Name: a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene
Uploaded: 2019-09-16T13:00:00
Description: Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

이 연구는 NSFC 비상 관리 프로젝트 (그랜트 번호 81741004), 중국의 국립 자연 과학 재단 (그랜트 번호 81860272), 광시 지방 과학 기술 재단의 주요 연구 계획 ( 그랜트 번호 AB16380219), 중국 박사 후 과학 재단 보조금 (그랜트 번호 2018M630993), 광시 자연 과학 재단 (그랜트 번호 2018GXNSFAA281067).

홍콩 공동 중국대학-신계 동쪽 클러스터 임상 연구 윤리위원회(참조 번호: 2013.055)
1. PCR 증폭
<ol><li>시작하기 전에 PCR 완충제 혼합물, 시료 희석제 및 DNA 샘플(검사 및 참조 DNA 모두)을-20°C 냉동고에서 제거하고 모든 시약과 DNA가 완전히 해동되었는지 확인하기 위해 실온에서 20-30분 동안 보관하십시오. 소용돌이와 사용하기 전에 잠시 아래로 돌루.</li>
	<li>분광광?...

<ol>
	<li>Verkerk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+gene+(FMR-1)+containing+a+CGG+repeat+coincident+with+a+breakpoint+cluster+region+exhibiting+length+variation+in+fragile+X+syndrome.">Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.</a> Cell. 65, 905-914 (1991).</li><li>Fu, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+of+the+CGG+repeat+at+the+fragile+X+site+results+in+genetic+instability:+resolution+of+the+Sherman+paradox.">Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.</a> Cell. 67, 1047-1058 (1991).</li><li>Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+functions+for+FMRP+in+axon+growth+cone+motility+and+activity-dependent+regulation+of+filopodia+and+spine+synapses.">Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses.</a> Molecular and Cellular Neurosciences. 32, 37-48 (2006).</li><li>Didiot, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+G-quartet+containing+FMRP+binding+site+in+FMR1+mRNA+is+a+potent+exonic+splicing+enhancer.">The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer.</a> Nucleic Acids Research. 36, 4902-4912 (2008).</li><li>Bechara, E. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+function+for+fragile+X+mental+retardation+protein+in+translational+activation.">A novel function for fragile X mental retardation protein in translational activation.</a> PLoS Biology. 7, e16 (2009).</li><li>Ascano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMRP+targets+distinct+mRNA+sequence+elements+to+regulate+protein+expression.">FMRP targets distinct mRNA sequence elements to regulate protein expression.</a> Nature. 492, 382-386 (2012).</li><li>Kenny, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOV10+and+FMRP+regulate+AGO2+association+with+microRNA+recognition+elements.">MOV10 and FMRP regulate AGO2 association with microRNA recognition elements.</a> Cell Reports. 9, 1729-1741 (2014).</li><li>Oberle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instability+of+a+550-base+pair+DNA+segment+and+abnormal+methylation+in+fragile+X+syndrome.">Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome.</a> Science. 252, 1097-1102 (1991).</li><li>Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+syndrome+and+targeted+treatment+trials.">Fragile X syndrome and targeted treatment trials.</a> Results and Problems in Cell Differentiation. 54, 297-335 (2012).</li><li>Hatton, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autistic+behavior+in+children+with+fragile+X+syndrome:+prevalence,+stability,+and+the+impact+of+FMRP.">Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP.</a> American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).</li><li>Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-linked+mental+retardation+with+the+fragile+X.+A+study+of+15+families.">X-linked mental retardation with the fragile X. A study of 15 families.</a> Human Genetics. 59, 281-289 (1981).</li><li>Backes, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cognitive+and+behavioral+profile+of+fragile+X+boys:+correlations+to+molecular+data.">Cognitive and behavioral profile of fragile X boys: correlations to molecular data.</a> American Journal of Medical Genetics. 95, 150-156 (2000).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+analysis+of+1112+prenatal+samples+from+1991+to+2010.">Fragile X analysis of 1112 prenatal samples from 1991 to 2010.</a> Prenatal Diagnosis. 31, 925-931 (2011).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+the+fragile+X+CGG+repeat+in+females+with+premutation+or+intermediate+alleles.">Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles.</a> American Journal of Human Genetics. 72, 454-464 (2003).</li><li>Fernandez-Carvajal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+an+FMR1+grey-zone+allele+to+a+full+mutation+in+two+generations.">Expansion of an FMR1 grey-zone allele to a full mutation in two generations.</a> Journal of Molecular Diagnostics. 11, 306-310 (2009).</li><li>Terracciano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+to+full+mutation+of+a+FMR1+intermediate+allele+over+two+generations.">Expansion to full mutation of a FMR1 intermediate allele over two generations.</a> European Journal of Human Genetics. 12, 333-336 (2004).</li><li>Garcia-Arocena, D., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+the+molecular+basis+of+FXTAS.">Advances in understanding the molecular basis of FXTAS.</a> Human Molecular Genetics. 19, R83-R89 (2010).</li><li>Juncos, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+clinical+findings+in+the+fragile+X-associated+tremor+ataxia+syndrome+(FXTAS).">New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS).</a> Neurogenetics. 12, 123-135 (2011).</li><li>Hagerman, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intention+tremor,+parkinsonism,+and+generalized+brain+atrophy+in+male+carriers+of+fragile+X.">Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X.