Name: isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing
Uploaded: 2019-12-03T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

אנו מודים למריקו ל. בנט, ליאנה ניקול בונאנו, ו Spyros דארמני על עזרתם במהלך פיתוח פרוטוקול זה. אנו מודים גם למתקן ה-FACS המשותף של סטנפורד, במיוחד מרדית ווגלז וליסה ניקולס; ין טראן, מייקל Eckart מאוניברסיטת סטנפורד וחומצות גרעין מתקן (פאן) על התמיכה הגדולה שלהם לצילום. עבודה זו ממומנת על ידי קרן JPB ו וינסנט ג'יי קוטס.

כל ההליכים מעורבים מכרסמים להתאים הנחיות אוניברסיטת סטנפורד, אשר עומדים בפני חוקי המדינה ומדיניות. כל ההליכים בעלי חיים אושרו על ידי פאנל מינהלי של אוניברסיטת סטנפורד על טיפול בעלי חיים מעבדה.
הערה: כל קומפוזיציות הפתרונות והמאגרים ניתנים ברשימת חומרים.<...

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

Microglia אינטראקציה פעילה עם סוגי תאים אחרים ב-CN, והם רגישים מאוד גירויים סביבתיים. על מנת למזער תגובות דלקתיות שינויים ביטוי הגנים שלהם במהלך תהליך הבידוד, פרוטוקול זה היה יעיל מתוך שיטה שפורסמה בעבר9, והוא מתאים כעת לבודד מיקרוגלייה מאזורים מרובים של המוח בודד בצורת העכבר במקבי...

