Name: highly efficient transfection of primary macrophages with in vitro transcribed mrna
Uploaded: 2019-11-09T13:00:00
Description: Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

העבודה הזאת נתמכת על ידי הגרמני בפורשיגומיייסמייססביסי (SFB 670).

בידוד מקרופאג מעכברים התבצע בהתאם לחוק הגנת בעלי חיים בגרמניה בציות לוועדת האתיקה באוניברסיטת קלן.
הערה: לבצע את כל השלבים ללבוש כפפות. בצע את כל צעדי החצייה תחת מכסה זרימה למינארי כדי למנוע זיהום של התאים. לפני העבודה עם mRNA, לנקות את כל המכשירים כגון פיפטות ומכל מש?...

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

כאן אנו מציגים פרוטוקול עבור העברה יעילה מאוד של מקרופאגים הראשי בדרך כלל קשה ל-transfection עם העתק מחוץ לגופית mRNA. חשוב לציין, העברה של מקרופאגים באמצעות פרוטוקול זה לא לגרום למוות התאים או להפעיל איתות proinflammatory המציין כי לא מגיב החצייה או mRNA מנוכר מזוהים כמו לא עצמי.
איכות ה-mRNA ה...

מקרופאגים הם תאים phagocytic המתמחים זיהוי, בליעת חיידקים משפיל, תאים אפוטוטיים ופסולת הסלולר. יתר על כן, הם עוזרים לארגן את התגובות החיסונית על ידי הפרשה ציטוקינים ו נוגדנים ועל ידי הצגת אנטיגנים לתאי T ו-B תאים. המקרופאגים גם לשחק תפקידים חשובים בתהליכים אחרים רבים, כגון ריפוי הפצע, טרשת עורקים, tuמוריגנזה והשמנה.
כדי להיות מסוגל לזהות מולקולות שאינן עצמיות כגון דפוסי מולקולרי הקשורים לפתוגן (PAMPs) ומולקולות מחוץ למקום כגון דפוסי נזק מולקולריים (DAMPs), מקרופאגים מצוידים במערך גדול של קולטני זיהוי תבנית (PRR)1. למרבה הצער, זה גם עושה מקרופאגים מאתגרת במיוחד כדי transfect2 כמו מגיב החצייה3 ואת חומצות גרעין מנוכר4,5,6,7 לעתים קרובות מוכרים על ידי prrs כמו לא עצמי. מסיבה זו, העברה של מקרופאגים באמצעות שיטות כימיות או פיזיות8 בדרך כלל גורמת הפעלה מקרופאג והשפלה של חומצות גרעין מזוהמים או אפילו ב מקרופאג התאבדות דרך פירופציטוזה, צורה של מוות תאים מתוכנת lytic המופעל לאחר הכרה של pמגברים ציטופולימרים/damps כגון DNA או זרים RNA9. העברה ביולוגית של מקרופאגים באמצעות וירוסים כגון אדנוירוסים או וירוסים כמו וקטורים הוא לעתים קרובות יעיל יותר, אך הבנייה של וקטורים ויראליות כגון הוא זמן רב ודורש ברמה אבטחה טיחות 2 ציוד10,11.
כך, למרות מקרופאגים הם הנושא של מחקר אינטנסיבי, ניתוח התפקודים שלהם על הרמה המולקולרית היא הכשלה כי אחד הכלים החשובים ביותר של ביולוגיה מולקולרית, הגלגול של חומצות גרעין בנייה לביטוי אקסוגני של חלבונים, בקושי ישימה. זה לעתים קרובות כוחות חוקרים להשתמש קווי תאים מקרופאג כמו במקום מקרופאגים בתום הכוח. יישומים עבור חומצות גרעין בניית המבנה כוללים ביטוי של גירסאות חלבון מוטציה או מתויג, הבעות יתר של חלבון מסוים, חלבון מחדש ביטוי ברקע נוקאאוט בהתאמה וביטוי של חלבונים ממינים אחרים (g. , היצור recombinase או מדריך RNA ו Cas9 עבור הסתרה המוקד הגן).
כאן, אנו מתארים פרוטוקול המאפשר העברה יעילה מאוד של (בדרך כלל קשה transfection) מקרופאגים ראשוניים, כי הוא murine הצפק מקרופאגים (PM) ו מח עצם נגזר מקרופאגים (BMDM) עם mRNA שנוצר מ-DNA תבניות כגון פלמידים. חשוב לעשות זאת, בתוך מבחנה מחוץ לגופית mrna שנוצר באמצעות פרוטוקול זה מכיל את נוקלאוטידים באופן טבעי משתנה 5-מתיל-ctp ו פסאודו-utp כי להפחית את האימונוגלוגניות ולשפר את יציבות4,6,7,12,13. יתר על כן, 5 '-הקצוות של ה-mrna המועתק מחוץ לחומרים מלאכותית הם deזרחנות על ידי פוספספטאז אנטארקטיקה כדי למנוע הכרה על ידי המתקן-I מורכב14,15. זה ממזער את ההכרה החיסונית הטבועה ב-mRNA מתורבת. עם שלנו קל לבצע את הפרוטוקול, שיעורי החצייה בין 50-65% (מקרופאגים הצפק (PM)) ו 85% (BMDM) הגיעו בזמן, וחשוב, אין הרעלת ציטוזה או החיסוני נצפתה. אנו מתארים בפרוטרוט (i) כיצד מושתקים החיסוני mRNA עבור החצייה ניתן להפיק מתוך מבנים DNA כגון פלמידים ו (ii) את ההליך החוצה עצמו.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>821,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre
recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and
an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