</a> Neurology. 57, 127-130 (2001).</li><li>Conway, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premature+ovarian+failure+and+FMR1+gene+mutations:+an+update.">Premature ovarian failure and FMR1 gene mutations: an update.</a> Annales d'endocrinologie. 71, 215-217 (2010).</li><li>Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+premutations+in+familial+premature+ovarian+failure.">Fragile X premutations in familial premature ovarian failure.</a> Lancet. 346, 309-310 (1995).</li><li>Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Very+early+premature+ovarian+failure+in+two+sisters+compound+heterozygous+for+the+FMR1+premutation.">Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation.</a> European Journal of Medical Genetics. 52, 37-40 (2009).</li><li>Bourgeois, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+fragile+X+premutation+disorders:+expanding+the+psychiatric+perspective.">A review of fragile X premutation disorders: expanding the psychiatric perspective.</a> Journal of Clinical Psychiatry. 70, 852-862 (2009).</li><li>Farzin, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autism+spectrum+disorders+and+attention-deficit/hyperactivity+disorder+in+boys+with+the+fragile+X+premutation.">Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation.</a> Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).</li><li>Hantash, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+premutation+carrier+frequency+in+patients+undergoing+routine+population-based+carrier+screening:+insights+into+the+prevalence+of+fragile+X+syndrome,+fragile+X-associated+tremor/ataxia+syndrome,+and+fragile+X-associated+primary+ovarian+insufficiency+in+the+United+States.">FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States.</a> Genetics in Medicine. 13, 39-45 (2011).</li><li>Kraan, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+allele+size+distribution+in+35,000+males+and+females:+a+comparison+of+developmental+delay+and+general+population+cohorts.">FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts.</a> Genetics in Medicine. 20 (12), 1627-1634 (2018).</li><li>Saul, R. A., Tarleton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1-Related+Disorders.">FMR1-Related Disorders.</a> GeneReviews. , (2012).</li><li>Amos Wilson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consensus+characterization+of+16+FMR1+reference+materials:+a+consortium+study.">Consensus characterization of 16 FMR1 reference materials: a consortium study.</a> Journal of Molecular Diagnostics. 10, 2-12 (2008).</li><li>Kwok, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+robust+PCR-based+assay+for+quantifying+fragile+X+CGG+repeats.">Validation of a robust PCR-based assay for quantifying fragile X CGG repeats.</a> Clinica Chimica Acta. 456, 137-143 (2016).</li><li>Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+carriers+of+premutation-size+alleles+of+the+FMRI+gene--and+implications+for+the+population+genetics+of+the+fragile+X+syndrome.">Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome.</a> American Journal of Human Genetics. 57, 1006-1018 (1995).</li><li>Tassone, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+CGG+allele+size+and+prevalence+ascertained+through+newborn+screening+in+the+United+States.">FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States.</a> Genome Medicine. 4, 100 (2012).</li><li>Dombrowski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premutation+and+intermediate-size+FMR1+alleles+in+10572+males+from+the+general+population:+loss+of+an+AGG+interruption+is+a+late+event+in+the+generation+of+fragile+X+syndrome+alleles.">Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles.</a> Human Molecular Genetics. 11, 371-378 (2002).</li><li>Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+and+instability+of+fragile+X+alleles:+implications+for+offering+fragile+X+prenatal+diagnosis.">Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis.</a> Obstetrics and Gynecology. 111, 596-601 (2008).</li><li>Hayward, B. E., Kumari, D., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+assays+for+the+fragile+X-related+disorders.">Recent advances in assays for the fragile X-related disorders.</a> Human Genetics. 136, 1313-1327 (2017).</li><li>Seltzer, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+CGG+expansions+of+the+FMR1+gene+in+a+US+population-based+sample.">Prevalence of CGG expansions of the FMR1 gene in a US population-based sample.</a> American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).</li><li>Hayward, B. E., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assays+for+determining+repeat+number,+methylation+status,+and+AGG+interruptions+in+the+Fragile+X-related+disorders.">Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders.</a> Methods in Molecular Biology. , 49-59 (1942).</li><li>Orrico, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+full+mutation+and+normal-sized+allele+of+the+FMR1+gene:+a+new+case.">Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case.</a> American Journal of Medical Genetics. 78, 341-344 (1998).</li><li>Schmucker, B., Seidel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+a+full+mutation+and+a+normal+size+allele+in+two+fragile+X+males.">Mosaicism for a full mutation and a normal size allele in two fragile X males.</a> American Journal of Medical Genetics. 84, 221-225 (1999).</li></ol>