Microglia, המייצג 5% על 10% של כל התאים העצביים, הם מקרופאגים המתמחים מפוזרים ברחבי מערכת העצבים המרכזית (CN)1. מוגן מאחורי מחסום דם-מוח, מיקרוגלייה אופייני במוח מבוגר בריא להכיל תהליכים עדינים רבים במהירות להאריך ולסגת כדי אינטראקציה עם נוירונים ותאי גליה אחרים בתוך הכימומה. Microglia יכול גם לאמץ את מורפולוגיה אמבות הקשורים בפונקציה phagocytic מוגברת במהלך שלבים התפתחותיים ספציפיים או על האתגרים החיסונית פציעה ומחלה1,2,3,4. תגליות מרגש לאחרונה הפגינו בבירור כי מיקרוגלייה הם בשום מקרה פסיבי עוברי אורח פסיבית המוח או אותות פתולוגיים, אבל לשחק תפקידים מרכזי בשליטה המוח התפתחות הומאוסטזיס, למשל, על ידי תמיכה הישרדות עצבי, גיזום הסינפסות בלתי האוליגודנדרוציטים, קידום תאים השושלת היוחסין בידול, כמו גם אנגיוגנזה1. ככל פונקציות יותר של מיקרוגלייה מובהר, ההתרגשות היא נוספת מונעת על ידי מחקרים גנטיקה של האדם, אשר הראו כי הרבה מחלות נוירוניווניות הסיכון גנים, כגון TREM2, הם בעיקר או בלעדית מבוטא על ידי מיקרוגלייה5,6,7. בהתחשב במשמעות שלהם בפיתוח וסביר מחלות נהיגה תפקידים, מאמץ עצום לאחרונה הושם לקראת ההבנה שלנו של רגולציה גנטית microglial ותפקוד בתקווה למצוא מטרות טיפוליות חדשות עבור מחלות ניווניות1,8.
רצפי RNA (RNA-seq) מאפשר אפיון לא משוחד של הביטוי הגן הספציפי לסוג תא, אשר בתורו המדריכים מדענים לחקור פונקציות גן ברשתות הסלולר צפוף7. RNA-seq נעשה בעיקר על דגימות בצובר, המוביל לגילוי של חתימת גנים microglial הומאטית המבדיל אותם מתאים עצביים אחרים החיסונית9. עם זאת, גישה כזו יכולה להתעלם הבדלים מולקולריים ופונקציונליים בקרב microglia, במיוחד אלה הנוכחים בפיתוח, או הקשורים הזדקנות ומחלות. אכן, תא בודד RNA-seq (scRNA-seq) מציע את הרגישות ואת הרזולוציה כי יש מהפכה בשדה על ידי חשיפת בעבר העריכה הטרוגניות של מיקרוגלייה במגוון של ההקשרים2,3,10. בנוסף, בשל נוכחותם של תאים אחרים החיסונית דומים בממשק מחזור המערכת, scRNA-seq מספק מידע לסייע לעיצוב של כלים חדשים כדי להפריד ולנתח פונקציונלית אלה תאים הקשורים עם מעט לפני ידע2,11.
מערך מגוון של פלטפורמות scRNA-seq הומצאו, כל אחד מתאים יישומים מסוימים12. באופן כללי, שיטות המבוססות על droplet, כגון: x גנומיקה, גבוהות יותר בתפוקה עם (עשרות) אלפי תאים ברצף בכל הפעלה, והם פחות סלקטיבית עבור הקלט שעשוי להכיל אוכלוסיות תאים מעורבות הדורשות סיווג נרחב. שיטות מבוססות לוח לספק רגישות גבוהה יותר לקרוא עומק13,14, בדרך כלל מיקוד אוכלוסיות ספציפיות ממיון התא כדי לחשוף הבדלים עדינים או תעתיקים נדירים. בהינתן אחוז קטן של תאים microglial, במיוחד אלה התפתחות-או מחלות הקשורות אוכלוסיות, בין כל סוגי התאים של ה-cn, זה לעתים קרובות רצוי לבודד מיקרוגלייה מאזור מסוים של עניין ולקבל מידע עמוק ובאורך מלא ההמרה על מנת להבין את טרוגניות.
כאן, אנו מספקים פרטים על איך לבודד מיקרוגלייה מאזורים שונים במוח העכבר גזור מאונה אחת, אשר משמשים עבור תא בודד (או בצובר) RNA-seq בעקבות הליך הכנה חצי אוטומטי המבוסס על לוח הספריה. לאחר מכן ניתן להשתמש בחצי הכדור השני לאימות היסטולוגית. באופן יעיל משיטה שפורסמה בעבר9, פרוטוקול בידוד זה שואפת למקסם את התשואה מכמות קטנה של חומרי ההתחלה, ובינתיים לשמור על פרופילי מיקרוגליאל גנטי ביטויים. אנו משתמשים מיון תא מופעל-פלואורסצנטית (facs) כדי להעשיר מיקרוגלייה (או תאים אחרים הקשורים החיסונית של עניין) לתוך 96-ובכן צלחות ממזער את הכרכים של ריאגנטים להכנת הספריה כדי להגדיל את התפוקה. אנו מדגישים את פלטפורמת scRNA-seq הרגישה הזאת, למרות שניתן ליישם אסטרטגיות אחרות המבוססות על צלחת. שיטה זו יכולה להיות מותאמת בקלות לבידוד מיקרוגלייה מרקמות אחרות, כגון פציעה או מחלה, וגיל העכבר יכול להשתנות כמעט בכל שלבי הלידה. בידוד יעיל של מיקרוגלייה אזוריים למחקרים בעלי תא יחיד הטרנססקריפט יסייע להבנה טובה יותר של התפקודים שלהם בריאות ומחלות.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5 M Betaine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B0300-5VL</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA, pH 8.0</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Hanks' Balanced Salt Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M HEPES</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>1X KAPA HIFI Hotstart Master Mix</td>
			<td>Kapa Biosciences</td>
			<td>Cat# KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td>
			<td>Corning</td>
			<td>Cat# 352235</td>
			<td></td>
		</tr>
		<tr>
			<td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &#8211; 6,000 bp)</td>
			<td>Advanced Analytical</td>
			<td>Cat# DNF-474-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A8806</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>Worthington</td>
			<td>Cat# LS002007</td>
			<td>Working solution: 12500 units/ml</td>
		</tr>
		<tr>
			<td>DTT, Molecular Grade</td>
			<td>Promega</td>
			<td>Cat# P1171</td>
			<td></td>
		</tr>
		<tr>
			<td>ERCC RNA Spike-In Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 4456740</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set A (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set B (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2002</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set C (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set D (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2004</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease (5 U/&#956;l)</td>
			<td>New England BioLabs</td>
			<td>Cat# M0262S</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Fc block</td>
			<td>BD Pharmingen</td>
			<td>Cat# 553142</td>
			<td></td>
		</tr>
		<tr>
			<td>Myelin removal beads</td>
			<td>Miltenyl Biotec</td>
			<td>Cat# 130-096-433</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT DNA Sample Prep Kit</td>
			<td>Illumina</td>
			<td>Cat# FC-131-1096</td>
			<td></td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td>
			<td>Illumina</td>
			<td>Cat# 20024907</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10X), pH 7.4</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>PCRClean DX beads</td>
			<td>Aline Biosciences</td>
			<td>Cat# C-1003-50</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# P3566</td>
			<td>Staining: 1:1000</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermal Fisher Scientific</td>
			<td>Cat# Q32851</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td>
			<td>BioLegend</td>
			<td>Cat# 101236; RRID: AB_11203704</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 25-0451-82; RRID: AB_469625</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Recombinant RNase Inhibitor</td>
			<td>Takara Bio</td>
			<td>Cat# 2313B</td>
			<td></td>
		</tr>
		<tr>
			<td>SMARTScribe Reverse Transcriptase (100 U/&#956;l)</td>
			<td>Clontech</td>
			<td>Cat# 639538</td>
			<td>Containing 5x First strand buffer</td>
		</tr>
		<tr>
			<td colspan="4">Oligonucleotides</td>
		</tr>
		<tr>
			<td>0.1 &#956;M ISPCR Oligo: 5&#39; - AAGCAGTGGTATCAA CGCAGAGT-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>Oligo-dT30VN primer: 5&#39; - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>TSO 5&#39; - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3&#39; (&#34;r&#34; is forribobases and &#34;+&#34; is for an LNA base)</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td colspan="4">Solutions</td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td>
		</tr>
		<tr>
			<td>MCS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td>
		</tr>
		<tr>
			<td>Medium A</td>
			<td></td>
			<td></td>
			<td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td>
		</tr>
		<tr>
			<td colspan="4">Plates</td>
		</tr>
		<tr>
			<td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td>
			<td>VWR</td>
			<td>89005-556</td>
			<td></td>
		</tr>
		<tr>
			<td>Hard-shell 96-well PCR plates</td>
			<td>Bio-Rad</td>
			<td>HSP9631</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Others</td>
		</tr>
		<tr>
			<td>Dumont #55 forceps</td>
			<td>Fine Science Tools</td>
			<td>11295-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Dounce homogenizer, 2 ml</td>
			<td>Wheaton</td>
			<td>357422</td>
			<td></td>
		</tr>
		<tr>
			<td>Large depletion column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Large selection column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAzap</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer (70 &#956;m)</td>
			<td>Falcon</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Equipment</td>
		</tr>
		<tr>
			<td>BD FACSAria II</td>
			<td>BD Biosciences</td>
			<td><a href="http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf" target="_blank">http://www.bdbiosciences.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fragment Analyzer</td>
			<td>Agilent</td>
			<td>5300</td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito HTS nanoliter pipetting robot</td>
			<td>TTP Labtech</td>
			<td><a href="https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/" target="_blank">https://www.ttplabtech.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

