Name: highly efficient transfection of primary macrophages with in vitro transcribed mrna
Uploaded: 2019-11-09T13:00:00
Description: Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Dit werk werd gesteund door de Deutsche Forschungsgemeinschaft (SFB 670).

Macrofaag isolatie van muizen werd uitgevoerd in overeenstemming met de Dierenbeschermings wetgeving van Duitsland in overeenstemming met de ethische commissie van de Universiteit van Keulen.
Opmerking: Voer alle stappen uit die handschoenen dragen. Voer alle transfectiestappen uit onder een laminaire stroom afzuigkap om besmetting van de cellen te voorkomen. Reinig voordat u met mRNA werkt alle instrumenten zoals pipetten en elk oppervlak met 70% ethanol en/of een RNAse-verne...

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

Hier presenteren we een protocol voor zeer efficiënte transfectie van meestal moeilijk te transfect primaire macrofagen met in vitro getranscribeerd mRNA. Belangrijk is dat de transfectie van de macrofagen met behulp van dit protocol geen celdood induceert of proinflammatoire signalering activeert die aangeeft dat noch het transfectiereagens noch de getransfunteerde mRNA als niet-zelf worden herkend.
De kwaliteit van de mRNA is van cruciaal belang voor een succesvolle transfectie van macrofag...

Macrofagen zijn fagocytische cellen die gespecialiseerd zijn in het opsporen, inname en vernederende microben, apoptotische cellen en cellulair puin. Bovendien, ze helpen om het orthese van immuunresponsen door het afscheidende cytokines en chemokines en door het presenteren van antigenen aan T-cellen en B-cellen. Macrofagen spelen ook belangrijke rollen in tal van andere processen, zoals wondgenezing, atherosclerose, tumorvorming en obesitas.
Om niet-zelf moleculen zoals pathogeen-geassocieerde moleculaire patronen (PAMPs) en out-of-place moleculen zoals schade-geassocieerde moleculaire patronen (DAMPs) te kunnen detecteren, zijn macrofagen uitgerust met een groot aantal patroon herkennings receptoren (PRR)1. Helaas maakt dit ook macrofagen bijzonder uitdagend voor transfect2 , omdat de transfectie-reagens 3 en de geoverde nucleïnezuren4,5,6,7 vaak door de PRRS worden herkend als niet-zelf. Om deze reden, transfectie van macrofagen met behulp van chemische of fysische methoden8 resulteert meestal in macrofaag activering en afbraak van de getransfuneerde nucleïnezuren of zelfs in macrofaag zelfmoord via pyroptosis, een vorm van geprogrammeerde lytische celdood geactiveerd na herkenning van cytosolische pamps/DAMPS zoals DNA of buitenlandse RNA9. Biologische transfectie van macrofagen met behulp van virussen zoals adenovirussen of lentivirussen als vectoren is vaak efficiënter, maar de bouw van dergelijke virale vectoren is tijdrovend en vereist bioveiligheid niveau 2-apparatuur10,11.
Dus, hoewel macrofagen het onderwerp zijn van intensief onderzoek, wordt de analyse van hun functies op moleculair niveau belemmerd, omdat een van de belangrijkste instrumenten van moleculaire biologie, de transfectie van nucleïnezuur constructies voor exogene expressie van eiwitten, is nauwelijks toepasbaar. Dit dwingt onderzoekers vaak macrofaag-achtige cellijnen te gebruiken in plaats van bonafide macrofagen. Toepassingen voor nucleïnezuur construct trans fectie omvatten expressie van gemuleerde of gelabelde eiwit versies, overexpressie van een specifiek eiwit, eiwit re-expressie in een respectieve Knockout achtergrond en expressie van eiwitten van andere soorten (bijv. , CRE of of leid RNA en Cas9 voor gerichte genen knock-out).
Hier beschrijven we een protocol dat zeer efficiënte transfectie van (meestal moeilijk te transfect) primaire macrofagen toestaat, dat is Murine peritoneale macrofagen (PM) en met beenmerg afgeleide macrofagen (BMDM) met mRNA gegenereerd uit DNA-sjablonen zoals plasmiden. Belangrijk is dat de in vitro getranscribeerde mRNA die met dit protocol is gegenereerd, de natuurlijk voorkomende gemodificeerde nucleosiden 5-methyl-CtP en pseudo-UTP bevat die de immunogeniciteit verminderen en de stabiliteit verhogen4,6,7,12,13. Bovendien worden de 5 '-uiteinden van de in vitro getranscribeerde mRNA gedefosforyleerd door Antarctische fosfatase om herkenning door de Rig-I complex14,15te voorkomen. Dit minimaliseert de aangeboren immuunherkenning van de in vitro getranscribeerd mRNA. Met ons eenvoudig uit te voeren protocol worden transfectie percentages tussen 50-65% (peritoneale macrofagen (PM)) en 85% (BMDM) bereikt terwijl, belangrijker nog, er geen cytotoxiciteit of immunogeniciteit is waargenomen. We beschrijven in detail (i) hoe de immunologisch gesilenced mRNA voor Transfectie kan worden gegenereerd uit DNA-constructies zoals plasmiden en (II) de transfectie procedure zelf.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>821,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre
recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and
an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