FXS는 삼중 21 후 지적 장애의 두 번째 가장 흔한 원인이며, X 연결 정신 지체30의거의 절반을 차지하며, 이는 4,000명의 남성중 약 1명, 8,000명의 여성 중 1명에 영향을 미칠 수 있습니다. 더 중요한 것은, 250-1,000명의 암컷에 있는 거의 1은 premutation를 전송하고, 이 주파수는 남성26,31,32,33에서</s...

깨지기 쉬운 X 증후군 (FXS) 및 깨지기 쉬운 X 관련 무질서, 예를 들면, 전율 및 운동 실조 증후군 (FX-TAS), 및 1 차적인 난소 불충분 (FX-POI)는 주로 5'번역되지 않은 에 있는 cytosine 구아닌 구아닌 (CGG) trinucleotide 반복 확장에 기인합니다 Xq27.31,2에깨지기 쉬운 X 정신 지체-1(FMR1)유전자의 영역 (UTR) FMR1 인코딩 단백질 (FMRP)은 mRNA의 대체 접합, 안정성 및 수지상 수송을 조절하여 신경 발달 및 시냅스 가소성에서 작동하는 폴리리보솜 관련 RNA 결합 단백질 또는 변조 합성입니다. 부분 적인 후두 단백질의 3,4 ,5,6,7.
>200의 CGG 반복 크기를 가진 동적 변이는 전체 돌연변이로 설명되며, 이는 FMR1 프로모터8의비정상적인 하이퍼메틸화 및 후속 전사 침묵을 유도한다. FMRP 단백질의 부재 또는 부족은 정상적인 신경 발달을 방해하고 FXS9를일으키며, 중등도에서 중증의 지적 장애, 발달 지연, 비활동성 행동, 가난한 접촉과 자폐증 표현10,11,12. 여성 FXS 환자에 있는 프리젠테이션은 일반적으로 남성에서 보다는 온화합니다. CGG 반복 크기는 각각 55에서 200 및 45~54에 이르는 선열 상태와 중간 상태로 분류됩니다. 높은 수준의 불안정성으로 인해, CGG 반복 크기는 부모로부터 자손13,14로전염될 때 아마도 확장될 것이다. 따라서, 전열 대말기를 가진 운반대는 반복 적인 팽창 때문에 FXS에 영향을 받은 아이들이 있는 의 고위험에 이고, 어떤 경우에는, 중간 대두는 2 세대15에걸쳐 전체 돌연변이 범위로 그들의 반복 크기를 확장할 수 있습니다15, 16. 또한, 전열을 가진 남성은 또한 FX-TAS와 FX-POI20둘 다에 걸리기 위하여 전열 암컷이 걸리기 동안, 늦은 개시 FX-TAS17,18,19,개발의 증가한 리스크를전달합니다, 21,22. 최근에는 발달 지연과 사회 행동의 문제가 있는 자폐 스펙트럼 장애가 FMR1 대립유전자전형인 어린이(23,24)에서제시되는 것으로 보고되고 있다.
