Name: highly efficient transfection of primary macrophages with in vitro transcribed mrna
Uploaded: 2019-11-09T13:00:00
Description: Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

이 작품은 도이치 포르충제마인샤프트(SFB 670)의 지원을 받았다.

생쥐로부터의 대식세포 분리는 쾰른 대학의 윤리위원회에 따라 독일의 동물보호법에 따라 수행되었다.
참고: 장갑을 끼고 모든 단계를 수행하십시오. 세포의 오염을 방지하기 위해 층류 후드 아래에 모든 형질 감염 단계를 수행합니다. mRNA로 작업하기 전에 파이펫과 모든 표면을 70% 에탄올 및/또는 RNAE 분해 계면활성제(재료표)로청소하십시오. 모든 ?...

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

여기에서 우리는 시험관 내 전사 mRNA를 가진 일반적으로 단단한 transfect 1 차 적인 대식세포의 고도로 능률적인 형질혈을 위한 프로토콜을 제시합니다. 중요한 것은, 이 프로토콜을 사용하는 대식세포의 형질감염은 세포 사멸을 유도하거나 형질감염 시약이나 형질감염된 mRNA가 비자기로 인식되지 않는다는 것을 나타내는 전염증성 신호를 활성화하지 않는다는 것이다.
mRNA의 ?...

대식세포는 미생물, 세포 사멸 세포 및 세포 파편을 검출, 섭취 및 분해하는 것을 전문으로 하는 식세포입니다. 또한, 그들은 사이토 카인과 케모카인을 분비하고 T 세포와 B 세포에 항원을 제시하여 면역 반응을 조율하는 데 도움이됩니다. 대식세포는 또한 상처 치유, 동맥 경화증, 종양 발생 및 비만과 같은 수많은 다른 프로세스에서 중요한 역할을 합니다.
병원체 관련 분자 패턴(PAMPs) 및 손상 관련 분자 패턴(DAMPs)과 같은 비자기 분자를 검출할 수 있도록 대식세포는 광범위한 패턴 인식 수용체(PRR)를구비한다. 불행하게도, 이것은 또한 형질감염 시약3 및 형질감염된 핵산4,5,6,7이 종종 PR에 의해 비자기로 인식됨에 따라2를 트랜스펙트하는 데 특히 도전적이다. 이러한 이유로, 화학적 또는 물리적방법을 이용한 대식세포의 형질감염8은 일반적으로 형질감염된 핵산의 활성화 및 분해를 초래하거나, 심지어 는 DNA 또는 외국 RNA9와같은 세포질 PAMPs/DAMPs의 인식 후에 촉발된 프로그램된 라이틱 세포 사멸의 한 형태인 형광핵산을 일으킨다. 벡터로서 아데노바이러스 또는 렌티바이러스와 같은 바이러스를 이용한 대식세포의 생물학적 형질감염은 종종 더 효율적이지만, 이러한 바이러스 벡터의 시공은 시간이 많이 소요되고 생체 안전수준 2장비(10,11)가필요하다.
따라서, 대식세포는 집중적인 연구의 대상이지만, 분자 생물학의 가장 중요한 도구 중 하나이기 때문에 분자 수준에서의 기능 분석은 방해를 받으며, 외인성 발현을 위한 핵산 구성물의 형질전환은 거의 적용되지 않습니다. 이것은 수시로 보나 선의의 대식세포 보다는 오히려 대식세포 같이 세포주를 사용하기 위하여 연구원을 강제로 합니다. 핵산 구성 형질전환을 위한 응용분야는 돌연변이 또는 태그가 지정된 단백질 버전의 발현, 특정 단백질의 과발현, 각각의 녹아웃 배경에서의 단백질 재발현 및 다른 종으로부터의 단백질의 발현(예를 들어)을 포함한다. , Cre 재조합 또는 표적 유전자 녹아웃을 위한 RNA 및 Cas9를 가이드한다.).
여기에서, 우리는 플라스미드와 같은 DNA 템플릿에서 생성된 mRNA를 가진 뮤린 맥이원 대식세포 (PM) 및 골수 유래 대식세포 (BMDM)의 고효율 형질감염을 허용하는 프로토콜을 기술합니다. 중요한 것은, 이 프로토콜을 사용하여 생성된 시험관내 전사 mRNA는 면역원성을 감소시키고 안정성을 향상시키는 자연발생적 변형된 뉴클레오시드 5-메틸-CTP 및 의사-UTP를 함유하고4,6,7,12,13. 더욱이, 시험관내 전사 mRNA의 5'-말단은 RIG-I 복합체14,15에의한 인식을 방지하기 위해 남극 인산염에 의해 탈인성된다. 이는 시험관내 전사 mRNA의 선천적인 면역 인식을 최소화한다. 프로토콜을 수행하기 쉬운 경우, 50-65 %(후막 대식세포 (PM)와 85 % (BMDM) 사이의 형질 감염 비율은 세포 독성 또는 면역 원성이 관찰되지 않는 동안 도달합니다. 우리는 (i) 형질감염에 대한 면역학적으로 침묵된 mRNA가 플라스미드 및 (ii) 형질전환 절차 자체와 같은 DNA 구조로부터 어떻게 생성될 수 있는지 상세히 설명한다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>821,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre
recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and
an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

