحة رقم 2018M630993)، ومؤسسة قوانغشى للعلوم الطبيعية (المنحة رقم 2018GXNSFAA281067).

تم منح الموافقة الأخلاقية من قبل الجامعة الصينية المشتركة في هونغ كونغ-الأقاليم الجديدة الشرقية مجموعة البحوث السريرية لجنة (الرقم المرجعي: 2013.055)
1. تضخيم PCR
<ol><li>قبل البدء، قم بإزالة مزيج المخزن المؤقت PCR، وعينات مخففة والحمض النووي (كل من الاختبار والحمض النووي المرجعي) (ا?...

<ol>
	<li>Verkerk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+gene+(FMR-1)+containing+a+CGG+repeat+coincident+with+a+breakpoint+cluster+region+exhibiting+length+variation+in+fragile+X+syndrome.">Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.</a> Cell. 65, 905-914 (1991).</li><li>Fu, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+of+the+CGG+repeat+at+the+fragile+X+site+results+in+genetic+instability:+resolution+of+the+Sherman+paradox.">Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.</a> Cell. 67, 1047-1058 (1991).</li><li>Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+functions+for+FMRP+in+axon+growth+cone+motility+and+activity-dependent+regulation+of+filopodia+and+spine+synapses.">Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses.</a> Molecular and Cellular Neurosciences. 32, 37-48 (2006).</li><li>Didiot, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+G-quartet+containing+FMRP+binding+site+in+FMR1+mRNA+is+a+potent+exonic+splicing+enhancer.">The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer.</a> Nucleic Acids Research. 36, 4902-4912 (2008).</li><li>Bechara, E. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+function+for+fragile+X+mental+retardation+protein+in+translational+activation.">A novel function for fragile X mental retardation protein in translational activation.</a> PLoS Biology. 7, e16 (2009).</li><li>Ascano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMRP+targets+distinct+mRNA+sequence+elements+to+regulate+protein+expression.">FMRP targets distinct mRNA sequence elements to regulate protein expression.</a> Nature. 492, 382-386 (2012).</li><li>Kenny, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOV10+and+FMRP+regulate+AGO2+association+with+microRNA+recognition+elements.">MOV10 and FMRP regulate AGO2 association with microRNA recognition elements.</a> Cell Reports. 9, 1729-1741 (2014).</li><li>Oberle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instability+of+a+550-base+pair+DNA+segment+and+abnormal+methylation+in+fragile+X+syndrome.">Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome.</a> Science. 252, 1097-1102 (1991).</li><li>Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+syndrome+and+targeted+treatment+trials.">Fragile X syndrome and targeted treatment trials.</a> Results and Problems in Cell Differentiation. 54, 297-335 (2012).</li><li>Hatton, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autistic+behavior+in+children+with+fragile+X+syndrome:+prevalence,+stability,+and+the+impact+of+FMRP.">Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP.</a> American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).</li><li>Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-linked+mental+retardation+with+the+fragile+X.+A+study+of+15+families.">X-linked mental retardation with the fragile X. A study of 15 families.</a> Human Genetics. 59, 281-289 (1981).</li><li>Backes, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cognitive+and+behavioral+profile+of+fragile+X+boys:+correlations+to+molecular+data.">Cognitive and behavioral profile of fragile X boys: correlations to molecular data.</a> American Journal of Medical Genetics. 95, 150-156 (2000).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+analysis+of+1112+prenatal+samples+from+1991+to+2010.">Fragile X analysis of 1112 prenatal samples from 1991 to 2010.</a> Prenatal Diagnosis. 31, 925-931 (2011).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+the+fragile+X+CGG+repeat+in+females+with+premutation+or+intermediate+alleles.">Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles.</a> American Journal of Human Genetics. 72, 454-464 (2003).</li><li>Fernandez-Carvajal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+an+FMR1+grey-zone+allele+to+a+full+mutation+in+two+generations.">Expansion of an FMR1 grey-zone allele to a full mutation in two generations.</a> Journal of Molecular Diagnostics. 11, 306-310 (2009).</li><li>Terracciano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+to+full+mutation+of+a+FMR1+intermediate+allele+over+two+generations.">Expansion to full mutation of a FMR1 intermediate allele over two generations.</a> European Journal of Human Genetics. 12, 333-336 (2004).</li><li>Garcia-Arocena, D., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+the+molecular+basis+of+FXTAS.">Advances in understanding the molecular basis of FXTAS.</a> Human Molecular Genetics. 19, R83-R89 (2010).</li><li>Juncos, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+clinical+findings+in+the+fragile+X-associated+tremor+ataxia+syndrome+(FXTAS).">New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS).</a> Neurogenetics. 12, 123-135 (2011).</li><li>Hagerman, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intention+tremor,+parkinsonism,+and+generalized+brain+atrophy+in+male+carriers+of+fragile+X.">Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X.</a> Neurology. 57, 127-130 (2001).