Macrofagen zijn fagocytische cellen gespecialiseerd in het opsporen van moleculen van niet-eigen oorsprong. Daartoe zijn ze uitgerust met een groot aantal patroon herkennings receptoren (PRRs). Helaas maakt dit ook macrofagen bijzonder uitdagend om te transfect als het transfectie-reagens en de getransfuneerde nucleïnezuren vaak worden herkend door de PRRS als niet-zelf. Daarom resulteert transfectie vaak in macrofaag activatie en afbraak van de getransfunde nucleïnezuren of zelfs bij zelfmoord op de macrofagen. Hier beschrijven we een protocol dat een zeer efficiënte transfectie van Murine primaire macrofagen zoals peritoneale macrofagen (PM) en met beenmerg afgeleide macrofagen (BMDM) mogelijk maakt met mRNA in vitro getranscribeerd uit DNA-templates zoals plasmiden. Met dit eenvoudige protocol worden transfectie percentages van ongeveer 50-65% voor PM en ongeveer 85% voor BMDM bereikt zonder cytotoxiciteit of immunogeniciteit waargenomen. We beschrijven in detail de generatie van mRNA voor transfectie van DNA-constructies zoals plasmiden en de transfectie-procedure.

We hebben dit protocol met succes gebruikt om mRNA-codering te genereren voor door de vlag gelabelde NEMO-en IKKβ-varianten voor transfectie van primaire macrofagen16. De plasmiden codering voor Flag-Tagged wild-type (Nemo WT) en C54/347a Mutant Nemo (NemoC54/374a) (Zie de tabel met materialen) bevatten al een T7 promotor in de juiste richting (Figuur 1a). Zo moesten we alleen de...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Macrofagen, vooral primaire macrofagen, zijn uitdagend om te transfect als ze gespecialiseerd zijn in het opsporen van moleculen van niet-eigen oorsprong. We beschrijven een protocol dat een zeer efficiënte transfectie van primaire macrofagen mogelijk maakt met mRNA gegenereerd uit DNA-templates zoals plasmiden.

Zeer efficiënte transfectie van primaire macrofagen met in vitro getranscribeerd mRNA