대식세포는 비자기 기원의 분자를 검출하는 것을 전문화한 식세포이다. 이를 위해, 이들은 대량의 패턴 인식 수용체(PRR)를 구비한다. 불행하게도, 이것은 또한 형질전환 시약 및 형질감염된 핵산이 종종 PRR에 의해 비 자기로 인식되기 때문에 형질전환에 특히 도전하게 한다. 따라서 형질감염은 종종 형질감염된 핵산의 활성화 및 분해를 초래하거나 대식세포의 자살에도 초래한다. 여기에서, 우리는 복막 대식세포 (PM) 및 골수 파생 대식세포 (BMDM)와 같은 min의 1 차적인 대식세포의 고도로 능률적인 형질감염을 허용하는 프로토콜을 말합니다. 이 간단한 프로토콜을 사용하면 PM에 대해 약 50-65 %의 형질 감염 비율과 BMDM에 대한 약 85 %가 세포 독성 또는 면역 원성 관찰없이 달성됩니다. 우리는 플라스미드 및 형질전환 절차와 같은 DNA 구조에서 형질전환에 대한 mRNA의 생성을 상세히 기술한다.

우리는 1차 대식세포16의형질감염에 대한 FLAG 태그가 있는 NEMO 및 IKKβ 변이체에 대한 mRNA 인코딩을 생성하기 위해 이 프로토콜을 성공적으로 사용했습니다. 플래그 태그가 지정된 야생 형 (NEMOWT)및 C54/347A 돌연변이 NEMO (NEMOC54/374A)에대한 플라스미드 인코딩은 이미 올바른 방향으로 T7 전차를 포함하고 있습니다(그림1<s...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

대식세포, 특히 1차 대식세포는 비자기 기원의 분자를 검출하는 것을 전문으로 하기 때문에 트랜스펙트에 도전하고 있습니다. 우리는 플라스미드와 같은 DNA 템플릿에서 생성된 mRNA를 가진 1 차적인 대식세포의 고도로 능률적인 형질혈을 허용하는 프로토콜을 기술합니다.

