Name: a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene
Uploaded: 2019-09-16T13:00:00
Description: Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

מחקר זה נתמך על ידי מענקים NSFC ניהול חירום הפרויקט (גרנט No. 81741004), הארגון הלאומי למדע הטבע של סין (גרנט No. 81860272), תוכנית המחקר העיקרי של המדע המחוזי הקרן טכנולוגיה של גואנגשי ( . גרנט לא AB16380219), בקרן המדע הפוסט-דוקטורט של סין (גרנט No. 2018M630993), והקרן למדע הטבע גואנגשי (מענק No. 2018GXNSFAA281067).

אישור מוסרי הוענק על ידי האוניברסיטה הסינית המשותפת של הונג קונג – שטחים חדשים באשכול המחקר הקליני של הטריטוריות החדשות ועדת האתיקה (מספר אסמכתא: 2013.055)
1. הגברה הPCR
<ol><li>לפני תחילת, להסיר את ערבוב מאגר ה-PCR, לדוגמה מדלל ו-DNA דגימות (שניהם DNA בדיקה והתייחסות) (לראות את הטבלה ?...

<ol>
	<li>Verkerk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+gene+(FMR-1)+containing+a+CGG+repeat+coincident+with+a+breakpoint+cluster+region+exhibiting+length+variation+in+fragile+X+syndrome.">Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.</a> Cell. 65, 905-914 (1991).</li><li>Fu, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+of+the+CGG+repeat+at+the+fragile+X+site+results+in+genetic+instability:+resolution+of+the+Sherman+paradox.">Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.</a> Cell. 67, 1047-1058 (1991).</li><li>Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+functions+for+FMRP+in+axon+growth+cone+motility+and+activity-dependent+regulation+of+filopodia+and+spine+synapses.">Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses.</a> Molecular and Cellular Neurosciences. 32, 37-48 (2006).</li><li>Didiot, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+G-quartet+containing+FMRP+binding+site+in+FMR1+mRNA+is+a+potent+exonic+splicing+enhancer.">The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer.</a> Nucleic Acids Research. 36, 4902-4912 (2008).</li><li>Bechara, E. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+function+for+fragile+X+mental+retardation+protein+in+translational+activation.">A novel function for fragile X mental retardation protein in translational activation.</a> PLoS Biology. 7, e16 (2009).</li><li>Ascano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMRP+targets+distinct+mRNA+sequence+elements+to+regulate+protein+expression.">FMRP targets distinct mRNA sequence elements to regulate protein expression.</a> Nature. 492, 382-386 (2012).</li><li>Kenny, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOV10+and+FMRP+regulate+AGO2+association+with+microRNA+recognition+elements.">MOV10 and FMRP regulate AGO2 association with microRNA recognition elements.</a> Cell Reports. 9, 1729-1741 (2014).</li><li>Oberle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instability+of+a+550-base+pair+DNA+segment+and+abnormal+methylation+in+fragile+X+syndrome.">Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome.</a> Science. 252, 1097-1102 (1991).</li><li>Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+syndrome+and+targeted+treatment+trials.">Fragile X syndrome and targeted treatment trials.</a> Results and Problems in Cell Differentiation. 54, 297-335 (2012).</li><li>Hatton, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autistic+behavior+in+children+with+fragile+X+syndrome:+prevalence,+stability,+and+the+impact+of+FMRP.">Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP.</a> American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).</li><li>Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-linked+mental+retardation+with+the+fragile+X.+A+study+of+15+families.">X-linked mental retardation with the fragile X. A study of 15 families.</a> Human Genetics. 59, 281-289 (1981).</li><li>Backes, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cognitive+and+behavioral+profile+of+fragile+X+boys:+correlations+to+molecular+data.">Cognitive and behavioral profile of fragile X boys: correlations to molecular data.</a> American Journal of Medical Genetics. 95, 150-156 (2000).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+analysis+of+1112+prenatal+samples+from+1991+to+2010.">Fragile X analysis of 1112 prenatal samples from 1991 to 2010.</a> Prenatal Diagnosis. 31, 925-931 (2011).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+the+fragile+X+CGG+repeat+in+females+with+premutation+or+intermediate+alleles.">Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles.</a> American Journal of Human Genetics. 72, 454-464 (2003).</li><li>Fernandez-Carvajal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+an+FMR1+grey-zone+allele+to+a+full+mutation+in+two+generations.">Expansion of an FMR1 grey-zone allele to a full mutation in two generations.</a> Journal of Molecular Diagnostics. 11, 306-310 (2009).</li><li>Terracciano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+to+full+mutation+of+a+FMR1+intermediate+allele+over+two+generations.">Expansion to full mutation of a FMR1 intermediate allele over two generations.</a> European Journal of Human Genetics. 12, 333-336 (2004).</li><li>Garcia-Arocena, D., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+the+molecular+basis+of+FXTAS.">Advances in understanding the molecular basis of FXTAS.</a> Human Molecular Genetics. 19, R83-R89 (2010).</li><li>Juncos, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+clinical+findings+in+the+fragile+X-associated+tremor+ataxia+syndrome+(FXTAS).">New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS).</a> Neurogenetics. 12, 123-135 (2011).