כמו מקרופאגים תושב במערכת העצבים המרכזית, מיקרוגלייה פעיל שליטה בפיתוח המוח הומאוסטזיס, ואת התפקוד שלהם יכול לנהוג במחלות אנושיות. מקדמות רבות נעשו כדי לחשוף את החתימות המולקולריות של מיקרוגלייה הומטיק, כמו גם שינויים של הביטוי הגנטי שלהם בתגובה לגירויים סביבתיים. עם הופעתו והתבגרות של תא בודד מתודולוגיות גנומית, הוא מוכר יותר ויותר כי מיקרוגלייה הטרוגניים עשוי להיות מתחת לתפקידים מגוונים הם משחקים בתנאים התפתחותיים ופתולוגיים שונים. ניתוח נוסף של טרוגניות כזה יכול להיות מושגת באמצעות בידוד יעיל של מיקרוגלייה מתוך אזור נתון של עניין, ואחריו פרופיל רגיש של תאים בודדים. כאן, אנו מספקים פרוטוקול מפורט לבידוד מהיר של מיקרוגלייה מאזורי מוח שונים בחצי הכדור המוח העכבר המבוגר. אנו גם להדגים כיצד להשתמש מיקרוגלייה אלה מיון עבור מבוסס צלחת תא יחיד ברצף RNA רצפי. אנו דנים על הסתגלות של שיטה זו לתרחישים אחרים ולספק הנחיות לשיפור המערכת כדי להתאים למחקרים בקנה מידה גדול.