</li><li>Conway, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premature+ovarian+failure+and+FMR1+gene+mutations:+an+update.">Premature ovarian failure and FMR1 gene mutations: an update.</a> Annales d'endocrinologie. 71, 215-217 (2010).</li><li>Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+premutations+in+familial+premature+ovarian+failure.">Fragile X premutations in familial premature ovarian failure.</a> Lancet. 346, 309-310 (1995).</li><li>Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Very+early+premature+ovarian+failure+in+two+sisters+compound+heterozygous+for+the+FMR1+premutation.">Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation.</a> European Journal of Medical Genetics. 52, 37-40 (2009).</li><li>Bourgeois, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+fragile+X+premutation+disorders:+expanding+the+psychiatric+perspective.">A review of fragile X premutation disorders: expanding the psychiatric perspective.</a> Journal of Clinical Psychiatry. 70, 852-862 (2009).</li><li>Farzin, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autism+spectrum+disorders+and+attention-deficit/hyperactivity+disorder+in+boys+with+the+fragile+X+premutation.">Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation.</a> Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).</li><li>Hantash, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+premutation+carrier+frequency+in+patients+undergoing+routine+population-based+carrier+screening:+insights+into+the+prevalence+of+fragile+X+syndrome,+fragile+X-associated+tremor/ataxia+syndrome,+and+fragile+X-associated+primary+ovarian+insufficiency+in+the+United+States.">FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States.</a> Genetics in Medicine. 13, 39-45 (2011).</li><li>Kraan, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+allele+size+distribution+in+35,000+males+and+females:+a+comparison+of+developmental+delay+and+general+population+cohorts.">FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts.</a> Genetics in Medicine. 20 (12), 1627-1634 (2018).</li><li>Saul, R. A., Tarleton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1-Related+Disorders.">FMR1-Related Disorders.</a> GeneReviews. , (2012).</li><li>Amos Wilson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consensus+characterization+of+16+FMR1+reference+materials:+a+consortium+study.">Consensus characterization of 16 FMR1 reference materials: a consortium study.</a> Journal of Molecular Diagnostics. 10, 2-12 (2008).</li><li>Kwok, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+robust+PCR-based+assay+for+quantifying+fragile+X+CGG+repeats.">Validation of a robust PCR-based assay for quantifying fragile X CGG repeats.</a> Clinica Chimica Acta. 456, 137-143 (2016).</li><li>Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+carriers+of+premutation-size+alleles+of+the+FMRI+gene--and+implications+for+the+population+genetics+of+the+fragile+X+syndrome.">Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome.</a> American Journal of Human Genetics. 57, 1006-1018 (1995).</li><li>Tassone, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+CGG+allele+size+and+prevalence+ascertained+through+newborn+screening+in+the+United+States.">FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States.</a> Genome Medicine. 4, 100 (2012).</li><li>Dombrowski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premutation+and+intermediate-size+FMR1+alleles+in+10572+males+from+the+general+population:+loss+of+an+AGG+interruption+is+a+late+event+in+the+generation+of+fragile+X+syndrome+alleles.">Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles.</a> Human Molecular Genetics. 11, 371-378 (2002).</li><li>Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+and+instability+of+fragile+X+alleles:+implications+for+offering+fragile+X+prenatal+diagnosis.">Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis.</a> Obstetrics and Gynecology. 111, 596-601 (2008).</li><li>Hayward, B. E., Kumari, D., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+assays+for+the+fragile+X-related+disorders.">Recent advances in assays for the fragile X-related disorders.</a> Human Genetics. 136, 1313-1327 (2017).</li><li>Seltzer, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+CGG+expansions+of+the+FMR1+gene+in+a+US+population-based+sample.">Prevalence of CGG expansions of the FMR1 gene in a US population-based sample.</a> American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).</li><li>Hayward, B. E., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assays+for+determining+repeat+number,+methylation+status,+and+AGG+interruptions+in+the+Fragile+X-related+disorders.">Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders.</a> Methods in Molecular Biology. , 49-59 (1942).</li><li>Orrico, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+full+mutation+and+normal-sized+allele+of+the+FMR1+gene:+a+new+case.">Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case.</a> American Journal of Medical Genetics. 78, 341-344 (1998).</li><li>Schmucker, B., Seidel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+a+full+mutation+and+a+normal+size+allele+in+two+fragile+X+males.">Mosaicism for a full mutation and a normal size allele in two fragile X males.</a> American Journal of Medical Genetics. 84, 221-225 (1999).</li></ol>