</li><li>Hagerman, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intention+tremor,+parkinsonism,+and+generalized+brain+atrophy+in+male+carriers+of+fragile+X.">Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X.</a> Neurology. 57, 127-130 (2001).</li><li>Conway, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premature+ovarian+failure+and+FMR1+gene+mutations:+an+update.">Premature ovarian failure and FMR1 gene mutations: an update.</a> Annales d'endocrinologie. 71, 215-217 (2010).</li><li>Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+premutations+in+familial+premature+ovarian+failure.">Fragile X premutations in familial premature ovarian failure.</a> Lancet. 346, 309-310 (1995).</li><li>Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Very+early+premature+ovarian+failure+in+two+sisters+compound+heterozygous+for+the+FMR1+premutation.">Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation.</a> European Journal of Medical Genetics. 52, 37-40 (2009).</li><li>Bourgeois, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+fragile+X+premutation+disorders:+expanding+the+psychiatric+perspective.">A review of fragile X premutation disorders: expanding the psychiatric perspective.</a> Journal of Clinical Psychiatry. 70, 852-862 (2009).</li><li>Farzin, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autism+spectrum+disorders+and+attention-deficit/hyperactivity+disorder+in+boys+with+the+fragile+X+premutation.">Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation.</a> Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).</li><li>Hantash, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+premutation+carrier+frequency+in+patients+undergoing+routine+population-based+carrier+screening:+insights+into+the+prevalence+of+fragile+X+syndrome,+fragile+X-associated+tremor/ataxia+syndrome,+and+fragile+X-associated+primary+ovarian+insufficiency+in+the+United+States.">FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States.</a> Genetics in Medicine. 13, 39-45 (2011).</li><li>Kraan, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+allele+size+distribution+in+35,000+males+and+females:+a+comparison+of+developmental+delay+and+general+population+cohorts.">FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts.</a> Genetics in Medicine. 20 (12), 1627-1634 (2018).</li><li>Saul, R. A., Tarleton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1-Related+Disorders.">FMR1-Related Disorders.</a> GeneReviews. , (2012).</li><li>Amos Wilson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consensus+characterization+of+16+FMR1+reference+materials:+a+consortium+study.">Consensus characterization of 16 FMR1 reference materials: a consortium study.</a> Journal of Molecular Diagnostics. 10, 2-12 (2008).</li><li>Kwok, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+robust+PCR-based+assay+for+quantifying+fragile+X+CGG+repeats.">Validation of a robust PCR-based assay for quantifying fragile X CGG repeats.</a> Clinica Chimica Acta. 456, 137-143 (2016).</li><li>Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+carriers+of+premutation-size+alleles+of+the+FMRI+gene--and+implications+for+the+population+genetics+of+the+fragile+X+syndrome.">Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome.</a> American Journal of Human Genetics. 57, 1006-1018 (1995).</li><li>Tassone, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+CGG+allele+size+and+prevalence+ascertained+through+newborn+screening+in+the+United+States.">FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States.</a> Genome Medicine. 4, 100 (2012).</li><li>Dombrowski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premutation+and+intermediate-size+FMR1+alleles+in+10572+males+from+the+general+population:+loss+of+an+AGG+interruption+is+a+late+event+in+the+generation+of+fragile+X+syndrome+alleles.">Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles.</a> Human Molecular Genetics. 11, 371-378 (2002).</li><li>Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+and+instability+of+fragile+X+alleles:+implications+for+offering+fragile+X+prenatal+diagnosis.">Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis.</a> Obstetrics and Gynecology. 111, 596-601 (2008).</li><li>Hayward, B. E., Kumari, D., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+assays+for+the+fragile+X-related+disorders.">Recent advances in assays for the fragile X-related disorders.</a> Human Genetics. 136, 1313-1327 (2017).</li><li>Seltzer, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+CGG+expansions+of+the+FMR1+gene+in+a+US+population-based+sample.">Prevalence of CGG expansions of the FMR1 gene in a US population-based sample.</a> American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).</li><li>Hayward, B. E., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assays+for+determining+repeat+number,+methylation+status,+and+AGG+interruptions+in+the+Fragile+X-related+disorders.">Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders.</a> Methods in Molecular Biology. , 49-59 (1942).</li><li>Orrico, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+full+mutation+and+normal-sized+allele+of+the+FMR1+gene:+a+new+case.">Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case.</a> American Journal of Medical Genetics. 78, 341-344 (1998).</li><li>Schmucker, B., Seidel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+a+full+mutation+and+a+normal+size+allele+in+two+fragile+X+males.">Mosaicism for a full mutation and a normal size allele in two fragile X males.</a> American Journal of Medical Genetics. 84, 221-225 (1999).</li></ol>