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

elektronisch chiming Omdat macrofagen gespecialiseerd zijn in het detecteren van moleculen van niet-zelfoorsprong, zijn ze bijzonder moeilijk te transfecteren. We beschrijven een protocol dat een zeer efficiënte transfectie van primaire macrofagen mogelijk maakt met mRNA gegenereerd uit DNA-sjablonen zoals plasmiden. Het belangrijkste voordeel van onze methode is dat hoge transfectiepercentages worden bereikt bij afwezigheid van detecteerbare cytotoxiciteit of immunogeniciteit.Het aantonen van de procedure zal Marc Herb een postdoc uit mijn laboratorium. Begin met het ontdooien van alle onderdelen van de RNA transcriptie kit. Vortex de reagentia voor vijf seconden en draai ze naar beneden voor twee seconden op 2,000 keer g, dan houd ze op ijs tot gebruik.Bereid de in vitro RNA transcriptiereactie voor in een 0,5-microliter microcentrifugebuis volgens de aanwijzingen van het manuscript. Draai de buis en draai hem naar beneden. Dan incubeer het op 37 graden Celsius gedurende 30 minuten tijdens het mengen bij 400 rpm op een thermische mixer.Voeg na de incubatie twee microliters van DNase I direct toe aan de reactiemix. Vortex en draai de buis naar beneden, en incubeer het in de thermische mixer voor nog eens 15 minuten. Reserveer een twee-microliter aliquot van het met Dnase behandelde product voor de controlegel en bewaar het bij min 80 graden Celsius.Voeg voor polyA-tailing vijf microliters 10X polyA polymerasereactiebuffer en vijf microliters polyA polymerase toe aan de met Dnase behandelde reactie. Vortex en draai de mix. Vervolgens incubeer het in de thermische mixer gedurende 30 minuten.Wanneer de reactie is voltooid, neem een twee-microliter aliquot voor de controle gel en bewaar het op min 80 graden Celsius. Voeg 5-prime dephosphorylation reagentia direct toe aan het polyA tailed product volgens de handschriftrichtingen. Vortex en spin in de buis, en incubeer het in de thermische mixer voor nog eens 30 minuten.Volg de dephosfosfosfoïnatiereactie met een incubatie van twee minuten bij 80 graden Celsius om de Antarctische fosforfosfatase te verwarmen. Zuiver vervolgens de in vitro getranscribeerd mRNA met behulp van een speciale RNA zuiveringskit. Meet de concentratie en zuiverheid van het eluted mRNA met een microvolume spectrofotometer.Voer een deaturturing agarose gel met de eerder verzamelde aliquots om de aanwezigheid van een enkel product te controleren, juiste transcript lengte, en polyA tailing. Bereid u voor op transfectie door het vooraf berekende volume van mRNA-transfectiebuffer minus de volumes van mRNA-transfectiereageage en het mRNA toe te voegen aan een reactiebuis. Ontdooi de mRNA-bouillon en meng het voorzichtig door de buis om te draaien.Voeg vervolgens het vooraf berekende volume van mRNA toe aan de reactiebuis. Vortex en spin vaststelling van de reactie mix en de mRNA transfectie reagens, voeg dan de juiste volume van de mRNA transfectie reagens aan de reactie mix buis. Draai de buis en draai hem naar beneden.Dan uitbroeden bij kamertemperatuur gedurende 15 minuten. Vervang ondertussen het cultuurmedium van de macrofagen door een fris warm cultuurmedium. Zodra de incubatie van de transfectiemix is voltooid, voeg de mix toe aan de plaatputten met de macrofagen dropwise en in een cirkel van buiten naar het midden van de put.Om een uniforme verdeling van de transfectie mix voorzichtig rock de plaat in een verticale en horizontale richting. Dan incubeer de plaat op 37 graden Celsius en 5% kooldioxide voor ten minste zes uur. Na de incubatie, analyseren transfectie efficiëntie met fluorescentie microscopie, flow cytometrie of immunoblot.Het belangrijkste onderdeel van deze procedure is het waarborgen van een uniforme verdeling van de transfectiemix, zodat alle macrofagen in contact komen met dezelfde hoeveelheid mRNA. Dit protocol werd met succes gebruikt om mRNA-coderings-tagged NEMO en IKK-bèta varianten voor transfectie van primaire macrofagen te genereren. Juiste grootte en polyA tailing van mRNA werd gecontroleerd door agarose gel elektroforese.Transfectie-efficiëntie werd bevestigd door het genereren van mRNA-codering van GFP en het uitvoeren van flow cytometrieanalyse. De transfectie steeg samen met de hoeveelheid transfected mRNA, tot 50 tot 65% voor PM en 80 tot 85%voor BMDM. Zowel in PM als in BMDM steeg het expressieniveau van EGFP in transfected cells op een tijd- en dosisafhankelijke manier.Belangrijk is dat de analyse van propidium jodide-positieve of annex V-positieve macrofagen bevestigde dat de transfectieprocedure geen lytische of apoptotische celsterfte heeft veroorzaakt. Transfectie efficiëntie van mRNAs coderen FLAG-tagged Nemo of IKK-beta varianten werden geanalyseerd met immunofluorescentie microscopie. De tarieven waren ongeveer 60% voor Nemo mRNAs en 55% voor IKK-beta mRNAs.Dit protocol werd ook gebruikt om mRNA-codering Cre recombinase te genereren. Transfectie van 400.000 BMDM met 400 nanogram Cre recombinase mRNA resulteerde in bijna volledige uitputting van Nemo-eiwit na 48 uur, wat duidt op zeer efficiënte transfectie. Het ontbreken van detecteerbare hoeveelheden Interleukine 1 beta, Interleukine-6 en tumor necrose factor geeft aan dat de transfectie procedure niet pro-inflammatoire signalering activeert.Onze relatief eenvoudige methode maakt het eindelijk mogelijk om gemuteerde of gelabelde eiwitten efficiënt uit te drukken in primaire macrofagen. Dit zou de analyse van macrofaagfuncties op moleculair niveau aanzienlijk bevorderen.

Research

JoVE Journal

Immunology and Infection

A Simple and Efficient Method to Isolate Macrophages from Mixed Primary Cultures of Adult Liver Cells

Een eenvoudige en efficiënte methode om macrofagen Isolaat van Mixed primaire culturen van Adult levercellen

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although ...

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

Geoptimaliseerd protocol voor Efficiënte Transfectie van dendritische cellen zonder Cell Rijping

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

Oprichting van een<em&gt; In vitro</em&gt; Systeem om Intracellular Gedrag van Studie<em&gt; Candida glabrata</em&gt; In Human THP-1 macrofagen

A cell culture model system, if a close mimic of host environmental conditions, can serve as an inexpensive, reproducible and easily manipulatable ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Kwantitatief<em&gt; In vitro</em&gt; Assay om neutrofieladhesie Maatregel om Activated primaire humane microvasculaire endotheelcellen onder statische omstandigheden

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Zeer efficiënte transfectie van Human THP-1 macrofagen door Nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Kwantificering van cytosolische vs. vacuole<em&gt; Salmonella</em&gt; In het Primair macrofagen door Differential Permeabilisatie

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like ...

Phagosome Migration and Velocity Measured in Live Primary Human Macrophages Infected with HIV-1

Phagosome Migratie en Velocity Gemeten Live primaire humane macrofagen geïnfecteerd met HIV-1

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Analyse van lymfocyt extravasatie gebruik van een<em&gt; In Vitro</em&gt; Model van het menselijk bloed-hersenbarrière

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

Small RNA Transfectie in primaire humane Th17 cellen door Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...