מקרופאגים הם תאים phagocytic מתמחה בזיהוי מולקולות של מוצא לא עצמי. למטרה זו, הם מצוידים במערך גדול של קולטני זיהוי תבנית (PRRs). למרבה הצער, זה גם עושה מקרופאגים מאתגרת במיוחד כדי transfect כמו מגיב החצייה ואת חומצות גרעין מנוכר מוכרים לעתים קרובות על ידי PRRs כמו לא עצמי. לכן, העברה החוצה גורמת לעתים קרובות מקרופאג הפעלה והשפלה של חומצות גרעין מנוכר או אפילו בהתאבדות של מקרופאגים. כאן, אנו מתארים פרוטוקול המאפשר העברה יעילה מאוד של מקרופאגים ראשוניים מורטין כגון מקרופאגים הצפק (PM) ו מח עצם הנגזר מקרופאגים (BMDM) עם mRNA בתוך מבחנה מתוך תבניות DNA כגון פלמידים. עם הפרוטוקול הפשוט הזה, שיעורי ההעברה של כ 50-65% עבור PM ו-85% עבור BMDM מושגת ללא רעילות ציטוזה או החיסוני נצפתה. אנו מתארים בפרוטרוט את הדור של mRNA עבור העברה של מבנים DNA כגון פלמידים והליך החצייה.

השתמשנו בהצלחה פרוטוקול זה כדי ליצור קידוד mRNA עבור הדגל-מתויג נמו ו IKKβ משתנים עבור העברה של מקרופאגים הראשי16. קידוד הפלמידים עבור דגל-מתויג פראי (נמוWT) ו C54/347a וטציה נמו (נמוC54/374a) (לראות את הטבלה של חומרים) כבר מכיל מקדם מקדם T7 בכיוון הנכון ...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

מקרופאגים, במיוחד מקרופאגים ראשוניים, מאתגרים transfect כפי שהם מתמחים בזיהוי מולקולות של מוצא לא עצמי. אנו מתארים פרוטוקול המאפשר העברה יעילה מאוד של מקרופאגים הראשי עם mRNA שנוצר מתבניות DNA כגון פלמידים.