FXS הוא הגורם השכיח ביותר השני של ליקוי אינטלקטואלי לאחר טריזומיה 21, חשבונאות עבור כמעט אחד מחצית של פיגור שכלי מנטלי של X30, אשר עשוי להשפיע על כ 1 ב 4,000 זכרים 1 ב 8,000 נקבות. חשוב יותר, כמעט 1 ב 250 – 1000 הנקבות לשאת premutation, ואת התדר הזה הוא 1 ב 250 – 1600 בזכרים26,31...

תסמונת X שביר (FXS) ושברירי X הפרעות הקשורות, למשל, רעד תסמונת אטקסיה (FX-TAS), ואת אי ספיקה השחלות הראשונית (FX-פוי) נגרמים בעיקר על ידי ציטוסין-גואן-ין (CGG) טריאוקליאואס חוזר על התרחבות 5 ' לא תורגם אזור (UTR) של הפיגור שברירי X-1 (FMR1) גן על xq 27.31,2. חלבון FMR1 מקודד (FMRP) הוא חלבון רב-תפקודי מסוג RNA-binding המשויכים להתפתחות העצבית והפלסטיות הסינפטית על-ידי ויסות שילוב אלטרנטיבי, יציבות, והובלת הדנדריטים של mrna או סינתזה של מודליטינג של חלבונים חלקיים מתוך הסינפטית3,4,5,6,7.
הווריאציה הדינמית עם גודל החזרה CGG של > 200 מתוארת כמוטציה מלאה, אשר מעוררת את ההיפרלציה החריגה ובעקבות השתקה של FMR1 יזם8. העדר או חוסר של חלבון FMRP משבש את פיתוח עצבי נורמלי גורם FXS9, מאופיין בסימפטומים קליניים שונים, כולל מתון עד מוגבלות אינטלקטואלית חמורה, עיכוב התפתחותי, התנהגויות היפראקטיביות, קשרים עניים וביטויים אוטיסטים10,11,12. המצגת אצל הנקבה FXS לחולי הוא בדרך כלל מתון יותר מזה אצל זכרים. גודל החזרה CGG החל מ 55 אל 200 ו 45 כדי 54 מסווגים כסטטוס מוטציה וביניים, בהתאמה. בשל הרמה הגבוהה של חוסר יציבות, גודל החזרה cgg ב מוטציה או ביניים אלל ככל הנראה מתרחב כאשר מועברים מהורים לצאצאים13,14. לפיכך, נושאות עם אללים מוטציות בסיכון גבוה של הילדים מושפעים FXS בגלל התרחבות חוזר, ובמקרים מסוימים, אללים ביניים יכול להרחיב את גודל החזרה שלהם לטווח מוטציה מלא על פני שני דורות15, . שישה עשרה יתר על כן, זכרים עם premutation גם להעביר סיכון מוגבר לפתח מאוחר התפרצות FX-TAS17,18,19, בעוד נקבות premutation וטציה הם מראש עבור שני fx-TAS ו-fx-פוי20, 21,22. לאחרונה, דווח כי הפרעות הספקטרום האוטיסטי עם עיכוב התפתחותי ובעיות בהתנהגויות חברתיות מוצגות אצל ילדים עם premutation אללים 23,24.
כדי לקבוע את גודל החזרה cgg מדויק הוא של משמעות רבה עבור סיווג וחיזוי של FXS ו-X שברירי הפרעות הקשורות25,26. מבחינה היסטורית, התגובה הספציפית של CGG שרשרת פולימראז (PCR) עם שינוי גודל בתוספת ניתוח הכתם הדרומי היה תקן זהב עבור פרופיל מולקולרי של FMR1 cgg חוזר27. עם זאת, ה-PCR הספציפי המסורתי הוא פחות רגיש למוטציות גדולות עם יותר מ 100 כדי 130 חוזר ואינו מסוגל להגברה מוטציות מלאות27,28. יתר על כן, אלקטרופורזה קפילר על מנתח גנטי מסורתי לשינוי גודל נכשל לזהות FMR1 PCR מוצרים עם יותר מ-200 cgg חוזר. ניתוח הכתם הדרומי מאפשר הבידול של מגוון רחב יותר של גודל חוזר, מהרגיל למספרים חוזרים מוטציה מלאה, והיה בשימוש נרחב לאישור מוטציות מלאות (אצל גברים) וההבחנה heterozygous אללים עם מוטציה מלאה מ כנראה homozygous אללים עם גדלי חזרה נורמליים (אצל נקבות). עם זאת, הרזולוציה עבור כימות החזרה מוגבלת. חשוב מכך, אסטרטגיית הבדיקה של שלב אחר שלב היא אינטנסיבית לעבודה, גוזלת זמן וחסכונית.
כאן, אנו מציגים שיטה מדויקת ואיתנה המבוססת על PCR לכמת של CGG חוזר על FMR1. השלב הראשון של מבחן זה הוא הגברה PCR של רצפי חוזר ב 5 ' UTR של יזם FMR1 באמצעות ערכת X PCR שביר. מוצרי ה-PCR מטוהרים ושינוי גודל מבוצע על-ידי מכשיר אלקטרופורזה במיקרופלואידיסי, והפרשנות העוקבת של מספר cgg חוזרת באמצעות תוכנת הניתוח על-ידי התייחסות לתקנים הידועים ומבוססים על ה רציונל כי אורך קטע ה-PCR פרופורציונלי באופן ישיר למספר החזרה של CGG. מערכת ה-PCR כוללת ריאגנטים המקל על הגברה של האזור הגדול ביותר במערכת האנטי-GC העשיר. שיטת ה-PCR מבוססת ומסוגלת לזהות את כל הטווחים של CGG חוזר על FMR1 יזמים. זוהי שיטה חסכונית שיכולה למצוא יישום רחב באבחנה מולקולרית והקרנת של FXS ו-X שברירי הפרעות הקשורות עם פחות סיבוב הזמן וההשקעה בציוד ולכן, יכול להיות מנוצל בספקטרום רחב של קליני מעבדות.

