Name: isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing
Uploaded: 2019-12-03T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

우리는 마리코 L. 베넷, 리아나 니콜 보난노, 스파이로스 다르마니스가 이 프로토콜을 개발하는 동안 도움을 준 것에 대해 감사드립니다. 우리는 또한 스탠포드 공유 FACS 시설, 특히 메러디스 웨글라츠와 리사 니콜스 감사합니다; 스탠포드 단백질 과 핵산 시설 (PAN)에서 엔 트랜, 마이클 에카트는 촬영에 대한 큰 지원을위해. 이 작품은 JPB 재단과 빈센트 J. 코트 재단에 의해 지원됩니다.

설치류와 관련된 모든 절차는 스탠포드 대학 지침을 준수, 이는 국가 및 주 법률 및 정책을 준수. 모든 동물 절차는 실험실 동물 관리에 스탠포드 대학의 행정 패널에 의해 승인되었다.
참고: 모든 솔루션 및 버퍼 컴포지션은 재료 표에제공됩니다.
1. 세포 격리당일 준비
<ol><li>다음 시약을 준비하고 얼음에 냉각: 중간 A (50 mL), 자?...

<ol>
	<li>Li, Q., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+and+macrophages+in+brain+homeostasis+and+disease.">Microglia and macrophages in brain homeostasis and disease.</a> Nature Reviews Immunology. 18 (4), 225-242 (2018).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+Heterogeneity+of+Microglia+and+Brain+Myeloid+Cells+Revealed+by+Deep+Single-Cell+RNA+Sequencing.">Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.</a> Neuron. 101 (2), 207-223 (2019).</li><li>Keren-Shaul, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Unique+Microglia+Type+Associated+with+Restricting+Development+of+Alzheimer's+Disease.">A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease.</a> Cell. 169 (7), 1276-1290 (2017).</li><li>Bohlen, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+Requirements+for+Microglial+Survival,+Specification,+and+Function+Revealed+by+Defined-Medium+Cultures.">Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures.</a> Neuron. 94 (4), 759-773 (2017).</li><li>Guerreiro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TREM2+variants+in+Alzheimer's+disease.">TREM2 variants in Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 117-127 (2013).</li><li>Jonsson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variant+of+TREM2+associated+with+the+risk+of+Alzheimer's+disease.">Variant of TREM2 associated with the risk of Alzheimer's disease.</a> New England Journal of Medicine. 368 (2), 107-116 (2013).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Colonna, M., Butovsky, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglia+Function+in+the+Central+Nervous+System+During+Health+and+Neurodegeneration.">Microglia Function in the Central Nervous System During Health and Neurodegeneration.</a> Annual Review of Immunology. 35, 441-468 (2017).</li><li>Bennett, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+tools+for+studying+microglia+in+the+mouse+and+human+CNS.">New tools for studying microglia in the mouse and human CNS.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).</li><li>Hammond, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA+Sequencing+of+Microglia+throughout+the+Mouse+Lifespan+and+in+the+Injured+Brain+Reveals+Complex+Cell-State+Changes.">Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes.</a> Immunity. 50 (1), 253-271 (2019).</li><li>Van Hove, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+atlas+of+mouse+brain+macrophages+reveals+unique+transcriptional+identities+shaped+by+ontogeny+and+tissue+environment.">A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.</a> Nature Neuroscience. 22 (6), 1021-1035 (2019).</li><li>Chen, G., Ning, B., Shi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-Cell+RNA-Seq+Technologies+and+Related+Computational+Data+Analysis.">Single-Cell RNA-Seq Technologies and Related Computational Data Analysis.</a> Frontiers in Genetics. 10, 317 (2019).</li><li>Svensson, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+analysis+of+single-cell+RNA-sequencing+experiments.">Power analysis of single-cell RNA-sequencing experiments.</a> Nature Methods. 14 (4), 381-387 (2017).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nature Protocols. 9 (1), 171-181 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Parallel+Genome-wide+Expression+Profiling+of+Individual+Cells+Using+Nanoliter+Droplets.">Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+Analysis+of+Single-Cell+RNA+Sequencing+Methods.">Comparative Analysis of Single-Cell RNA Sequencing Methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Tabula Muris, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+of+20+mouse+organs+creates+a+Tabula+Muris.">Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris.</a> Nature. 562 (7727), 367-372 (2018).</li><li>Bohlen, C. J., Bennett, F. C., Bennett, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Microglia.">Isolation and Culture of Microglia.</a> Current Protocols in Immunology. 125 (1), 70 (2018).</li><li>Haimon, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Re-evaluating+microglia+expression+profiles+using+RiboTag+and+cell+isolation+strategies.">Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.</a> Nature Immunology. 19 (6), 636-644 (2018).</li><li>Collins, H. Y., Bohlen, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Culture+of+Rodent+Microglia+to+Promote+a+Dynamic+Ramified+Morphology+in+Serum-free+Medium.">Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium.</a> Journal of Visualized Experiments. (133), e57122 (2018).</li><li>Nikodemova, M., Watters, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+isolation+of+live+microglia+with+preserved+phenotypes+from+adult+mouse+brain.">Efficient isolation of live microglia with preserved phenotypes from adult mouse brain.</a> Journal of Neuroinflammation. 9, 147 (2012).</li><li>Swartzlander, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+cell+type-specific+isolation+and+profiling+of+mouse+brains+in+inflammation+and+Alzheimer's+disease.">Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease.</a> Journal of Clinical Investigation Insight. 3 (13), 121109 (2018).</li><li>Hennig, B. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Low-Cost+NGS+Library+Preparation+Using+a+Robust+Tn5+Purification+and+Tagmentation+Protocol.">Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol.</a> G3. 8 (1), 79-89 (2018).</li></ol>