FXS هو السبب الثاني الأكثر شيوعا من الإعاقة الذهنية بعد trisomy 21، مما يمثل ما يقرب من نصف التخلف العقلي المرتبطة بـ X30، والتي قد تؤثر على ما يقرب من 1 من كل 4000 ذكر و1 من كل 8000 أنثى. والأهم من ذلك، ما يقرب من 1 من كل 250-1000 الإناث تحمل ما قبل النقوس، وهذا التردد هو 1 في 250-1600 في الذكور<sup class="xr...

متلازمة X الهشة (FXS) والاضطرابات الهشة X المرتبطة بها، على سبيل المثال، الهزة ومتلازمة ترنح (FX-TAS)، وقصور المبيض الأولي (FX-POI) هي أساسا بسبب السيتوسين-غوانين-غوانين (CGG) ترينوكلوتيد تكرار التوسع في 5 'غير مترجمة المنطقة (UTR) من التخلف العقلي X الهشة-1(FMR1)الجينات على Xq27.31،2. البروتين المشفر FMR1 (FMRP) هو بروتين ملزم بالحمض النووي الريبي المرتبط بالبوليريبوسوم يعمل في تطوير الخلايا العصبية واللدونة متشابك من خلال تنظيم الربط البديل، والاستقرار، والنقل الددري من mRNA أو التوليف تحوير من البروتينات المشاركات الجزئية3،4،5،6،7.
ويوصف التباين الديناميكي مع حجم تكرار CGG من >200 بأنها طفرة كاملة، مما يحفز فرط الميثيل الشاذ وإسكات النسخ اللاحقة للمروّج FMR1 8. يؤدي غياب أو نقص بروتين FMRP إلى تعطيل تطور الخلايا العصبية الطبيعية ويسبب FXS9، الذي يتميز بأعراض سريرية مختلفة، بما في ذلك الإعاقة الذهنية المعتدلة إلى الشديدة، وتأخر النمو، والسلوكيات المفرطة النشاط، ضعف الاتصالات ومظاهر التوحد10،11،12. العرض في المرضى FXS الإناث عموما أكثر اعتدالا من ذلك في الذكور. ويصنف حجم تكرار CGG الذي يتراوح بين 55 و200 و45 إلى 54 على أنه حالة ما قبل التحويل والمستوى المتوسط، على التوالي. بسبب درجة عالية من عدم الاستقرار، وCGG تكرار حجم في premutation أو الأليل المتوسطة يفترض أن يوسع عندما تنتقل من الآباء والأمهات إلى ذرية13،14. وهكذا، فإن الناقلين مع الأليلات ما قبل النضة في خطر كبير من وجود الأطفال المتضررين من FXS بسبب التوسع المتكرر، وفي بعض الحالات، يمكن أن توسع الأليلات المتوسطة حجمها المتكرر إلى مجموعة الطفرة الكاملة على مدى جيلين15، 16. وعلاوة على ذلك، فإن الذكور مع preprepre ينقل أيضا زيادة خطر تطوير في وقت متأخر من ظهور FX-TAS17،18،19، في حين أن الإناث قبل التحول هي مستعدة لكل من FX-TAS وFX-POI20، 21،22. في الآونة الأخيرة، أفيد أن اضطرابات طيف التوحد مع تأخر النمو ومشاكل في السلوكيات الاجتماعية يتم عرضها في الأطفال مع النفير FMR1 alleles23،24.
لتحديد بالضبط CGG تكرار حجم له أهمية كبيرة لتصنيف والتنبؤ من FXS والاضطرابات الهشة المرتبطة X25،26. تاريخيا، كان CGG تكرار المنطقة محددة تفاعل البوليميراز سلسلة (PCR) مع تجزئة جزء بالإضافة إلى تحليل وصمة عار الجنوبية المعيار الذهبي للتنميط الجزيئي للFMR1 CGG تكرار27. ومع ذلك، PCR محددة التقليدية هي أقل حساسية للطفرات الكبيرة مع أكثر من 100 إلى 130 يكرر وغير قادر على تضخيم الطفرات الكاملة27،28. وعلاوة على ذلك، يفشل الكتروفوريس الشعري على محلل وراثي تقليدي لتكرار التحجيم في الكشف عن منتجات PcR FMR1 مع أكثر من 200 CGG يكرر. يتيح تحليل اللطخة الجنوبية التمييز بين مجموعة أوسع من الحجم المتكرر، من الأرقام العادية إلى أرقام تكرار الطفرة الكاملة، وقد تم استخدامه على نطاق واسع لتأكيد الطفرات الكاملة (في الذكور) وتمييز الأليلات المتجانسة مع طفرة كاملة من على ما يبدو المتجانسة الأليلات مع أحجام تكرار العادية (في الإناث). ومع ذلك، فإن قرار التحديد الكمي للتكرار محدود. والأهم من ذلك، أن استراتيجية الاختبار هذه خطوة بخطوة هي استراتيجية كثيفة العمالة وتستغرق وقتاً طويلاً وغير فعالة من حيث التكلفة.
هنا، نقدم طريقة دقيقة وقوية تستند إلى PCR لتحديد كمي من CGG يكرر FMR1. الخطوة الأولى من هذا الاختبار هي تضخيم PCR من تسلسل تكرار في 5'UTR من المروج FMR1 باستخدام مجموعة PCR X الهشة. يتم تنقية منتجات PCR ويتم تنفيذ تغيير حجم الشظايا على أداة الكهربائي الشعرية الدقيقة، والتفسير اللاحق لعدد CGG يكرر باستخدام برنامج التحليل عن طريق الرجوع إلى المعايير مع تكرار المعروفة على أساس الأساس المنطقي أن طول جزء PCR يتناسب مباشرة مع عدد CGG يكرر. ويشمل نظام PCR الكواشف التي تسهل تضخيم منطقة تكرار trinucleotide الغنية جدا GC. هذا الاختبار المستند إلى PCR قابل للاستنساخ وقادر على تحديد جميع نطاقات CGG يكرر المروجين FMR1. هذا هو طريقة فعالة من حيث التكلفة التي يمكن أن تجد تطبيق واسع النطاق في التشخيص الجزيئي وفحص FXS والاضطرابات الهشة ذات الصلة X مع أقل بدوره حول الوقت والاستثمار في المعدات، وبالتالي، يمكن استخدامها في مجموعة أوسع من السريرية المختبرات.