정확한 CGG 반복 크기를 결정하는 것은 FXS 및 깨지기 쉬운 X-관련장애(25,26)의분류 및 예측에 큰 의미가 있다. 역사적으로, 단편 크기 조정을 더한 CGG 반복 영역 별 중합효소 연쇄 반응(PCR)은 FMR1 CGG 반복27의분자 프로파일링을 위한 금 본위제였다. 그러나, 전통적인 특이적 PCR은 100 개 이상의 130 회 이상의 반복을 가진 큰 전열에 덜 민감하고 전체 돌연변이27,28을증폭시킬 수 없다. 또한, 반복 크기 조정을 위한 전통적인 유전자 분석기의 모세관 전기 동공은 200CGG 이상의 반복으로 FMR1 PCR 제품을 검출하지 못합니다. 남부 얼룩 분석은 정상에서 전체 돌연변이 반복 수에 이르기까지 더 넓은 범위의 반복 크기를 분화할 수 있게 해주며, 전체 돌연변이(남성에서) 전체 돌연변이를 확인하고 전체 돌연변이를 가진 헤테로지구스 알레를 분화하는 데 널리 사용되어 왔습니다. 분명히 동형 접합 대말레는 정상 크기의 (여성에서). 그러나 반복을 정량화하기 위한 해상도는 제한적입니다. 더 중요한 것은 이 단계별 테스트 전략은 노동 집약적이고 시간이 많이 소요되며 비용이 비효율적이라는 것입니다.
여기서는 FMR1의CGG 반복을 정량화하기 위한 정확하고 견고한 PCR 기반 방법을 제시합니다. 이 시험의 첫 번째 단계는 깨지기 쉬운 X PCR 키트를 사용하여 FMR1 프로모터의 5'UTR에서 반복 서열의 PCR 증폭이다. PCR 제품은 정제되고 단편 크기 조정은 미세 유체 모세관 전기 동공 계측기에서 수행되며, 후속 해석 소프트웨어를 사용하여 CGG 반복 횟수를 해석하여 공지된 반복으로 표준을 참조하여 PCR 조각 길이가 CGG 반복 횟수에 정비례한다는 근거입니다. PCR 시스템은 고도로 풍부한 삼뉴클레오티드 반복 영역의 증폭을 용이하게 하는 시약을 포함한다. 이러한 PCR 기반 분석은 재현가능하고 FMR1 프로모터의 모든 CGG 반복을 식별할 수 있다. 이것은 FXS 및 깨지기 쉬운 X 관련 장애의 분자 진단 및 스크리닝에서 광범위한 응용 을 찾을 수있는 비용 효율적인 방법이며, 따라서 장비에 대한 턴어라운드 시간과 투자가 적어 광범위한 임상 스펙트럼에서 활용 될 수 있습니다. 실험실.

