Name: constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43
Uploaded: 2020-09-11T14:00:00
Description: Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Vi vil gerne takke Meningitis Trust og MRC for at yde finansiering til dette arbejde.

1. Frembringelse af muterende amplikon ved SOE-PCR23 og amplifikation af spectinomycinkassetten
<ol><li>Start med at udføre PCR til amplifikation af homologiarmene (henholdsvis lag 5' (488 bp) og ply3' (715 bp)) i de flankerende områder af laggenet fra stamme 519/43. Brug primere plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTTTTTCTGGATCC GCGTCCTTTTTTTTTTTTC) og plyRv2_NotI...

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Streptococcus pneumoniae, navnlig serotype 1, er fortsat en global trussel, der forårsager invasiv pneumokoksygdom og meningitis. På trods af introduktionen af forskellige vacciner, der skal beskytte mod serotype 1, i Afrika, er denne serotype stadig i stand til at forårsage udbrud, der fører til høj sygelighed og dødelighed13. Evnen til genetisk manipulation af denne serotype er af afgørende betydning på grund af dens kliniske relevans. Metoden beskrevet i denne undersøgelse til...

Streptococcus pneumoniae (S. pneumoniae, pneumokokker) er en af hovedårsagerne til sygelighed og dødelighed globalt. Indtil for nylig er der opdaget tæt på 100 serotyper af S. pneumoniae 1,2,3,4,5,6,7. Årligt, invasiv pneumokoksygdom (IPD) hævder omkring 700.000 dødsfald, af børn yngre end 5 år8. S. pneumoniae er hovedårsagen til bakteriel lungebetændelse, otitis media, meningitis og septikæmi på verdensplan9.
I det afrikanske meningitisbælte er serotype 1 ansvarlig for meningitisudbrud, hvor sekvenstype (ST) ST217, en ekstremt virulent sekvenstype, er dominerende 10,11,12,13,14,15. Dens betydning i meningitis patologi er blevet sammenlignet med Neisseria meningitidis i det afrikanske meningitis bælte16. Serotype 1 er ofte hovedårsagen til IPS; Det findes dog meget sjældent i vogn. Faktisk er denne serotype i Gambia ansvarlig for 20% af al invasiv sygdom, men den blev kun fundet hos 0,5% af raske bærere14,17,18,19. Genetisk udveksling og rekombination i kompetente pneumokokker forekommer generelt i transport snarere end i invasiv sygdom20. Desuden har serotype 1 vist sig at have en af de korteste transportrater, der er beskrevet blandt pneumokokker (kun 9 dage). Derfor er det blevet foreslået, at denne serotype kan have en meget lavere rekombinationshastighed end andre21.
Dybtgående undersøgelser er nødvendige for at forstå årsagen til serotype 1-stammernes lave transporthastighed og dens betydning for invasiv sygdom i Afrika syd for Sahara.
Her rapporterer vi en protokol, der tillader genomdækkende mutagenese af en bestemt serotype 1-stamme, 519/43. Denne stamme kan let erhverve og rekombinere nyt DNA i sit genom. Denne metode er endnu ikke sammentømret, men den er meget effektiv, når den udføres i 519/43 baggrund (andre mål er muteret, manuskripter under udarbejdelse). Ved blot at bruge 519/43-stammen og udnytte dens naturlige kompetence samt erstatte den måde, hvorpå det eksogene DNA tilvejebringes, var vi i stand til at mutere pneumolysingenet (lag) i denne serotype 1-stamme. Denne metode repræsenterer en forbedring i forhold til den, der præsenteres af Harvey et al.22 , da den udføres i et trin uden behov for at føre DNA'et gennem en anden serotype. Ikke desto mindre, og på grund af variabilitet mellem stammer, er ingen metode blevet standardiseret til alle stammer. Evnen til at mutere specifikke gener og observere dens virkninger vil muliggøre en dyb forståelse af serotype 1 S. pneumoniae stammer, og det vil give svar på disse stammers rolle i meningitis i Afrika syd for Sahara.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 er fortsat et enormt problem i lav- og mellemindkomstlande, især i Afrika syd for Sahara. På trods af dens betydning er undersøgelser i denne serotype blevet hindret af manglen på genetiske værktøjer til at ændre den. I dette studie beskriver vi en metode til genetisk modifikation af et klinisk serotype 1-isolat (stamme 519/43). Interessant nok blev dette opnået ved at udnytte Pneumokokkers evne til naturligt at erhverve DNA. I modsætning til de fleste pneumokokker var brugen af lineært DNA imidlertid ikke vellykket; For at mutere denne vigtige stamme måtte der anvendes et selvmordsplasmid. Denne metode har givet mulighed for en dybere forståelse af denne undvigende serotype, både hvad angår dens biologi og patogenicitet. For at validere metoden blev det store kendte pneumokoktoksin, pneumolysin, muteret, fordi det har en velkendt og let at følge fænotype. Vi viste, at mutanten som forventet mistede sin evne til at lyse røde blodlegemer. Ved at være i stand til at mutere et vigtigt gen i den interessante serotype var vi i stand til at observere forskellige fænotyper for tab af funktionsmutanter ved intraperitoneale og intranasale infektioner end dem, der blev observeret for andre serotyper. Sammenfattende viser denne undersøgelse, at stamme 519/43 (serotype 1) kan være genetisk modificeret.

Protokollen beskrevet her starter med at bruge PCR til at forstærke venstre og højre homologiarme, samtidig med at 191 bp slettes fra det midterste område af laggenet . Under udførelsen af PCR introduceres et BamHI-sted ved 3' i venstre homologiarm og i 5' ende af højre homologiarm (figur 1A). Dette efterfølges af PCR-SOE, hvor venstre og højre homologiarme smeltes sammen til en amplicon (figur 1B). Denne SOE-PCR-amplikon klones derefter til pGEM...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Her beskriver vi en S. pneumoniae serotype 1 stamme 519/43, der kan genmodificeres ved at bruge dens evne til naturligt at erhverve DNA og et selvmordsplasmid. Som bevis for princippet blev der lavet en isogen mutant i pneumolysin (lag) genet.

Konstruktion af mutanter i Serotype 1 Streptococcus pneumoniae stamme 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Karakterisering af inflammatoriske reaktioner under intranasal kolonisering med Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Overvåge ændringer i Membrane polaritet, Membrane Integritet, og intracellulære Ion Koncentrationerne i<em&gt; Streptococcus pneumoniae</em&gt; Brug fluorescerende farvestoffer

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Kapsulær Serotypning af<em&gt; Streptococcus pneumoniae</em&gt; Brug af Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Kapsulær Serotypning af<em&gt; Streptococcus pneumoniae</em&gt; Af latexagglutinering

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

A Murine Model of Group B Streptococcus Vaginal Colonization

En murin model af gruppe B<em&gt; Streptococcus</em&gt; Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

En Robust Lungebetændelse Model i immunkompetente Gnavere at evaluere Antibakteriel Effekt mod<i&gt; S. pneumoniae</i&gt;,<i&gt; H. influenzae</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; eller<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replikering af bestilt, Nonredundant bibliotek af Pseudomonas aeruginosa stamme PA14 Transposon indsættelse mutanter

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...