Microglia적극적으로 CNS에 있는 그밖 세포 모형과 상호 작용하고, 환경 자극에 아주 과민합니다. 격리 과정 동안 그들의 유전자 발현에 있는 선동적인 반응 그리고 비정상적인 변경을 극소화하기 위하여, 이 프로토콜은 이전에 간행된 방법9에서능률화되었습니다, 그리고 지금 병렬로 단 하나 마우스 두뇌 반구의 다중 지구에서 microglia를 격리하기 위하여 적당합니다. 조직과 시약은...

모든 신경 세포의 5%-10%를 나타내는 Microglia는 중추 신경계 (CNS)1에걸쳐 흩어져 있는 상주 대식세포입니다. 혈액-뇌 장벽 뒤에 보호, 건강 한 성인 두뇌에 전형적인 microglia 신속 하 게 확장 하 고 천골에서 신경 세포와 상호 작용 하는 후퇴 많은 미세 한 프로세스를 포함. Microglia는 또한 특정 발달 단계 도중 증가된 식세포 기능과 관련되었던 amoeboid 형태를 채택할 수 있습니다 또는 상해와 질병에 있는 면역 도전에1,2,3,4. 최근의 흥미로운 발견은 microglia가 뇌 유래 또는 병리학 적 신호에 결코 수동적인 방관자가 아니라, 예를 들어, 신경 생존을 지원하고, 미성숙 시냅스를 가지치기, 올리고벤드로크세포 세포 분화를 촉진하고, 혈관신생1을촉진함으로써 뇌 발달 및 항상성 조절에 중추적인 역할을 한다는 것을 분명히 입증하였다. microglia의 더 많은 기능이 해명됨에 따라, 흥분은 TREM2와 같은 많은 신경 퇴행성 질환 위험 유전자가 주로 또는 독점적으로 마이크로 글리아5,6,7에의해 표현된다는 것을 보여주었던 인간 유전학 연구에 의해 더욱 촉진됩니다. 발달과 그럴듯한 질병 구동 역할에 있어서 의의를 감안할 때, 최근 신경퇴행성 질환에 대한 새로운 치료 표적을 찾기 위해 미세교세포 유전자 조절 및 기능에 대한 이해를 위해 엄청난 노력이 투입되고있다1,8.
RNA 시퀀싱 (RNA-seq)은 세포 유형 별 유전자 발현의 편견없는 특성화를 허용하며, 이는 차례로 조밀한 세포 네트워크에서 유전자 기능을 조사하는 과학자를안내합니다 7. RNA-seq는 주로 대량 샘플에서 이루어졌으며, 다른 신경 및 면역 세포와 구별되는 항상성 미세 교만 유전자 시그니처의 발견으로이어졌습니다 9. 그러나, 이러한 접근은 microglia 사이 분자와 기능적인 다름을 간과할 수 있었습니다, 특히 그 개발에 일시적으로 나타나거나, 노화와 질병과 관련되었던. 실제로, 단세포 RNA-seq(scRNA-seq)는 다양한 문맥2,3,10에서이전에 과소평가된 마이크로글리아의 이질성을 밝혀냄으로써 분야에 혁명을 일으켰던 감도 및 분해능을 제공한다. 또한, CNS 순환 계면에서 다른 유사한 면역 세포의 존재로 인해, scRNA-seq는 이러한 관련 세포를 거의 사전 지식 없이 분리하고 기능적으로 해부하는 새로운 도구의 설계를 돕는 정보를 제공한다2,11.
scRNA-seq 플랫폼의 다양한 배열이 발명되었으며, 각각 특정 애플리케이션12에적합합니다. 일반적으로, 10x 유전체학과 같은 액적 기반 방법은 각 실행에서 시퀀싱된 수천 개의 셀을 통해 처리량이 더 높으며, 광범위한 분류를 필요로 하는 혼합 된 세포 집단을 포함할 수 있는 입력에 대해 덜 선택적입니다. 플레이트 기반 방법은 더 높은 감도및 읽기 깊이13,14를제공하며, 일반적으로 세포 분류로부터 특정 집단을 타겟팅하여 미묘한 차이 또는 희귀 한 성적 증명서를 밝힙니다. microglial 세포의 작은 백분율을 감안할 때, 특히 그 발달- 또는 질병 관련 하위 집단, 모든 CNS 세포 모형 중, 관심있는 특정 지역에서 microglia를 격리하고 그들의 이질성을 이해하기 위하여 깊고 전체 길이 전사체 정보를 얻는 것이 바람직하다.
여기서, 우리는 반자동 플레이트 기반 라이브러리 준비 절차에 따라 단일 세포 (또는 대량) RNA-seq에 사용되는 단일 반구에서 해부된 다른 마우스 뇌 영역에서 microglia를 분리하는 방법에 대한 세부 정보를 제공합니다. 그런 다음 다른 반구를 조직학적 유효성 검사에 사용할 수 있습니다. 이전에 공표된 방법9로부터간소화된 이 절연 프로토콜은 소량의 시작 물질로부터 수율을 최대화하고, 한편 내인성 미세교유전자 발현 프로파일을 유지하는 것을 목표로 한다. 우리는 형광 활성화 세포 선별 (FACS)을 사용하여 마이크로 글리아 (또는 기타 관련 면역 세포)를 96 웰 플레이트로 풍부하게하고 처리량을 높이기 위해 라이브러리 준비를위한 시약의 양을 소형화합니다. 우리는 다른 플레이트 기반 전략이 적용될 수 있더라도, 이 민감한 scRNA-seq 플래트홈을 강조합니다. 이 방법은 상해 또는 질병 초점과 같은 다른 해부 된 조직에서 microglia를 쉽게 분리하도록 쉽게 적응 할 수 있으며 마우스의 나이는 거의 모든 출생 후 단계에 따라 다를 수 있습니다. 단세포 전사체 연구를 위한 국소 microglia의 능률적인 격리는 건강과 질병에 있는 그들의 기능의 더 나은 이해를 촉진할 것입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5 M Betaine</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# B0300-5VL</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA, pH 8.0</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Hanks' Balanced Salt Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M HEPES</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>1X KAPA HIFI Hotstart Master Mix</td>