<table>
	<tbody>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes</td>
			<td>Axygen</td>
			<td>PCR-02D-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free</td>
			<td>Ambion</td>
			<td>AM9849</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate</td>
			<td>Thermo Fisher</td>
			<td>AB0800</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Electrode cartridge</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: IKA vortex mixer</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Test chips</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit</td>
			<td>Agilent</td>
			<td>5067-1506</td>
			<td>For Fragment sizing</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Markers (green cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA chips</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Electrode Cleaner</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Spin Filter</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Syringe</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Chip priming station</td>
			<td>Agilent</td>
			<td>5065-4401</td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Cubee Mini-centrifuge</td>
			<td>GeneReach</td>
			<td>aqbd-i</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold</td>
			<td>Merck Millipore</td>
			<td>MSVMHTS00</td>
			<td>Vacuum instrument for Filter plate vacuum Manifold for PCR product purification</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Silicone stopper</td>
			<td>Merck Millipore</td>
			<td>XX2004718</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Vacuum pump</td>
			<td>Merck Millipore</td>
			<td>WP6122050</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Waste collection vessel</td>
			<td>Merck Millipore</td>
			<td>XX1004705</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit</td>
			<td>PerkinElmer</td>
			<td>3101-0010</td>
			<td>For PCR amplification</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit: Sample Diluent</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FragilEase PCR Buffer mix</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) 
			FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)</td>
		</tr>
		<tr>
			<td>FragilEase Polymerase</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FraXsoft analysis software</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR clean up plate: NucleoFast 96 PCR plate</td>
			<td>MACHEREY-NAGEL</td>
			<td>743100</td>
			<td></td>
		</tr>
		<tr>
			<td>reference DNA sample</td>
			<td>Coriell</td>
			<td>NA20240 &#38; NA20239</td>
			<td></td>
		</tr>
		<tr>
			<td>S1000 96-well Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1852196</td>
			<td>This can be replaced by other Thermal Cyclers (eg. Veriti&#8482; 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)</td>
		</tr>
		<tr>
			<td>TriNEST Incubator/Shaker instrument</td>
			<td>PerkinElmer</td>
			<td>1296-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977015</td>
			<td>For 2100 Bioanalyzer electrode cleaning</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific Industries</td>
			<td>SI-0256 (Model G560E)</td>
			<td>Conventional vortex mixer</td>
		</tr>
	</tbody>
</table>