<table>
	<tbody>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes</td>
			<td>Axygen</td>
			<td>PCR-02D-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free</td>
			<td>Ambion</td>
			<td>AM9849</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate</td>
			<td>Thermo Fisher</td>
			<td>AB0800</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Electrode cartridge</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: IKA vortex mixer</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Test chips</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit</td>
			<td>Agilent</td>
			<td>5067-1506</td>
			<td>For Fragment sizing</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Markers (green cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA chips</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Electrode Cleaner</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Spin Filter</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Syringe</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Chip priming station</td>
			<td>Agilent</td>
			<td>5065-4401</td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Cubee Mini-centrifuge</td>
			<td>GeneReach</td>
			<td>aqbd-i</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold</td>
			<td>Merck Millipore</td>
			<td>MSVMHTS00</td>
			<td>Vacuum instrument for Filter plate vacuum Manifold for PCR product purification</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Silicone stopper</td>
			<td>Merck Millipore</td>
			<td>XX2004718</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Vacuum pump</td>
			<td>Merck Millipore</td>
			<td>WP6122050</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Waste collection vessel</td>
			<td>Merck Millipore</td>
			<td>XX1004705</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit</td>
			<td>PerkinElmer</td>
			<td>3101-0010</td>
			<td>For PCR amplification</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit: Sample Diluent</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FragilEase PCR Buffer mix</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) 
			FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)</td>
		</tr>
		<tr>
			<td>FragilEase Polymerase</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FraXsoft analysis software</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR clean up plate: NucleoFast 96 PCR plate</td>
			<td>MACHEREY-NAGEL</td>
			<td>743100</td>
			<td></td>
		</tr>
		<tr>
			<td>reference DNA sample</td>
			<td>Coriell</td>
			<td>NA20240 &#38; NA20239</td>
			<td></td>
		</tr>
		<tr>
			<td>S1000 96-well Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1852196</td>
			<td>This can be replaced by other Thermal Cyclers (eg. Veriti&#8482; 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)</td>
		</tr>
		<tr>
			<td>TriNEST Incubator/Shaker instrument</td>
			<td>PerkinElmer</td>
			<td>1296-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977015</td>
			<td>For 2100 Bioanalyzer electrode cleaning</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific Industries</td>
			<td>SI-0256 (Model G560E)</td>
			<td>Conventional vortex mixer</td>
		</tr>
	</tbody>
</table>