			<td>Kapa Biosciences</td>
			<td>Cat# KK2602</td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap</td>
			<td>Corning</td>
			<td>Cat# 352235</td>
			<td></td>
		</tr>
		<tr>
			<td>AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp &#8211; 6,000 bp)</td>
			<td>Advanced Analytical</td>
			<td>Cat# DNF-474-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A8806</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>Worthington</td>
			<td>Cat# LS002007</td>
			<td>Working solution: 12500 units/ml</td>
		</tr>
		<tr>
			<td>DTT, Molecular Grade</td>
			<td>Promega</td>
			<td>Cat# P1171</td>
			<td></td>
		</tr>
		<tr>
			<td>ERCC RNA Spike-In Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 4456740</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 10437-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set A (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set B (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2002</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set C (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2003</td>
			<td></td>
		</tr>
		<tr>
			<td>Illumina XT Index Kit v2 Set D (96 indexes)</td>
			<td>Illumina</td>
			<td>Cat# FC-131-2004</td>
			<td></td>
		</tr>
		<tr>
			<td>Lambda Exonuclease (5 U/&#956;l)</td>
			<td>New England BioLabs</td>
			<td>Cat# M0262S</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Fc block</td>
			<td>BD Pharmingen</td>
			<td>Cat# 553142</td>
			<td></td>
		</tr>
		<tr>
			<td>Myelin removal beads</td>
			<td>Miltenyl Biotec</td>
			<td>Cat# 130-096-433</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT DNA Sample Prep Kit</td>
			<td>Illumina</td>
			<td>Cat# FC-131-1096</td>
			<td></td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit v2.5 (150 Cycles)</td>
			<td>Illumina</td>
			<td>Cat# 20024907</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10X), pH 7.4</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>PCRClean DX beads</td>
			<td>Aline Biosciences</td>
			<td>Cat# C-1003-50</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium Iodide</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# P3566</td>
			<td>Staining: 1:1000</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS Assay Kit</td>
			<td>Thermal Fisher Scientific</td>
			<td>Cat# Q32851</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)</td>
			<td>BioLegend</td>
			<td>Cat# 101236; RRID: AB_11203704</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Cat# 25-0451-82; RRID: AB_469625</td>
			<td>Staining: 1:300</td>
		</tr>
		<tr>
			<td>Recombinant RNase Inhibitor</td>
			<td>Takara Bio</td>
			<td>Cat# 2313B</td>
			<td></td>
		</tr>
		<tr>