<table>
	<tbody>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes</td>
			<td>Axygen</td>
			<td>PCR-02D-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free</td>
			<td>Ambion</td>
			<td>AM9849</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate</td>
			<td>Thermo Fisher</td>
			<td>AB0800</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Electrode cartridge</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: IKA vortex mixer</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Test chips</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit</td>
			<td>Agilent</td>
			<td>5067-1506</td>
			<td>For Fragment sizing</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Markers (green cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA chips</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Electrode Cleaner</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Spin Filter</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Syringe</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Chip priming station</td>
			<td>Agilent</td>
			<td>5065-4401</td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Cubee Mini-centrifuge</td>
			<td>GeneReach</td>
			<td>aqbd-i</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold</td>
			<td>Merck Millipore</td>
			<td>MSVMHTS00</td>
			<td>Vacuum instrument for Filter plate vacuum Manifold for PCR product purification</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Silicone stopper</td>
			<td>Merck Millipore</td>
			<td>XX2004718</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Vacuum pump</td>
			<td>Merck Millipore</td>
			<td>WP6122050</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Waste collection vessel</td>
			<td>Merck Millipore</td>
			<td>XX1004705</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit</td>
			<td>PerkinElmer</td>
			<td>3101-0010</td>
			<td>For PCR amplification</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit: Sample Diluent</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FragilEase PCR Buffer mix</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) 
			FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)</td>
		</tr>
		<tr>
			<td>FragilEase Polymerase</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FraXsoft analysis software</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR clean up plate: NucleoFast 96 PCR plate</td>
			<td>MACHEREY-NAGEL</td>
			<td>743100</td>
			<td></td>
		</tr>
		<tr>
			<td>reference DNA sample</td>
			<td>Coriell</td>
			<td>NA20240 &#38; NA20239</td>
			<td></td>
		</tr>
		<tr>
			<td>S1000 96-well Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1852196</td>
			<td>This can be replaced by other Thermal Cyclers (eg. Veriti&#8482; 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)</td>
		</tr>
		<tr>
			<td>TriNEST Incubator/Shaker instrument</td>
			<td>PerkinElmer</td>
			<td>1296-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977015</td>
			<td>For 2100 Bioanalyzer electrode cleaning</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific Industries</td>
			<td>SI-0256 (Model G560E)</td>
			<td>Conventional vortex mixer</td>
		</tr>
	</tbody>
</table>

a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene

깨지기 쉬운 X 증후군(FXS) 및 관련 장애는 연약한 X 정신지체-1(FMR1)유전자 프로모터의 5' 번역되지 않은 영역(UTR)에서 시토신 구아닌(CGG) 삼뉴클레오티드 반복의 확장에 의해 유발된다. 종래에는 유전분석기의 모세관 전기동공단편 분석이 FMR1의CGG 반복의 크기 조정에 사용되지만, 반복 횟수가 200개 이상일 때 정확한 측정을 위해 추가적인 남부 얼룩 분석이 요구된다. 여기서, 우리는 FMR1의CGG 반복의 정량화를 위한 정확하고 견고한 중합효소 연쇄 반응(PCR) 기반 방법을 제시한다. 이 시험의 첫 번째 단계는 깨지기 쉬운 X PCR 키트를 사용하여 FMR1 프로모터의 5'UTR에서 반복 서열을 증폭한 다음, PCR 제품의 정제 및 미세 유체 모세관 전기 동공 계측기의 단편 크기 조정, 및 분석 소프트웨어를 사용하여 알려진 반복으로 표준을 참조하여 CGG 반복 횟수를 후속 해석합니다. 이러한 PCR 기반 분석법들은 재현가능하고 200개 이상의 반복 횟수(전체 돌연변이로 분류됨), 55~200(전분), 46~54(중간), 및 10을 포함하는 FMR1 프로모터의 전체 범위의 CGG 반복을 식별할 수 있다. 45 (정상). 그것은 견고성과 빠른보고 시간으로 FXS 및 깨지기 쉬운 X 관련 장애의 분류를 용이하게하는 비용 효율적인 방법입니다.

상기 전돌연변이 암 기준 샘플(NA20240, 30 및 80의 반복 크기)과 전체 돌연변이 암 기준 샘플(NA20239, 20 및 200의 반복 크기)의 크기 조정 결과는 각각 도 1A 및 도 1B에나타내고 있다. 전형적으로, 2개의 마커 피크(하부 마커 50 염기 쌍 [bp] 및 상부 마커 10,380 bp)는 단편 크기 프로파일에 포함된다. 일반적으로 거의 95 bp의 크기와 프라이머 복잡한 피크가있다. 참?...

Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

연약한 X 정신 지체-1 유전자에서 시토신 구아닌-구아닌 트리뉴클레오티드 반복을 정량화하기 위한 정확하고 견고한 중합효소 연쇄 반응 기반 분석은 깨지기 쉬운 X 증후군 및 연약한 X 증후군및 연약한 X 관련의 분자 진단 및 스크리닝을 용이하게 합니다. 턴라운드 시간이 짧고 장비에 대한 투자가 부족합니다.