a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene

תסמונת X שביר (FXS) והפרעות הקשורות נגרמות על ידי התרחבות של ציטוסין-גואן-גואן-גואנין (CGG) טריטוקלאואדה חוזר באזור 5 ' בלתי מתורגם (UTR) של פיגור שברירי X 1 (FMR1) גן יזם. מקובל, ניתוח מקטע של אלקטרופורזה קפילר על מנתח גנטי משמש לשינוי גודל CGG חוזר של FMR1, אך ניתוח כתמי דרומי נוסף נדרש למדידה מדויקת כאשר מספר החזרה גבוה מ-200. כאן, אנו מציגים שיטה מדויקת ואיתנה של תגובת שרשרת פולימראז (PCR) לקוונפיקציה של ה-CGG חוזר על FMR1. השלב הראשון של בדיקה זו הוא ה-PCR הגברה של רצפי חוזר ב 5 ' UTR של FMR1 יזם באמצעות ערכת ה-pcr X שביר, ואחריו טיהור של מוצרי ה-PCR ושינוי גודל על מכשיר אלקטרופורזה מיקרופלואידיסי נימי, ו פרשנות הבאה של מספר ה-CGG חוזר על-ידי התייחסות לתקנים עם הידוע חוזר באמצעות תוכנת הניתוח. שיטת ה-PCR מבוססת ומסוגלת לזהות את הטווח המלא של CGG חוזר על FMR1 יזמים, כולל אלה עם מספר חוזר של יותר מ 200 (מסווג כמוטציה מלאה), 55 כדי 200 (premutation), 46 ל54 (ביניים), ו 10 כדי 45 (רגיל). זוהי שיטה חסכונית המאפשרת סיווג של FXS ו-X שברירי הפרעות הקשורות עם החוסן וזמן דיווח מהיר.

התוצאות לשינוי גודל של התייחסות נקבה טרום מוטציה מדגם (NA20240, לחזור על גודל של 30 ו 80) ואת מוטציה מלאה נקבה התייחסות מדגם (NA20239, גודל חוזר של 20 ו 200) מוצגים באיור 1a ואיור 1a, בהתאמה. בדרך כלל, שני פסגות סמן (נמוך סמן 50 בסיס זוגות [bp] ו-סמן העליון 10,380 bp) נכללים בפרופיל גו...

Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

מדויק וחזק מבוסס תגובת שרשרת פולימראז ' המבוססת על ככמת ציטוסינוס-גואן ין-גואנין trinucleotide גאות חוזר על הפיגור שברירי X 1 גן מקלה אבחנה מולקולרית והקרנה של תסמונת X שביר והקשורות X שברירי הפרעות עם הזמן להסתובב קצר והשקעה בציוד.

בסיס מבוסס על תגובת שרשרת פולימראז חזקה עבור כימות ציטוסינוס-גואנין-גואנין Trinucleotide גאות חוזר בצורה שברירית X פיגור-1 גן