			<td>SMARTScribe Reverse Transcriptase (100 U/&#956;l)</td>
			<td>Clontech</td>
			<td>Cat# 639538</td>
			<td>Containing 5x First strand buffer</td>
		</tr>
		<tr>
			<td colspan="4">Oligonucleotides</td>
		</tr>
		<tr>
			<td>0.1 &#956;M ISPCR Oligo: 5&#39; - AAGCAGTGGTATCAA CGCAGAGT-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>Oligo-dT30VN primer: 5&#39; - AAGCAGTGGTATCAACGCA GAGTACT 30 VN-3&#39;</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td>TSO 5&#39; - AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-3&#39; (&#34;r&#34; is forribobases and &#34;+&#34; is for an LNA base)</td>
			<td></td>
			<td></td>
			<td>(Picelli et al., 2014)</td>
		</tr>
		<tr>
			<td colspan="4">Solutions</td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS</td>
		</tr>
		<tr>
			<td>MCS buffer</td>
			<td></td>
			<td></td>
			<td>Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS</td>
		</tr>
		<tr>
			<td>Medium A</td>
			<td></td>
			<td></td>
			<td>Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red</td>
		</tr>
		<tr>
			<td colspan="4">Plates</td>
		</tr>
		<tr>
			<td>384-well Rigi-Plate PCR Microplates, Axygen Scientific</td>
			<td>VWR</td>
			<td>89005-556</td>
			<td></td>
		</tr>
		<tr>
			<td>Hard-shell 96-well PCR plates</td>
			<td>Bio-Rad</td>
			<td>HSP9631</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Others</td>
		</tr>
		<tr>
			<td>Dumont #55 forceps</td>
			<td>Fine Science Tools</td>
			<td>11295-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Dounce homogenizer, 2 ml</td>
			<td>Wheaton</td>
			<td>357422</td>
			<td></td>
		</tr>
		<tr>
			<td>Large depletion column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Large selection column</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAzap</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9780</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer (70 &#956;m)</td>
			<td>Falcon</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Equipment</td>
		</tr>
		<tr>
			<td>BD FACSAria II</td>
			<td>BD Biosciences</td>
			<td><a href="http://www.bdbiosciences.com/documents/BD_FACSAria_II_cell_sorter_brochure.pdf" target="_blank">http://www.bdbiosciences.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fragment Analyzer</td>
			<td>Agilent</td>
			<td>5300</td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito HTS nanoliter pipetting robot</td>
			<td>TTP Labtech</td>
			<td><a href="https://www.ttplabtech.com/products/liquid-handling/mosquito-hts/" target="_blank">https://www.ttplabtech.com/</a></td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q33226</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of region-specific microglia from one adult mouse brain hemisphere for deep single-cell rna sequencing