깨지기 쉬운 X 정신 지체-1 유전자에서 시토신 구아닌-구아닌 트리뉴클레오티드 반복을 정량화하기 위한 견고한 폴리머라제 연쇄 반응 기반 분석

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

이 비용 효율적인 방법은 FXS 및 깨지기 쉬운 X 관련 질환의 분자 진단 및 스크리닝에서 광범위한 응용 프로그램을 찾을 수 있습니다. 소요 시간이 빠르고 장비에 대한 투자가 줄어듭니다. 당사의 PCR 기반 분석체는 견고성과 신속한 보고 시간을 가진 중간, 사전 순열 및 완전한 돌연변이를 포함하여 FXS 및 깨지기 쉬운 X 관련 무질서의 전체 스펙트럼의 분류를 촉진할 수 있습니다.절차는 퍼키넬머 싱가포르의 웬 추아에 의해 입증될 것입니다. PCR 버퍼 믹스, 샘플 희석제 및 DNA 샘플을 섭씨 20도 냉동고에서 제거하고 해동하는 데 20~30분 동안 실온에서 둡시하십시오. 시약을 사용하기 전에, 소용돌이와 잠시 아래로 회전.분광계로 DNA 샘플 농도를 측정하고 필요한 경우 샘플 희석제를 사용하여 마이크로리터 당 25 나노그램으로 희석합니다. PCR 플레이트의 웰에 레이블을 지정하여 참조 및 테스트된 DNA 샘플을 식별하고 검사, 참조 및 음수 제어 샘플에 필요한 반응 수를 계산합니다. PCR 버퍼 믹스 15마이크로리터를 샘플 희석제 0.6 마이크로리터및 각 반응에 대해 폴리머라제 0.4 마이크로리터를 결합하여 PCR 마스터 믹스를 준비한다.믹스를 소용돌이시키고 아래로 회전합니다. 그런 다음 혼합물의 18 마이크로리터를 각 우물에 분배합니다. 그런 다음 각 DNA의 두 마이크로 리터를 적절한 우물로 피펫합니다.시약을 5번 위아래로 파이프로 섞은 다음 판을 밀봉합니다. 플레이트를 열순환기에 놓고 원고 의 방향에 따라 PCR을 실행합니다. 인큐베이터 셰이커를 섭씨 65도로 예열하고 각 PCR 제품에 1X TE 버퍼 80마이크로리터를 추가합니다.멀티채널 파이펫을 사용하여 샘플을 PCR 정리 플레이트로 옮기고 플레이트를 셰이커에 넣습니다. 1200 RPM에서 10 분 동안 흔들면서 섭씨 65도에서 배양하십시오. 인큐베이션 후 인큐베이터 셰이커를 섭씨 25도로 식히고 진공 기기를 250밀리바르로 설정하고 필터를 통해 용액을 흡인시합니다.15분 후, 우물에는 액체가 남아 있지 않아야 합니다. 진공을 끄고 각 웰에 1X TE 버퍼50 마이크로리터를 추가합니다. 이전 진공 설정을 사용하여 10분 동안 솔루션을 흡인합니다.종이 타월 더미에 단단히 눌러 필터 플레이트의 바닥을 건조한 다음 각 우물의 하단 중앙에 1X TE 버퍼 20 마이크로리터를 추가합니다. 접시를 셰이커에 놓고 섭씨 25도에 배양하고 1200 RPM에서 5분간 흔들어 줍니다. 인큐베이션 후, 정제된 PCR 제품의 최소 15마이크로리터를 신선한 96웰 PCR 플레이트로 전송한다.시작하기 전에 DNA 염료 농축물, DNA 젤 매트릭스, DNA 마커, DNA 사다리 및 정제 된 DNA 샘플을 실온으로 가져옵니다. 주사기를 교체하고 베이스 플레이트를 조정하여 프라이밍 스테이션을 설정한 다음 주사기 클립의 레버를 놓고 상단 위치로 밀어 넣습니다. 크기 조정 소프트웨어를 시작하고 젤 염료 믹스를 준비합니다.염료 농축액을 10초 동안 소용돌이치게 한 다음 아래로 회전합니다. 그런 다음, 젤 매트릭스 바이알에 염료의 25 마이크로 리터를 추가하고 혼합용액을 소용돌이. 젤 염료 믹스를 스핀 필터로 옮기고 원심분리기에 놓고 1500g에서 10분간 회전합니다.젤 염료 믹스를 로드할 준비가 되면 새로운 DNA 칩을 프라이밍 스테이션에 삽입하고 G.Close로 표시된 젤 염료 믹스의 9마이크로리터를 프라이밍 스테이션에 넣고 플런서가 1 밀리리터 마크에 배치되도록 합니다. 주사기 플런저를 클립에 의해 보관될 때까지 아래로 누릅니다. 정확히 30초 동안 기다린 다음 클립을 놓습니다.5초 더 기다린 다음 플런저를 1밀리리터 위치로 천천히 당깁니다. 프라이밍 스테이션을 열고 G.Add 5 마이크로리터의 마커를 사다리 기호와 12개의 샘플 우물각각에 추가하여 젤 염료 믹스 9개를 우물에 넣습니다. 