העברה יעילה במיוחד של מקרופאגים ראשוניים עם מחוץ לגופית

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

פעמונים אלקטרוניים מכיוון שמאקרופאגים מתמחים בזיהוי מולקולות ממקור לא עצמי, קשה במיוחד לשנות אותן. אנו מתארים פרוטוקול המאפשר החלפה יעילה ביותר של מקרופאגים ראשוניים עם mRNA שנוצר מתבניות DNA כגון פלסמידים. היתרון העיקרי של השיטה שלנו הוא כי שיעורי transfection גבוהים מושגים בהיעדר כל cytotoxicity לזיהוי או אימונוגניות.הדגמת ההליך תהיה מארק הרב פוסט-דוק מהמעבדה שלי. התחל על ידי הפשרת כל הרכיבים של ערכת שעתוק RNA. Vortex reagents במשך חמש שניות ולסובב אותם למטה במשך שתי שניות ב 2, 000 פעמים g, ואז לשמור אותם על קרח עד השימוש.הכן את תגובת שעתוק RNA במבחנה בצינור מיקרוצנטריפוגה 0.5 מיקרוליטר בהתאם לכיווני כתב היד. מערבולת הצינור ולסובב אותו. ואז להדק אותו ב 37 מעלות צלזיוס במשך 30 דקות תוך ערבוב ב 400 סל"ד על מערבל תרמי.לאחר הדגירה, להוסיף שני microliters של DNase אני ישירות לתוך תערובת התגובה. מערבולת ולסובב את הצינור למטה, ולהדרור אותו במיקסר התרמי במשך 15 דקות נוספות. שמרו על אליקוט שני מיקרוליטר של המוצר שטופל בדנ"א לג'ל הבקרה ואחסנו אותו במינוס 80 מעלות צלזיוס.לזנב פוליA, הוסיפו חמישה מיקרוליטרים של חיץ תגובת פולימראז פולימראז 10X וחמישה מיקרוליטרים של פולימראז פוליA לתגובה שטופלה בדנ"א. מערבולת ולסובב את התערובת. ואז להדרגר אותו במיקסר התרמי במשך 30 דקות.כאשר התגובה הושלמה, לקחת aliquot שני microliter עבור ג'ל הבקרה ולאחסן אותו במינוס 80 מעלות צלזיוס. הוסף 5-reagents dephosphorylation 5-פריים ישירות למוצר זנב polyA על פי הוראות כתב היד. מערבולת ולסובב במורד הצינור, ולהדרגר אותו במיקסר התרמי במשך 30 דקות נוספות.בצע את תגובת dephosphorylation עם דגירה של שתי דקות ב 80 מעלות צלזיוס על מנת לחמם לנטרל את הפוספטזה האנטארקטית. לאחר מכן לטהר את mRNA מועתק במבחנה באמצעות ערכת טיהור RNA ייעודית. למדוד את הריכוז והטוהר של mRNA אלוט עם ספקטרופוטומטר microvolume.הפעל ג'ל אגרוז denaturing עם aliquots שנאספו בעבר כדי לאמת את נוכחותו של מוצר יחיד, אורך תעתיק נכון, וזנב polyA. היכונו לתרגום רוחבי על-ידי הוספת אמצעי האחסון המחושב מראש של מאגר ההמרה mRNA פחות אמצעי האחסון של ריאגנט ה-mRNA וה-mRNA לצינור תגובה. מפשירים את מלאי ה-mRNA ומערבבים אותו בעדינות על ידי היפוך הצינור.לאחר מכן הוסיפו את הנפח המחושב מראש של mRNA לצינור התגובה. Vortex ולסובב את תערובת התגובה ואת ריאגנט transfection mRNA, ולאחר מכן להוסיף את הנפח המתאים של ריאגנט transfection mRNA לצינור תערובת התגובה. מערבולת הצינור ולסובב אותו.ואז לה הדגירה אותו בטמפרטורת החדר במשך 15 דקות. בינתיים, החלף את מדיום התרבות של המקרופאגים במדיום תרבות חם ורענן. לאחר הדגירה של תערובת transfection הושלמה, מוסיפים את התערובת לפלטות המכילות את המקרופאגים dropwise ובעיגול מבחוץ לאמצע הבאר.כדי להבטיח חלוקה אחידה של transfection לערבב בעדינות רוק הצלחת בכיוון אנכי ואופקי. ואז לה הדגירה את הצלחת ב 37 מעלות צלזיוס ו 5% פחמן דו חמצני לפחות שש שעות. לאחר הדגירה, לנתח יעילות transfection עם מיקרוסקופיה פלואורסצנטית, ציטומטריה זרימה או immunoblot.החלק החשוב ביותר של הליך זה הוא להבטיח הפצה אחידה של תערובת transfection כך שכל המקרופאגים ליצור קשר עם אותה כמות של mRNA. פרוטוקול זה שימש בהצלחה ליצירת גרסאות NEMO ו- IKK-beta עם קידוד mRNA עבור חילוף של מקרופאגים ראשיים. גודל נכון וזנב polyA של mRNA אומת על ידי אלקטרופורזה ג'ל agarose.יעילות Transfection אושרה על ידי יצירת mRNA קידוד GFP וביצוע ניתוח ציטומטריה זרימה. שיעור ההדבקה גדל יחד עם כמות mRNA מנופל, והגיע 50 עד 65% עבור PM ו 80 עד 85% עבור BMDM. הן PM והן BMDM, רמת הביטוי של EGFP בתאים מומרים גדלה בזמן ובאופן תלוי מינון.חשוב לציין, ניתוח של propidium יודיד חיובי או נספח V חיובי מקרופאגים אישרו כי הליך transfection לא לגרום למות תאים ליטיק או apoptotic. יעילות Transfection של mRNAs קידוד גרסאות נמו מתויגות בדגל או IKK-בטא נותחו עם מיקרוסקופיה immunofluorescence. התעריפים היו כ-60% עבור נמו mRNAs ו-55% עבור MRNAs של IKK-beta.פרוטוקול זה שימש גם ליצירת קידוד mRNA Cre recombinase. Transfection של 400, 000 BMDM עם 400 ננוגרם של Cre recombinase mRNA הביא דלדול כמעט מוחלט של חלבון נמו לאחר 48 שעות, המציין transfection יעיל מאוד. היעדר כמויות ניתנות לגילוי של אינטרלוקין 1 בטא, אינטרלוקין-6 וגורם נמק הגידול מצביעים על כך שהליך ההשתנות אינו מפעיל איתות פרו דלקתי.השיטה הפשוטה יחסית שלנו מאפשרת סוף סוף לבטא ביעילות חלבונים שעברו מוטציה או מתויגים במקרופאגים ראשוניים. זה יקדם באופן משמעותי את הניתוח של פונקציות מקרופאג ברמה המולקולרית.