중추 신경계에 거주 대식세포로, microglia 적극적으로 뇌 발달과 항상성을 제어, 그들의 기능 장애는 인간의 질병을 구동 할 수있다. 상당한 발전은 환경 자극에 응하여 그들의 유전자 발현의 변경뿐만 아니라 항상성 microglia의 분자 서명을 밝히기 위하여 만들어졌습니다. 단세포 게놈 방법론의 출현과 성숙으로, 이종 microglia는 다른 발달 및 병리학 조건에서 재생하는 다양한 역할을 기초로 할 수 있다는 것을 점점 인식되고 있습니다. 이러한 이질성의 추가 해부는 관심있는 특정 영역에서 microglia의 효율적인 분리를 통해 달성 될 수 있으며, 개별 세포의 민감한 프로파일링이 뒤따릅니다. 여기서, 우리는 단일 성인 마우스 뇌 반구에서 상이한 뇌 영역에서 microglia의 신속한 격리에 대한 상세한 프로토콜을 제공한다. 우리는 또한 플레이트 기반 깊은 단세포 RNA 순서를 위해 이 분류된 microglia를 사용하는 방법을 설명합니다. 이 방법의 다른 시나리오에 대한 적응성에 대해 논의하고 대규모 연구를 수용할 수 있도록 시스템을 개선하기 위한 지침을 제공합니다.