체외 전사 mRNA를 가진 1 차적인 대식세포의 고효율 형질감염

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

전자 치밍 대식세포는 비 자기 기원의 분자를 검출하는 전문이기 때문에, 그들은 특히 transfect하기 어렵다. 우리는 플라스미드와 같은 DNA 템플릿에서 생성된 mRNA를 가진 1 차적인 대식세포의 고도로 효율적인 질입이 허용하는 프로토콜을 기술합니다. 우리의 방법의 주요 장점은 검출 가능한 세포 독성 또는 면역 원성이 없는 상태에서 높은 형질 전환율이 달성된다는 것입니다.절차를 시연하는 것은 마크 허브 내 실험실에서 postdoc 될 것입니다. RNA 전사 키트의 모든 구성 요소를 해동하여 시작합니다. 시약을 5초 동안 소용돌이치게 하고 2, 000배 g에서 2초 동안 회전한 다음 사용할 때까지 얼음 위에 보관하십시오.원고 방향에 따라 0.5 마이크로리터 미세 센트리후르 튜브에서 체외 RNA 전사 반응을 준비한다. 튜브를 소용돌이쳐 아래로 회전합니다. 그런 다음 열 믹서에 400 rpm에서 혼합하면서 30 분 동안 섭씨 37도에서 배양하십시오.인큐베이션 후, DNase의 마이크로리터 2개를 반응 믹스에 직접 넣습니다. 소용돌이와 튜브를 아래로 회전하고, 또 다른 15 분 동안 열 믹서에 인큐베이션. 대조겔용 DNA 처리 제품의 2마이크로리터 알리쿼트를 예약하여 섭씨 영하 80도에 보관하십시오.폴리아 테일링의 경우, 10X 폴리아 폴리머라제 반응 버퍼의 5개의 마이크로리터와 5개의 폴리아 폴리머라제 마이크로리터를 DNA-처리 반응에 첨가한다. 소용돌이와 믹스를 스핀 다운. 그런 다음 30 분 동안 열 믹서에 인큐베이션하십시오.반응이 완료되면 제어 젤에 대한 2 마이크로 리터 알리쿼트 (aliquot)를 가져 와서 섭씨 영하 80도에 보관하십시오. 원고 방향에 따라 폴리A 꼬리 제품에 직접 5-프라임 dephosphorylation 시약을 추가합니다. 소용돌이와 튜브를 스핀 다운하고, 또 다른 30 분 동안 열 믹서에 인큐베이션.남극 인산화를 가열하기 위해 섭씨 80도에서 2분 간 배양하여 탈포염 반응을 따르십시오. 그런 다음 전용 RNA 정화 키트를 사용하여 생체 외 전사 mRNA를 정화합니다. 마이크로볼륨 분광계로 용출된 mRNA의 농도와 순도를 측정합니다.이전에 수집된 알리쿼트와 함께 데니밍 아가로즈 젤을 실행하여 단일 제품의 존재, 올바른 성적증명서 길이 및 폴리A 테일링의 존재를 확인합니다. mRNA 경질 완충제의 미리 계산된 부피를 반응 튜브에 mRNA 경질 시약 및 mRNA의 부피를 뺀 것으로 전환에 대비한다. mRNA 스톡을 해동하고 튜브를 뒤집어 부드럽게 섞습니다.그런 다음 반응 튜브에 미리 계산된 mRNA 부피를 추가합니다. 소용돌이및 반응 믹스및 mRNA 경질 시약을 스핀다운한 다음, 반응 혼합 튜브에 mRNA 경전 시약의 적절한 부피를 첨가한다. 튜브를 소용돌이쳐 아래로 회전합니다.그런 다음 실온에서 15 분 동안 배양하십시오. 한편, 대식세포의 배양 배지를 신선한 따뜻한 배양 매체로 대체한다. 배설 믹스의 인큐베이션이 완료되면, 대식세포가 들어있는 플레이트 웰에 믹스를 넣고 외부에서 우물의 중간까지 원을 그리며 떨어뜨립니다.투명하게 분배되도록 하려면 플레이트를 수직 및 수평 방향으로 부드럽게 흔들어 주세요. 그런 다음 플레이트를 섭씨 37도, 이산화탄소 5%에서 최소 6시간 동안 배양합니다. 인큐베이션 후 형광 현미경 검사법, 유동 세포형 또는 면역blot로 경질 효율을 분석합니다.이 절차의 가장 중요한 부분은 모든 대식세포가 동일한 양의 mRNA와 접촉하도록 트랜스페션 믹스의 균일한 분포를 보장하는 것입니다. 이 프로토콜은 1차 대식세포의 전환에 대해 플래그 태그가 달린 NEMO 및 IKK-베타 변종을 코딩하는 mRNA 인코딩을 성공적으로 생성하는 데 사용되었습니다. mRNA의 정확한 크기와 폴리A 테일링은 아가로즈 겔 전기포광에 의해 검증되었다.GFP를 인코딩하는 mRNA를 생성하고 유동 세포측정 분석을 수행함으로써 경피 효율을 확인했습니다. 경질율은 전과된 mRNA의 양과 함께 증가하여 PM의 경우 50~65%, BMDM의 경우 80~85%에 달했습니다. PM과 BMDM 모두에서, 전과 된 세포에서 EGFP의 발현 수준은 시간 및 복용량 의존방식으로 증가하였다.중요한 것은, 프로피듐 요오드 양성 또는 부속서 V 양성 대식세포의 분석은 형질 전환 절차가 lytic 또는 세포 사멸 세포 사멸세포를 유도하지 않았다는 것을 확인했습니다. MRNA의 트랜스페션 효율은 플래그 태그가 달린 니모 또는 IKK-베타 변이체를 면역형광 현미경으로 분석되었다. 비율은 니모 mRNA에 대 한 약 60%와 IKK 베타 mRNAs에 대 한 55%.이 프로토콜은 또한 mRNA 인코딩 Cre 재조합을 생성하는 데 사용되었다. 400, 000 BMDM의 트랜스페션과 400 나노그램의 Cre 재조합 mRNA는 48시간 후에 니모 단백질을 거의 완전히 고갈시켰으며, 이는 매우 효율적인 트랜스페션을 나타냅니다. 인터류신 1 베타, 인터류신-6 및 종양 괴사 인자의 검출 가능한 양이 없는 것은 경질 절차가 프로 염증 성 신호를 활성화하지 않는다는 것을 나타낸다.우리의 비교적 간단한 방법은 마침내 1 차적인 대식세포에서 돌연변이 또는 태그가 지정된 단백질을 효율적으로 표현할 수 있게 합니다. 이것은 분자 수준에 대식세포 기능의 분석을 실질적으로 더 할 것입니다.