Research

JoVE Journal

Immunology and Infection

A Simple and Efficient Method to Isolate Macrophages from Mixed Primary Cultures of Adult Liver Cells

שיטה פשוטה ויעילה על מנת לבודד המקרופאגים מתרבויות ראשי מעורבות של תאים בכבד למבוגרים

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although ...

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

פרוטוקול אופטימיזציה עבור transfection יעילה של תאים דנדריטים ללא ההבשלה Cell

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

הקמתה של<em&gt; במבחנה</em&gt; מערכת ללמוד את התנהגות תאית של<em&gt; קנדידה glabrata</em&gt; בהמקרופאגים THP-1 אדם

A cell culture model system, if a close mimic of host environmental conditions, can serve as an inexpensive, reproducible and easily manipulatable ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

כמותי<em&gt; במבחנה</em&gt; Assay כדי למדוד הידבקות נויטרופילים לתאים מופעלים עיקריים אדם אנדותל כלי הדם בתנאים סטטיים

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Transfection יעיל ביותר של של אדם המקרופאגים THP-1 על ידי nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

כימות של Cytosolic לעומת vacuolar<em&gt; סלמונלה</em&gt; ביסודי המקרופאגים על ידי דיפרנציאל permeabilization

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like ...

Phagosome Migration and Velocity Measured in Live Primary Human Macrophages Infected with HIV-1

הגירה ו מהירות Phagosome נמדד המקרופאגים אדם מן המעלה הראשונה חי עם HIV-1

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

ניתוח של לימפוציטים extravasation שימוש<em&gt; במבחנה</em&gt; דגם של מחסום אנושי דם-מוח

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

RNA הקטן Transfection ב ראשוני האדם TH17 תאים על ידי הדור הבא Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...