이 프로토콜은 scRNA-seq에 선행된 1명의 성인 perfused 뇌 반구에 있는 다른 두뇌 지구에서 microglia를 분리하고 분류하는 방법을 기술합니다. 우리는 단일 세포 현탁액을 만들기 위해 douncing을 사용하고 또한 microglia를 풍부하게하는 첫 번째 단계로. 불충분하거나 과도하게 사용하면 수율이 감소합니다. 또한, 성인 마우스 두뇌는 미엘린의 높은 수준을 포함, 또한 정렬 효율성과 제대로 제거 하지 않을 ?...

Watch this Scientific Journal Video about Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing at JoVE.com

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

우리는 성인 마우스 뇌 반구의 다른 해부 된 영역에서 microglia의 격리를위한 프로토콜을 제공하고, 전체 길이 전사체의 깊은 단일 세포 RNA 시퀀싱을위한 반자동 라이브러리 준비를 제공합니다. 이 방법은 건강과 질병에서 microglia의 기능적 이질성을 해명하는 데 도움이됩니다.

깊은 단세포 RNA 염기서열 분석에 대한 하나의 성인 마우스 뇌 반구에서 영역 별 Microglia의 격리

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive ...

이 방법은 1 세포 수준에서 microglia 유전자 발현의 편견없는 상각을 허용하며, 이는 건강하고 병은 뇌에서 마이크로글리아의 분자 이질성을 해명하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 다른 뇌 영역에서 미세 glia의 신속한 격리를위한 상세한 절차를 제공하고 깊은 시퀀싱을위한 단일 셀 RA6 라이브러리를 효율적으로 생성하는 방법을 보여줍니다. 이 절차를 시작하려면 텍스트 프로토콜에 설명된 대로 필요한 모든 버퍼와 솔루션을 준비하고 얼음 위에 냉각합니다.마우스를 안락사시키고 참수한 후, 작은 가위를 사용하여 머리의 피부를 잘라 두개골 아래를 노출시합니다. 그런 다음, 처탈 봉합사, 람도이달 봉합사 및 관상 봉합사를 잘라냅니다. 집게를 사용하여 조직을 손상시키지 않고 정수리 뼈와 늑간 뼈의 양쪽을 분리하고 조심스럽게 중간 A.를 포함하는 해부 페트리 접시로 뇌를 이동, 두 반구로 중간라인을 통해 뇌를 잘라.피질 엽과 뇌줄기로부터 소뇌를 분리하기 위해 숫자 55 집게를 사용합니다. 그런 다음 55번 포셉을 사용하여 피질에서 해마와 줄무늬를 조심스럽게 해부하고 각 조직을 별도의 컬렉션 페트리 접시로 옮겨 넣습니다. 첫째, 면도날을 사용하여 각 뇌 영역을 1입방 밀리미터 미만의 미세한 조각으로 자릅니다.팁이 잘린 1밀리리터 파이펫을 사용하여 조직 조각을 미리 차가운 Dounce 균질화로 옮춥니다. 눈에 보이는 덩어리가 없을 때까지 6~10개의 전체 스트로크를 위해 Dounce 균질화의 피스톤안팎을 천천히 비틀어 조직을 균질화합니다. 그런 다음 70 마이크로미터 스트레이너를 통해 해리된 조직을 50 밀리리터 튜브로 이송합니다.각 Dounce 균질화및 피스톤을 총 6밀리리터의 차가운 매체 A로 헹구고 헹구는 다음 헹구는 15 밀리리터 튜브로 원심분리를 합니다. 원심분리기 단일 셀 서스펜션은 400배, 섭씨 4도에서 5분간 5분간 휴식을 취합니다. MCS의 3밀리리터가 있는 자성 분리기에서 큰 고갈 컬럼 1개와 큰 선택 기둥 3개를 헹구는 다.조직 샘플에 대한 원심분리가 완료되면 펠릿을 방해하지 않고 피펫을 꺼내 서퍼나탄을 폐기하십시오. RNase 억제제가 포함된 MCS 버퍼에서 세포를 다시 일시 중지합니다. 피질과 소뇌에서 다시 매달린 세포를 포함하는 각 튜브에 미엘린 제거 구슬 100 마이크로리터를 추가하고 해마와 줄무늬에서 다시 중단 된 세포를 포함하는 각 튜브에 myelin 제거 구슬 50 마이크로 리터를 추가합니다.10 분 동안 얼음에 튜브를 배양. 그 후, 피질 세포를 포함하는 튜브에 MCS를 추가하여 최대 2 밀리리터의 볼륨을 가져오고 나머지 튜브에 MCS를 추가하여 각 볼륨을 최대 1 밀리리터까지 가져옵니다. 컬럼이 헹구는 버퍼가 비어 있으면 피질 셀 2밀리리터를 큰 고갈 기둥에 로드하고 서로 셀 서스펜션 1밀리리터를 별도의 큰 선택 열에 로드합니다.