사다리 기호와 PCR 제품 또는 물의 마이크로리터 1개를 샘플 우물에 추가하여 사다리의 마이크로리터 1개를 우물에 추가합니다.2400 RPM에서 1 분 동안 칩을 소용돌이. 이를 생체 분석기에 삽입하고 5분 이내에 칩을 실행합니다. 실행이 완료되면 피크 데이터를 csv 테이블 파일로 내보냅니다.전열 여성 샘플및 전체 돌연변이 여성 샘플은 참조 샘플로 사용됩니다. 상하 마커 피크는 단편 크기 프로파일에 포함되며 일반적으로 약 95개의 기본 쌍에서 프라이머 복합 피크가 있습니다. 이러한 참조 샘플은 회귀 표준 곡선을 구성하는 데 사용됩니다.그런 다음 선형 회귀 표준 곡선을 사용하여 알 수 없는 샘플의 반복 크기를 계산합니다. 임상 정상, 중간, 전열, 전체 돌연변이 및 모자이크 전체 돌연변이 샘플은 이 방법으로 올바르게 분류될 수 있다. 경우에 따라, 정상 균질 알렐의 존재로 인해 가능성이 있는 미세 유체 전기 포감 결과에 하나의 피크가 표시됩니다.최적이 아닌 결과의 한 가지 유형은 모호하거나 해석할 수 없는 기준 편향이며 기기 오작동으로 인한 것으로 의심됩니다. 이 절차를 시도할 때 프로토콜을 시작하기 전에 적절한 양의 DNA와 품질을 보장하는 것이 중요합니다. FMR1 유전자 염기서열분석은 AGG 중단 패턴을 확인하기 위해 수행될 수 있다.그리고 메틸화에 민감한 제한 효소 또는 양성환 변형 분석이 메틸화 상태를 모니터링하는 데 사용될 수 있다. 이것은 빠르고 견고하며 비용 효율적인 기술입니다. 그것은 FXS와 깨지기 쉬운 X 관련 무질서의 캐리어 상태에 인구 기지를 둔 연구 결과에서 그밖 연구원을 도울 것입니다.

Research

JoVE Journal

Genetics

Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry

액체 크로마토 그래피 / 질량 분석 유독 복어의 개선 중합 효소 연쇄 반응 - 제한 조각의 길이 다형성 유전자형

An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by ...

연구

유전학

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

복부 색소 침착 정량화<em&gt; Drosophila melanogaster</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

점 돌연변이 수리 CRISPR/Cas9 및 SsODN 인간 세포에 의해 촉매의 기능으로 현지 변이 검사 하는 표준 방법론

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

강력한 DNA 고립과 표 본관 표본에 대 한 높은 처리량 시퀀싱 도서관 건축

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

후보 유전자 다중화 유전형과 질량 분석 임상 코 호트 연구에서 테스트

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

하나의 물방울 디지털 연쇄 반응 핫스팟 지역에서 돌연변이의 포괄적이 고 동시 검색

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

마우스 배아 줄기 세포 사용 하 여 남부 럽 연쇄 반응에서에서 동종 재결합 이벤트의 식별

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome ...

Manipulation of Gene Function in Mexican Cavefish

멕시코 Cavefish에서 유전자 기능 조작

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Vivo 내 인 성 유전자 발현의 조작에 대 한 원격 제어 시스템의 응용 프로그램에서

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...