a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene

متلازمة X الهشة (FXS) والاضطرابات المرتبطة بها بسبب التوسع في السيتوسين-غوانين-غوانين (CGG) ترينوكلوتيد تكرار في منطقة 5 'غير مترجمة (UTR) من الهشاشة X التخلف العقلي-1(FMR1)الجينات المروج. تقليديا، يتم استخدام تحليل جزء الكهربائي الشعرية على محلل وراثي لتغيير الحجم من CGG يكرر FMR1، ولكن مطلوب تحليل لطخة الجنوبية إضافية للقياس الدقيق عندما يكون الرقم المتكرر أعلى من 200. هنا، نقدم دقيقة وقوية تفاعل البوليميراز سلسلة (PCR) -- طريقة تستند إلى القياس الكمي من CGG يكرر FMR1. الخطوة الأولى من هذا الاختبار هي تضخيم PCR من تكرار التسلسلات في 5'UTR من المروج FMR1 باستخدام مجموعة PCR X الهشة، تليها تنقية منتجات PCR وتجزئة التحجيم على جهاز الكهربائي الشعيرات الشعرية microfluidic، و تفسير لاحق لعدد CGG يكرر عن طريق الرجوع إلى المعايير مع تكرار المعروفة باستخدام برنامج التحليل. هذا الاختبار المستند إلى PCR قابل للتكرار وقادر على تحديد مجموعة كاملة من CGG يكرر من المروجين FMR1، بما في ذلك تلك التي مع عدد متكرر من أكثر من 200 (تصنف على أنها طفرة كاملة)، 55 إلى 200 (التحوير)، 46 إلى 54 (وسيط)، و 10 إلى 45 (عادي). وهي طريقة فعالة من حيث التكلفة تسهل تصنيف FXS والاضطرابات الهشة المرتبطة بـ X مع المتانة ووقت الإبلاغ السريع.

وترد في الشكل1ألف والشكل 1باءعلى التوالي نتائج تغيير حجم العينة المرجعية الأنثوية قبل التحوّل (NA20240، والأحجام المتكررة من 30 و80) والعينة المرجعية الأنثوية الكاملة للطفرة (NA20239، والأحجام المتكررة من 20 و200). بشكل عام، يتم تضمين قمتين علامة (علامة أقل 50 أزواج قاع...

Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

اختبار دقيق وقوي قائم على سلسلة من ردود الفعل البوليمرية لتحديد كمية السيتوسين-غوانين-غوانين الترينوكلوتيد يكرر في الجين الهش X التخلف العقلي-1 يسهل التشخيص الجزيئي وفحص متلازمة X الهشة والهشة X ذات الصلة اضطرابات مع أقصر بدوره حول الوقت والاستثمار في المعدات.

اختبار قوي من تفاعل البوليميراز القائم على سلسلة لقياس السيتوسين-غوانين-غوانين ترينوكلوتيد يكرر في التهشاشة X التخلف العقلي-1 الجينات