다음으로, MCS 버퍼 1밀리리터로 큰 고갈 컬럼을 세척하고 각 세척에 대해 MCS 버퍼 1밀리리터를 사용하여 각 대형 선택 컬럼을 두 번 세척합니다. 35 마이크로리터 스트레이너 캡을 통해 세포를 라운드 하단 FACS 튜브로 필터링합니다. 원심 분리는 400 배 g에서 4섭씨에서 5 분 동안 세포에 펠릿.그런 다음, 천천히 상체를 부어 티슈 페이퍼에 튜브의 가장자리를 두드려. FACS 버퍼의 300 마이크로 리터로 각 튜브의 세포를 다시 중단합니다. 먼저, 마우스 FC 수용체의 5마이크로리터를 각 튜브에 시약을 차단합니다.얼음에 5분간 배양하세요. 그런 다음 각 튜브에 CD45 PE 크기 7과 1 마이크로리터를 추가합니다. 실온에서 셰이커에 튜브를 10분 동안 배양합니다.그 후 FACS 버퍼 2밀리리터를 추가하여 세척합니다. 원심분리기는 400배, 섭씨 4도에서 5분간 세포를 펠릿합니다. RNase 억제제의 1개의 마이크로리터 및 propidium 요오드의 0.5 마이크로리터를 포함하는 FACS 버퍼의 400 마이크로리터로 각 관내 세포를 재중단합니다.표준 FACS 절차에 따라 100 마이크로미터 노즐로 단일 라이브 마이크로글리아를 각 우물에 4개의 소리터가 포함된 96웰 PCR 플레이트로 정렬합니다. 잠시 접시를 소용돌이쳐 벤치 상단 원심분리기를 사용하여 아래로 회전합니다. 도서관 준비 전까지 접시를 영하 80도까지 보관하십시오.진행 할 준비가되면, 얼음에 접시를 해동. 열 사이클러를 사용하여 첫 번째 전사를 수행하여 cDNA를 생성하고 텍스트 프로토콜에 설명된 바와 같이 추가 엑소뉴클레아제 소화 단계로 cDNA를 증폭시한다. 그 후, 각 우물에 자기 구슬 18 마이크로리터를 추가하여 cDNA를 정화합니다.5 분 동안 자기 스탠드에 접시를 배양. 그런 다음, 상체를 제거하고 각 세척에 대해 우물 당 80 마이크로 리터를 사용하여 갓 만든 80 %에탄올로 샘플을 두 번 세척하십시오. 태그를 수행하려면 나노리터 파이펫팅 기계를 사용하여 각 cDNA 샘플의 0.4 마이크로리터와 도서관 준비 키트의 1.2 마이크로리터를 10분 동안 섭씨 55도의 384웰 플레이트에 혼합합니다.태그 링 반응을 중지하려면 실온에서 0.4 마이크로리터의 중화 버퍼를 5분 동안 추가합니다. 다음으로, 384개의 인덱스와 1.2 마이크로리터의 PCR에서 샘플에 혼합하고 텍스트 프로토콜에 설명된 대로 라이브러리를 증폭시합니다. 동일한 384웰 플레이트에서 개별 라이브러리를 모두 풀로 묶고 마그네틱 구슬을 사용하여 최종 풀로 된 라이브러리를 정화합니다.이 연구에서, microglia는 피질에서 격리, 소뇌, 해 마, 그리고 성인 마우스의 뇌 반구의 줄무늬. 준비된 세포 현탁액은 항체 염색을 수행하기 전에 미엘린 제거의 수율, 세포 생존력 및 효능을 추정하기 위해 트라이판 블루 및 혈혈계를 사용하여 현미경으로 검사된다. 이 시점에서 총 세포 수는 피질에 대해 30, 000 이상이어야하며 다른 조직에 대해 5, 000 이상이어야합니다.세포의 90% 이상이 작은 미엘린 파편으로 실행 가능해야 합니다. FACS 기계는 일반적으로 CD45 낮음 및 CD11B 양수인 마이크로글리아를 정렬하는 데 사용됩니다. 성공적인 격리는 적어도 피질 조직을 위해 모든 살아있는 단세포에서 80% microglia 이상 생성되어야 합니다.개별 microglia가 용해 완충제로 포착되면 RNA가 방출되고 그 후 cDNA로 전사되어 23 사이클동안 증폭됩니다. 모세관 전기 포근 플랫폼으로서, 단편 분석기 및 고민감 NGS 단편 키트는 크기 분포에 대한 신속하고 정확한 정보뿐만 아니라 96웰 플레이트의 각 웰에 존재하는 cDNA 분자의 양을 제공합니다. 500에서 5, 000 베이스 쌍 사이의 얼룩을 나타내는 샘플은 특정 농도 임계값 이상이며 라이브러리를 만드는 데 사용할 수 있습니다.샘플은 세포당 100만 개 이상의 원시 판독 깊이로 시퀀싱되어 단일 세포 RNA 시퀀싱 방법론의 검출 력을 포화시합니다. 2보다 약 60%의 매핑 비율로, 000개의 유전자는 microglial 세포 당 검출될 수 있습니다. 이 격리 방법에서 생성된 이전에 발표된 데이터는 독립적인 실험에서 재현되어 서열 된 인구에 걸쳐 microglia 특정 유전자를 검출하는 민감도를 입증합니다.단일 microglia 전사의 정보로, 연구원은 그들의 관심사의 맥락에서 유일한 세포 인구를 발견하고, 추가이 새로 확인된 인구의 기능관련성을 연구할 수 있습니다.