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

שיטה חסכונית זו יכולה למצוא יישומים רחבים באבחון מולקולרי והקרנה של FXS והפרעות שבירות הקשורות ל- X. זה מהיר בזמן המפנה ופחות השקעה בציוד. בדיקת PCR מבוססת PCR שלנו יכולה להקל על סיווג הספקטרום המלא של FXS והפרעות הקשורות ל-X שבירות, כולל ביניים, טרום-קדם ומוטציה מלאה עם חוסן ותנאי דיווח מהירים.ההליך יוכח על ידי וונג צ'ואה מ פרקיןאלמר סינגפור. התחל על ידי הסרת תערובת חיץ PCR, דגימת diluent, ודגימות DNA מהמקפיא 20 מעלות צלזיוס, ולהשאיר אותם בטמפרטורת החדר במשך 20 עד 30 דקות כדי להפשיר. לפני השימוש בריג'ינים, מערבולת ולסובב אותם לזמן קצר למטה.למדוד את ריכוז דגימת ה-DNA עם ספקטרופוטומטר, ואם יש צורך, לדלל אותו ל 25 ננוגרם למיקרוליטר עם דלואנט מדגם. סמן את הבארים של לוחית PCR כדי לזהות דגימות דנ"א של חומר עזר ובדוק ולחשב את מספר התגובות הדרושות לדגימות הבדיקה, הייחוס והבקרה השלילית. הכן את התערובת הראשית של PCR על ידי שילוב של 15 מיקרוליטרים של תערובת מאגר PCR ל- 0.6 מיקרוליטרים של דילואנט לדוגמה ו- 0.4 מיקרוליטרים של פולימראז עבור כל תגובה.מערבולת את התערובת ולסובב אותו. לאחר מכן מחלקים 18 מיקרוליטרים של התערובת לתוך כל באר. ואז פיפטה שני מיקרוליטרים של כל דנ"א לתוך באר המתאימה.מערבבים את הרייטים על ידי צינור למעלה ולמטה חמש פעמים, ואז לאטום את הצלחת. מניחים את הצלחת בתרמוציקלר ולהפעיל את PCR על פי הוראות כתב היד. מחממים את שייקר החממה ל-65 מעלות ומוסיפים 80 מיקרוליטרים של מאגר 1X TE לכל מוצר PCR.השתמש פיפטה רב ערוצית כדי להעביר את הדגימות לצלחת ניקוי PCR ולשים את הצלחת בשייקר. הדגירה אותו ב 65 מעלות צלזיוס תוך רועד ב 1200 סל"ד במשך 10 דקות. לאחר החממה, מקררים את שייקר החממה עד 25 מעלות צלזיוס, מניחים את מכשיר הוואקום ל-250 מיליבאר, ושואבים את הפתרון דרך המסנן.לאחר 15 דקות, בארות צריך לא נשאר נוזל. כבה את הוואקום והוסף 50 מיקרוליטרים של מאגר TE 1X לכל באר. שאף את הפתרון במשך 10 דקות באמצעות הגדרות ואקום קודמות.יבש את החלק התחתון של צלחת המסנן על ידי לחיצה עליו בחוזקה על ערימה של מגבות נייר ולאחר מכן להוסיף 20 microliters של מאגר TE 1X למרכז התחתון של כל באר. מניחים את הצלחת בשייקר ודגירה ב 25 מעלות צלזיוס תוך טלטול ב 1200 סל"ד במשך חמש דקות. לאחר הדגירה, להעביר לפחות 15 microliters של מוצר PCR מטוהרים צלחת PCR טרי 96 היטב.לפני תחילת, להביא את תרכיז צבע ה-DNA, מטריצת ג'ל DNA, סמן DNA, סולם DNA, ודגימות DNA מטוהרות לטמפרטורת החדר. הגדר את תחנת priming על ידי החלפת המזרק והתאמת לוח הבסיס, ולאחר מכן לשחרר את הידית של קליפ המזרק להחליק אותו למיקום העליון. התחל את תוכנת שינוי הגודל והכן את תערובת צבע הג'ל.מערבולת צבע להתרכז במשך 10 שניות, ולאחר מכן לסובב אותו. לאחר מכן, מוסיפים 25 מיקרוליטרים של הצבע לבקבוקון מטריצת ג'ל ומערבולת הפתרון לערבב. מעבירים את תערובת צבע הג'ל למסנן ספין, מניחים אותו בצנטריפוגה ומסובבים אותו במשך 10 דקות לפי 1500 גרם.כאשר מוכנים לטעון את תערובת צבע הג'ל, הכנס שבב דנ"א חדש לתחנת הפרימינג והוסף תשעה מיקרוליטרים של תערובת צבע הג'ל לתוך באר המסומנת ב- G.Close את תחנת הפרימינג וודא כי הבוכנה ממוקמת בסימן מיליליטר אחד. לחץ על בוכנה מזרק למטה עד שהוא מוחזק על ידי קליפ. המתן בדיוק 30 שניות ולאחר מכן שחרר את הסרטון.חכה עוד חמש שניות, ואז לאט לאט למשוך את הבוכנה בחזרה לתקרת מיליליטר אחת. פתח את תחנת priming ולהוסיף תשעה microliters של תערובת צבע ג'ל לתוך הבארים המסומנים עם G.Add חמישה microliters של סמן לתוך מסומן היטב עם סמל סולם וכל אחד 12 בארות מדגם. הוסף מיקרוליטר אחד של הסולם ל באר עם סמל הסולם מיקרוליטר אחד של מוצר PCR או מים ל בארות מדגם.מערבולת השבב לדקה אחת ב 2400 סל"ד. הכנס אותו לתוך bioanalyzer ולהפעיל את השבב בתוך חמש דקות. לאחר השלמת הפעולה, יצא את נתוני השיא כקבצי טבלת csv.דגימת נקבה premutation מדגם נקבה מוטציה מלאה משמשים כמו דגימות התייחסות. שיא סמן עליון ותחתון כלולים בפרופיל גודל הקטע, ובדרך כלל יש שיא מורכב פריימר בכ -95 זוגות בסיסים. דוגמאות הפניה אלה משמשות לבניית עקומה סטנדרטית של רגרסיה.העקומה הסטנדרטית של רגרסיה ליניארית משמשת לאחר מכן לחישוב גדלים חוזרים של דוגמאות לא ידועות. קליני נורמלי, ביניים, premutation, מוטציה מלאה, דגימות מוטציה מלאה פסיפס ניתן לסווג כראוי עם שיטה זו. במקרים מסוימים, רק שיא אחד מוצג בתוצאות אלקטרופורזה microfluidic, אשר ככל הנראה בשל נוכחותם של אללים הומופוביים נורמליים.סוג אחד של תוצאה תת-אופטימלית הוא הטיה בסיסית, שיכולה להיות מעורפלת או בלתי ניתנת לפענה, והיא חשודה בכך שהיא נגרמת על ידי תקלה במכשיר. בעת ניסיון הליך זה, חשוב להבטיח כמות מתאימה של DNA ואיכות לפני הפעלת הפרוטוקול. ניתן לבצע רצף גנים FMR1 כדי לזהות את תבנית ההפרעה של AGG.ואנזים הגבלה רגיש מתילציה או שינוי ביסולפיד ניתן להשתמש כדי לפקח על מצב מתילציה. זוהי טכניקה מהירה, חזקה וחסכונית. זה יסייע לחוקרים אחרים בביצוע מחקר מבוסס אוכלוסייה על מצב המוביל של FXS והפרעות הקשורות X שביר.