Research

JoVE Journal

Immunology and Infection

A Simple and Efficient Method to Isolate Macrophages from Mixed Primary Cultures of Adult Liver Cells

성인 간세포의 혼합 차 문화에서 Macrophages을 분리하는 간단하고 효율적인 방법

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although ...

연구

면역학 및 감염병학

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

세포 성숙없이 돌기 세포의 효율적인 Transfection을 위해 최적화된 프로토콜

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

Establishment of an In vitro System to Study Intracellular Behavior of Candida glabrata in Human THP-1 Macrophages

설립<em&gt; 체외</em&gt; 시스템의 세포 내 행동을 연구하는<em&gt; 칸디다 글라 브라</em&gt; 인간 THP-1 식세포에

A cell culture model system, if a close mimic of host environmental conditions, can serve as an inexpensive, reproducible and easily manipulatable ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

정량<em&gt; 체외</em정적 조건에서 활성화 된 기본 인간의 미세 혈관 내피 세포에 호중구 부착을 측정하는&gt; 분석

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Nucleofection에 의해 인간의 THP-1 대 식세포의 고효율 형질

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

공포 성 대 세포질의 정량화<em&gt; 살모넬라</em&gt; 차동 투과성으로하여 기본 대 식세포에서

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like ...

Phagosome Migration and Velocity Measured in Live Primary Human Macrophages Infected with HIV-1

HIV-1 감염 라이브 차 인간 대 식세포에서 측정 Phagosome 마이그레이션 및 속도

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

를 사용하여 림프구 혈관 외로 유출 분석<em&gt; 체외</em&gt; 인간의 혈액 - 뇌 장벽의 모델

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

차세대 일렉트로 차 인간 Th17 세포 작은 RNA 형질

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...