פרוטוקול זה מתאר שיטה לבידוד ומיון מיקרוגלייה מאזורי מוח שונים בחצי הכדור המוח האדם המבוגר, ואחריו scRNA-seq. אנו משתמשים douncing כדי ליצור תא השעיה בודד גם כצעד הראשון להעשיר microglia. לא מספיק או over-douncing מפחית את התשואה. בנוסף, מוחות עכבר למבוגרים מכילים רמות גבוהות של מיאלין, אשר יכול גם להפחית את י...

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

אנו מספקים פרוטוקול עבור בידוד של מיקרוגלייה מאזורים בגזור שונים של המוח העכבר באמצע המחצית, ואחריו הכנה חצי אוטומטי הספריה לרצף העמוק של RNA תא בודד של טרנססקריפט באורך מלא. שיטה זו תסייע להבהיר טרוגניות תפקודית של מיקרוגלייה בריאות ומחלות.

בידוד של אזור-מיקרוגליה ספציפי מתוך חצי הכדור השני של המוח העכבר עבור רצפי RNA של תא יחיד בודד

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

שיטה זו מאפשרת לכידת מיקרוגליה בלתי משוחדת ברמת תא יחיד, אשר יכולה לעזור להבהיר את ההטרוגניות המולקולרית של microglia במוח בריא וחולה. היתרון העיקרי של טכניקה זו הוא שהיא מספקת הליך מפורט לבידוד מהיר של microglia מאזורי מוח שונים ומראה כיצד ליצור ביעילות בסיס לשחק את ספריות RA6 תא יחיד עבור רצף עמוק. כדי להתחיל בהליך זה, הכינו את כל המאגרים והפתרונות הדרושים כמתואר בפרוטוקול הטקסט וצננים אותם על הקרח.לאחר המתת דם ועירת ראשו של העכבר, השתמש במספריים קטנים כדי לחתוך את העור על הראש כדי לחשוף את הגולגולת שמתחת. לאחר מכן, חותכים דרך התפר sagittal, תפר lambdoidal, ותפר קורונאלי. השתמש מטליות כדי למשוך את שני הצדדים של עצםקודית ועצם interparietal מבלי לפגוע ברקמה בזהירות להעביר את המוח לתוך צלחת פטרי ניתוח המכיל בינוני A.באמצעות להב מקורר מראש, לחתוך את המוח דרך קו האמצע לשתי ההמיספרות.השתמש במלקחיים מספר 55 כדי להפריד את המוח הקטן מהאונה הקורטית וגזע המוח. לאחר מכן, השתמש במספר 55 מדפים כדי לנתח בזהירות את ההיפוקמפוס ואת הסטריאטום מקליפת המוח ולהעביר כל רקמה לתוך אוסף נפרד צלחת פטרי. ראשית, השתמש בסכין גילוח כדי לקצוץ כל אזור במוח לחתיכות עדין שהם פחות ממילימטר מעוקב אחד.באמצעות פיפיטר אחד מיליליטר עם קצה מנותק, להעביר את חתיכות הרקמה לתוך homogenizers Dounce מקורר מראש. הומוגניזציה של הרקמה על ידי פיתול איטי של הבוכנה פנימה ומבחוץ של homogenizer Dounce במשך שש עד 10 משיכות מלאות עד שלא קיימים גושים גלויים. לאחר מכן, להעביר את הרקמות ניתוב לתוך צינורות 50 מיליליטר דרך מסנני מיקרומטר 70.לשטוף כל homogenizer Dounce ובוכנה עם סך של שישה מיליליטר של מדיום קר A ואז להעביר את שטיפה לצינור 15 מיליליטר עבור צנטריפוגה. השעיה חד-תאית צנטריפוגית ב 400 פעמים g וב ארבע מעלות צלזיוס במשך חמש דקות עם הפסקה בחמש. שטפו עמודת דלדול אחת גדולה ושלוש עמודות בחירה גדולות במפריד מגנטי עם שלושה מיליליטר של MCS.כאשר הצנטריפוגה עבור דגימות הרקמה הושלמה, פיפטה החוצה להשליך על טבעי מבלי להפריע גלולה. תן שימוש חוזר בתאים במאגר MCS המכיל מעכבי RNase. הוסף 100 microliters של בחנורי הסרת המילין לכל צינור המכיל תאים מושעים מחדש מן קליפת המוח והקטנה ולהוסיף 50 microliters של בחנורי הסרת המילין לכל אחד הצינורות המכילים תאים מושעים מחדש מן ההיפוקמפוס וסטריאטום.דגירה הצינורות על קרח במשך 10 דקות. לאחר מכן, להוסיף MCS לצינור המכיל תאים קליפת המוח כדי להביא את עוצמת הקול שלה עד שני מיליליטר ואת הצינורות הנותרים להביא כל אחד הכרכים שלהם עד מיליליטר אחד. לאחר שהעמודות ריקות ממאגר שטיפה, טען שני מיליליטר של תאי קליפת המוח אל עמודת הדלדול הגדולה ומיליליטר אחד של מתלה התא השני על עמודות בחירה גדולות נפרדות.לאחר מכן, לשטוף את עמודי דלדול גדול אלה עם מיליליטר אחד של מאגר MCS ולשטוף כל עמודת בחירה גדולה פעמיים באמצעות מיליליטר אחד של מאגר MCS עבור כל לשטוף. סנן את התאים דרך 35 כובעי מסנני מיקרוליטר לצינורות FACS עגולים. צנטריפוגה צינורות אלה ב 400 פעמים g וב ארבע מעלות צלזיוס במשך חמש דקות כדי גלולה את התאים.