Research

JoVE Journal

Genetics

Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry

שרשרת פולימראז משופר אורך קטע התגובה הגבלת Genotyping פולימורפיזם של נפוחיתיים רעילים ידי נוזלי כרומטוגרפיה / ספקטרומטריית מסה

An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by ...

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

כימות פיגמנטציה בטן ב<em&gt; תסיסנית מלנוגאסטר</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

מתודולוגיה סטנדרטי כדי לבדוק באתר המוטגניות כפונקציה של תיקון נקודת מוטציה על ידי CRISPR/Cas9 ו- SsODN בתאי אדם

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

DNA חזקים בידוד ובנייה ספריית רצף תפוקה גבוהה עבור דגימות עשבייה

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

CRISPR בתיווך ארגון מחדש של הכרומטין לולאה

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

ג'ין המועמד בדיקות במחקרים קליניים עוקבה ועם Genotyping מרובבת ספקטרומטר מסה

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet יחיד שרשרת התגובה פולימראז דיגיטלי עבור זיהוי מקיף, בו זמנית של מוטציות באזורים חמה

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

זיהוי של אירועי רקומבינציה הומולוגית בתאי גזע עובריים בעכבר באמצעות סופג הדרומי ואת תגובת שרשרת פולימראזית

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome ...

Manipulation of Gene Function in Mexican Cavefish

מניפולציה של פונקציית ג'ין Cavefish מקסיקני

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

In vivo היישום של מערכת שליטה מרחוק עבור הביטוי מניפולציה של ג'ין אנדוגני

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...