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

يمكن لهذه الطريقة فعالة من حيث التكلفة العثور على تطبيقات واسعة في التشخيص الجزيئي وفحص FXS والاضطرابات الهشة X ذات الصلة. انها سريعة في وقت التحول وأقل من الاستثمار في المعدات. يمكن أن تسهل مقايستنا القائمة على PCR تصنيف الطيف الكامل لـ FXS والاضطرابات الهشة المرتبطة بـ X ، بما في ذلك الوسيطة ، قبل التبدل ، والطفرة الكاملة مع المتانة ووقت الإبلاغ السريع.وسوف تظهر الإجراء من قبل وينغ تشوا من بيركنزلمير سنغافورة. ابدأ بإزالة مزيج العازلة PCR، وعينات عينة مخففة، وعينات الحمض النووي من الفريزر 20 درجة مئوية، وتركها في درجة حرارة الغرفة لمدة 20 إلى 30 دقيقة للذوبان. قبل استخدام الكواشف، دوامة وتدور لفترة وجيزة لهم.قياس تركيز عينة الحمض النووي مع مقياس الطيفي، وإذا لزم الأمر، تمييع إلى 25 نانوغرام لكل ميكرولتر مع ذوبان العينة. قم بتسمية آبار لوحة PCR لتحديد عينات الحمض النووي المرجعية والمختبرة وحساب عدد التفاعلات اللازمة للعينات الاختبارية والمرجعية والاختبارات السلبية. إعداد مزيج رئيسي PCR عن طريق الجمع بين 15 ميكرولترات من مزيج PCR العازلة إلى 0.6 ميكرولترات من عينة diluent و 0.4 ميكرولترات من البوليميراز لكل رد فعل.دوامة المزيج وتدور عليه. ثم الاستغناء 18 ميكرولترات من الخليط في كل بئر. ثم ماصة اثنين من microliters من كل الحمض النووي في البئر المناسبة.اخلط الكواشف عن طريق الأنابيب صعودا وهبوطا خمس مرات، ثم ختم لوحة. ضع اللوحة في الدراجات الحرارية وادير الـ PCR وفقًا لاتجاهات المخطوطة. سخني حاضنة شاكر إلى 65 درجة مئوية وأضف 80 ميكرولترات من 1X TE العازلة لكل منتج PCR.استخدام ماصة متعددة القنوات لنقل العينات إلى لوحة تنظيف PCR ووضع لوحة في شاكر. احتضانه عند درجة حرارة 65 درجة مئوية بينما يرتجف عند 1200 دورة في الدقيقة لمدة 10 دقائق. بعد الحضانة، تبريد شاكر الحاضنة وصولا الى 25 درجة مئوية، تعيين أداة فراغ إلى 250 ملليبار، وpirpirate الحل من خلال مرشح.بعد 15 دقيقة، يجب أن يكون الآبار أي السائل المتبقية. إيقاف تشغيل الفراغ وإضافة 50 ميكرولترات من 1X TE العازلة لكل بئر. استلهم الحل لمدة 10 دقائق باستخدام إعدادات الفراغ السابقة.جفف الجزء السفلي من لوحة التصفية عن طريق الضغط عليها بقوة على كومة من المناشف الورقية ثم إضافة 20 ميكرولترات من 1X TE العازلة إلى مركز أسفل كل بئر. ضع الطبق في الشاكر ويحضن عند درجة حرارة 25 درجة مئوية أثناء الاهتزاز عند 1200 دورة في الدقيقة لمدة خمس دقائق. بعد الحضانة، نقل ما لا يقل عن 15 ميكرولترات من المنتج المنقى PCR إلى 96 لوحة PCR طازج.قبل البدء، وجلب dna صبغة التركيز، مصفوفة هلام الحمض النووي، علامة الحمض النووي، سلم الحمض النووي، وعينات الحمض النووي النقية إلى درجة حرارة الغرفة. قم بإعداد محطة الفاتنة عن طريق استبدال الحقنة وضبط اللوحة الأساسية ، ثم حرر ذراع مقطع الحقنة وانزله إلى المركز العلوي. بدء برنامج التحجيم وإعداد مزيج صبغ هلام.دوامة صبغ التركيز لمدة 10 ثوان، ثم تدور عليه. ثم، إضافة 25 ميكرولترات من الصبغة إلى قارورة مصفوفة هلام ودوامة الحل لخلط. نقل مزيج صبغة هلام إلى مرشح تدور، وضعه في الطرد المركزي، وتدور لمدة 10 دقائق في 1500 مرات ز.عندما تكون على استعداد لتحميل مزيج صبغ هلام، إدراج رقاقة الحمض النووي جديدة في محطة فتيلة وإضافة تسعة ميكرولترات من مزيج صبغ هلام في البئر الذي تم وضع علامة مع G.Close محطة فتيلة وضمان أن يتم وضع المكبس في علامة ملليلتر واحد. اضغط على المكبس حقنة أسفل حتى يتم عقده من قبل مقطع. انتظر لمدة 30 ثانية بالضبط، ثم حرر القصاصة.انتظر خمس ثوان أخرى، ثم سحب ببطء المكبس مرة أخرى إلى موقف ملليلتر واحد. فتح محطة فتيلة وإضافة تسعة microliters من مزيج صبغ هلام في الآبار ملحوظ مع G.Add خمسة microliters من علامة في علامة ملحوظ جيدا مع رمز سلم وكل من 12 عينة الآبار. إضافة ميكرولتر واحد من السلم إلى البئر مع رمز سلم وميكر واحد من المنتج PCR أو الماء إلى آبار العينة.دوامة رقاقة لمدة دقيقة واحدة في 2400 دورة في الدقيقة. أدخله في الـ bioanalyzer و قم بتشغيل الرقاقة خلال خمس دقائق. عند اكتمال التشغيل، قم بتصدير بيانات الذروة كملفات جدول csv.وتستخدم عينة أنثى ما قبل التبدل وعينة أنثى طفرة كاملة كعينات مرجعية. يتم تضمين ذروة علامة أعلى وأدنى في ملف تعريف حجم الجزء، وعادة ما يكون هناك ذروة مجمع التمهيدي في حوالي 95 أزواج قاعدة. يتم استخدام هذه العينات المرجعية لإنشاء منحنى انحدار قياسي.ثم يتم استخدام منحنى الانحدار المعياري الخطي لحساب أحجام التكرار للعينات غير المعروفة. يمكن تصنيف عينات الطفرات السريرية العادية والمتوسطة، قبل التبدل، والطفرة الكاملة، والفسيفساء بشكل صحيح باستخدام هذه الطريقة. في بعض الحالات، يتم عرض ذروة واحدة فقط في نتائج الكهرباء الدقيقة الفلورية، والتي من المرجح أن يرجع ذلك إلى وجود الأليليسات المتجانسة العادية.نوع واحد من النتائج دون المستوى الأمثل هو التحيز خط الأساس، والتي يمكن أن تكون غامضة أو غير تفسير، ويشتبه في أن يكون سببها عطل في الجهاز. عند محاولة هذا الإجراء، من المهم ضمان كمية مناسبة من الحمض النووي والجودة قبل بدء البروتوكول. يمكن إجراء تسلسل الجينات FMR1 لتحديد نمط انقطاع AGG.ويمكن استخدام إنزيم التقييد الحساس للميثيل أو مقايسة تعديل ثنائي السلفيد لمراقبة حالة الميثيل. هذه تقنية سريعة وقوية وفعالة من حيث التكلفة. وسوف يساعد الباحثين الآخرين في إجراء دراسة قائمة على السكان على حالة الناقل من FXS والاضطرابات الهشة X المرتبطة.