לאחר מכן, לשפוך לאט את העל טבעי לטבול את קצה הצינור על נייר טישו. תן שימוש חוזר בתאים בכל צינור עם 300 מיקרוליטרים של מאגר FACS. ראשית, להוסיף חמישה microliters של קולטני FC העכבר לחסום reagent לכל צינור.דגירה על קרח במשך חמש דקות. לאחר מכן, הוסף מיקרוליטר אחד של CD45 PE בגודל שבע ומיקרוליטר אחד של CD11B BV421 לכל צינור. דגירה הצינורות על שייקר בטמפרטורת החדר במשך 10 דקות.לאחר מכן, הוסף שני מיליליטר של מאגר FACS לשטוף. צנטריפוגה ב 400 פעמים g וב ארבע מעלות צלזיוס במשך חמש דקות כדי גלולה את התאים. תן שימוש חוזר בתאים בכל צינור עם 400 מיקרוליטרים של מאגר FACS המכיל מיקרוליטר אחד של מעכבי RNase ו-0.5 מיקרוליטרים של פרופידיום יודיד.בהתאם להליך FACS הסטנדרטי, מיין microglia חי יחיד עם חריר 100 מיקרומטר לתוך לוחות PCR 96 היטב המכילים ארבעה microliters של מאגר תיזה בכל באר. בקצרה מערבולת הצלחות ולסובב אותם למטה באמצעות צנטריפוגה העליון ספסל. לאחסן את הצלחות במינוס 80 מעלות צלזיוס עד הכנת הספרייה.כאשר מוכן להמשיך, להפשיר את הצלחת על קרח. השתמש במחזור תרמי כדי לבצע שעתוק ראשון כדי ליצור cDNA ולהעצים את cDNA עם שלב עיכול exonuclease נוסף כפי שמתואר בפרוטוקול הטקסט. לאחר מכן, לטהר את cDNA על ידי הוספת 18 microliters של חרוזים מגנטיים לכל באר.דגירה הצלחת על מעמד מגנטי במשך חמש דקות. לאחר מכן, להסיר את supernatant ולשטוף את הדגימות פעמיים עם טרי עשה 80%אתנול באמצעות 80 microliters של אתנול לגם עבור כל לשטוף. כדי לבצע תג, השתמש במכונת צינור ננוליטר כדי לערבב 0.4 microliters של כל מדגם cDNA עם 1.2 microliters של Tn5 reagents תג מערכת ההכנה הספרייה בצלחת 384 גם ב 55 מעלות צלזיוס במשך 10 דקות.כדי לעצור את תגובת התגיות, הוסיפו 0.4 מיקרוליטרים של חיץ נטרול בטמפרטורת החדר למשך חמש דקות. לאחר מכן, ב 384 אינדקסים ו 1.2 microliters של PCR מעורבב לדגימות להגביר את הספריות כמתואר בפרוטוקול הטקסט. בריכת כל הספריות בודדות מאותו לוח 384 באר יחד ולהשתמש חרוזים מגנטיים כדי לטהר את הספריות מאגר הסופי.במחקר זה, microglia מבודדים קליפת המוח, המוח הקטן, ההיפוקמפוס, וסטריאטום של חצי הכדור המוח של עכבר בוגר. ההשעיה התא מוכן נבדק תחת מיקרוסקופ באמצעות כחול trypan ו hemocytometer כדי להעריך את התשואה, הכדאיות התא, ואת היעילות של הסרת המילין לפני ביצוע כתמי נוגדנים. סה"כ ספירת תאים בשלב זה צריכה להיות מעל 30, 000 עבור קליפת המוח ו מעל 5, 000 עבור הרקמות האחרות.מעל 90% מהתאים צריכים להיות בני קיימא עם פסולת מילין קטנה. מחשב FACS משמש למיון המיקרוגליה, שהם בדרך כלל CD45 נמוך ו- CD11B חיובי. בידוד מוצלח אמור לייצר מעל 80%microglia מתוך כל תאים בודדים חיים, לפחות עבור רקמת קליפת המוח.לאחר microglia בודדים נלכדים לתוך מאגר תיזה, RNA הוא שוחרר ולאחר מכן הפוך מתמלל cDNA, אשר לאחר מכן מוגברת במשך 23 מחזורים. כפלטפורמת אלקטרופורזה נימית, מנתח השברים וערכות שברי NGS רגישות במיוחד מספקים מידע מהיר ומדויק על התפלגות הגודל, כמו גם כמות מולקולות cDNA הקיימות בכל באר של צלחת 96 באר. ניתן להשתמש בדגימות המציגות מריחה בין 500 ל- 5,000 זוגות בסיסים והן נמצאות מעל סף ריכוז מסוים כדי ליצור ספריות.הדגימות רצפים לעומק של יותר ממיליון קריאות גולמיות לכל תא, אשר מרווה את כוח הזיהוי של מתודולוגיית ריצוף RNA של תא יחיד. עם קצב מיפוי של כ 60% מעל 2, 000 גנים ניתן לזהות לכל תא microglial. נתונים שפורסמו בעבר שנוצרו משיטת בידוד זו משוחזרים מניסויים עצמאיים, המדגימים את הרגישות לגילוי גנים ספציפיים למיקרוגליה על פני האוכלוסייה הרציפה.עם המידע של תמלול microglia יחיד, החוקרים יכולים לגלות את אוכלוסיות התאים הייחודיות בהקשר של העניין שלהם, וללמוד עוד יותר את הרלוונטיות התפקודית של אוכלוסיות אלה שזוהו לאחרונה.