Research

JoVE Journal

Neuroscience

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

총 RNA의 분리 및 다운 스트림 차세대 시퀀싱 및 유전자 발현 프로 파일링에 대한 개별 마우스 뇌 영역의 Microdissection 아닌 레이저 캡처 현미경 접근법

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

연구

신경과학

One Mouse, Two Cultures: Isolation and Culture of Adult Neural Stem Cells from the Two Neurogenic Zones of Individual Mice

하나의 마우스, 두 문화 : 분리 및 성인 신경의 문화가 개인 마우스의 두 신경 인성 영역에서 줄기 세포

The neurosphere assay and the adherent monolayer culture system are valuable tools to determine the potential (proliferation or differentiation) of adult ...

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

Brain Slice Biotinylation: An Ex Vivo Approach to Measure Region-specific Plasma Membrane Protein Trafficking in Adult Neurons

뇌 슬라이스 바이오 티 닐화 :<em&gt; 전의 VIVO</em성인 뉴런에서 지역 고유의 플라즈마 막 단백질 인신 매매를 측정하는&gt; 접근

Regulated endocytic trafficking is the central mechanism facilitating a variety of neuromodulatory events, by dynamically controlling receptor, ion ...

Characterization and Isolation of Mouse Primary Microglia by Density Gradient Centrifugation

특성화 및 조밀도 기온 변화도 원심 분리 하 여 마우스 기본 Microglia의 절연

Microglia, the resident immune cells in the brain, are the first responders to inflammation or injury in the central nervous system. Recent research has ...

Isolation and RNA Extraction of Neurons, Macrophages and Microglia from Larval Zebrafish Brains

절연 및 애벌레 Zebrafish 두뇌에서 신경 세포, 대 식 세포 및 Microglia RNA 추출

To gain a detailed understanding of the role of different CNS cells during development or the establishment and progression of brain pathologies, it is ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

대규모 병렬 단일 핵 RNA 시퀀싱에 대 한 성인 척수 핵의 절연

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

단일 셀 RNA 시퀀싱 시퀀싱 (디바-Seq) 절대 수 수동 정렬 및 두 배 전사 생체 외에서 를 사용 하 여 붙일 레이블이 마우스 뉴런의

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...

Assessment of Long-term Depression Induction in Adult Cerebellar Slices

성인 소뇌 슬라이스에 장기 우울증 유도의 평가

Synaptic plasticity provides a mechanism for learning and memory. For cerebellar motor learning, long-term depression (LTD) of synaptic transmissions from ...