Research

JoVE Journal

Genetics

Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry

تحسين تفاعل البلمرة المتسلسل-تقييد جزء طول تعدد الأشكال الجيني من ينفوخية السامة من قبل اللوني السائل / قياس الطيف الكتلي

An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by ...

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

قياس التصبغ البطن في<em&gt; ذبابة الفاكهة ميلانوغاستر</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

منهجية موحدة لدراسة المحدثة للطفرات في الموقع كدالة لإصلاح نقطة تحور تحفزها كريسبر/Cas9 وسودن في الخلايا البشرية

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

عزل الحمض النووي قوية وبناء مكتبة التسلسل الفائق للعينات دار النباتات

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

كريسبر بوساطة إعادة تنظيم هيكل حلقة الكروماتين

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

الجينات المرشح الاختبار في الدراسات الفوجية السريرية مع التنميط متعدد والطيف الكتلي

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

قطره واحدة رقمي البلمرة المتسلسل لكشف شامل ومتزامن من الطفرات في المناطق الساخنة

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

تحديد الأحداث جزئ مثلى في الخلايا الجذعية الجنينية الماوس باستخدام النشاف الجنوبي وتفاعل البوليميراز المتسلسل

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome ...

Manipulation of Gene Function in Mexican Cavefish

التلاعب بالجينات الدالة في كافيفيش المكسيكي

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

في تطبيق نظام التحكم عن بعد "التلاعب بالتعبير الجيني الذاتية" فيفو

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...