Research

JoVE Journal

Neuroscience

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

Non-לייזר מיקרוסקופית לכידת גישה עבור Microdissection של אזורים במוח דיסקרטית עכבר עבור בידוד RNA סך סידור Downstream הדור הבא והביטוי פרופיל גנטי

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

One Mouse, Two Cultures: Isolation and Culture of Adult Neural Stem Cells from the Two Neurogenic Zones of Individual Mice

עכבר אחד, שתי תרבויות: בידוד והתרבות של תאי גזע עצביים למבוגרים משני האזורים העצביים של עכברים בודדים

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult ...

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

המוח פרוס Biotinylation:<em&gt; Ex Vivo</em&gt; גישה למדוד סחר חלבון פלזמה ממברנה אזור ספציפי בתאי עצב בוגרים

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion ...

Characterization and Isolation of Mouse Primary Microglia by Density Gradient Centrifugation

אפיון ובידוד של העכבר מיקרוגלייה העיקרי על ידי צנטריפוגה הדרגתיות צפיפות

Microglia, the resident immune cells in the brain, are the first responders to inflammation or injury in the central nervous system. Recent research has ...

Isolation and RNA Extraction of Neurons, Macrophages and Microglia from Larval Zebrafish Brains

בידוד והפקת RNA של נוירונים, מקרופאגים מיקרוגלייה מן המוח זחל דג זברה

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

בידוד של חוט השדרה למבוגרים גרעינים עבור רצפי RNA חד-גרעין בנפט מקבילים

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

רצפי RNA בתא יחיד של נוירונים Fluorescently שכותרתו העכבר באמצעות מיון ידני וכפול במבחנה תמלול עם ספירות מוחלטת רצף (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...

Assessment of Long-term Depression Induction in Adult Cerebellar Slices

הערכה של האינדוקציה לטווח ארוך של דיכאון פרוסות למבוגרים בלבד

Synaptic plasticity provides a mechanism for learning and memory. For cerebellar motor learning, long-term depression (LTD) of synaptic transmissions from ...