Name: constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43
Uploaded: 2020-09-11T14:00:00
Description: Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Wir danken dem Meningitis Trust und dem MRC für die Finanzierung dieser Arbeit.

1. Erzeugung des mutierenden Amplikons mittels SOE-PCR23 und Amplifikation der Spectinomycin-Kassette
<ol><li>Beginnen Sie mit der Durchführung einer PCR zur Amplifikation der Homologiearme (Ply 5' (488 bp) bzw. Ply3' (715 bp)) der flankierenden Regionen des Ply-Gens aus dem Stamm 519/43. Verwenden Sie die Primer plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGC GGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTCTGGATCC GCGTC...

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Streptococcus pneumoniae, insbesondere Serotyp 1, ist nach wie vor eine globale Bedrohung, die invasive Pneumokokkenerkrankungen und Meningitis verursacht. Trotz der Einführung verschiedener Impfstoffe, die vor Serotyp 1 schützen sollten, ist dieser Serotyp in Afrika immer noch in der Lage, Ausbrüche zu verursachen, die zu einer hohen Morbidität und Mortalität führen13. Die Fähigkeit, diesen Serotyp genetisch zu manipulieren, ist aufgrund seiner klinischen Relevanz von entscheidend...

Streptococcus pneumoniae (S. pneumoniae, der Pneumokokkus) ist weltweit eine der Hauptursachen für Morbidität und Mortalität. Bis vor kurzem wurden fast 100 Serotypen von S. pneumoniae entdeckt 1,2,3,4,5,6,7. Jährlich sterben rund 700.000 Kinder unter 5 Jahrenan der invasiven Pneumokokkenerkrankung (IPD) 8. S. pneumoniae ist weltweit die Hauptursache für bakterielle Pneumonie, Mittelohrentzündung, Meningitis und Septikämie9.
Im afrikanischen Meningitis-Gürtel ist Serotyp 1 für Meningitis-Ausbrüche verantwortlich, bei denen der Sequenztyp (ST) ST217, ein extrem virulenter Sequenztyp, 10,11,12,13,14,15 dominant ist. Seine Bedeutung in der Meningitis-Pathologie wurde mit der von Neisseria meningitidis im afrikanischen Meningitis-Gürtelverglichen 16. Serotyp 1 ist oft die Hauptursache für IPD; Es ist jedoch sehr selten in der Kutsche zu finden. Tatsächlich ist dieser Serotyp in Gambia für 20% aller invasiven Erkrankungen verantwortlich, wurde jedoch nur bei 0,5% der gesunden Träger gefunden14,17,18,19. Genetischer Austausch und Rekombination in kompetenten Pneumokokken erfolgt im Allgemeinen eher bei der Beförderung als bei invasiven Erkrankungen20. Darüber hinaus wurde gezeigt, dass Serotyp 1 eine der kürzesten Trageraten aufweist, die bei Pneumokokken beschrieben wurden (nur 9 Tage). Daher wurde vorgeschlagen, dass dieser Serotyp eine viel niedrigere Rekombinationsrate aufweisen könnte als andere21.
Eingehende Studien sind notwendig, um den Grund für die niedrige Beförderungsrate von Serotyp-1-Stämmen und ihre Bedeutung für invasive Erkrankungen in Afrika südlich der Sahara zu verstehen.
Hier berichten wir über ein Protokoll, das eine genomweite Mutagenese eines bestimmten Serotyp-1-Stammes ermöglicht, 519/43. Dieser Stamm kann leicht neue DNA erwerben und in sein Genom rekombinieren. Diese Methode ist noch nicht übergreifend, aber sie ist sehr effizient, wenn sie im 519/43-Hintergrund durchgeführt wird (andere Ziele wurden mutiert, Manuskripte sind in Vorbereitung). Durch die einfache Verwendung des 519/43-Stammes und die Nutzung seiner natürlichen Kompetenz sowie die Substitution der Art und Weise, wie die exogene DNA bereitgestellt wird, konnten wir das Pneumolysin-Gen (ply) in diesem Serotyp-1-Stamm mutieren. Diese Methode stellt eine Verbesserung gegenüber der von Harvey et al.22 vorgestellten Methode dar, da sie in einem Schritt durchgeführt wird, ohne dass die DNA durch einen anderen Serotyp geleitet werden muss. Nichtsdestotrotz und aufgrund der Variabilität zwischen den Stämmen wurde keine Methode für alle Stämme standardisiert. Die Fähigkeit, bestimmte Gene zu mutieren und ihre Auswirkungen zu beobachten, wird ein tiefgreifendes Verständnis der Serotyp 1 S. pneumoniae-Stämme ermöglichen und Antworten auf die Rolle dieser Stämme bei Meningitis in Afrika südlich der Sahara liefern.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae Serotyp 1 ist nach wie vor ein großes Problem in Ländern mit niedrigem und mittlerem Einkommen, insbesondere in Afrika südlich der Sahara. Trotz seiner Bedeutung wurden Studien zu diesem Serotyp durch den Mangel an genetischen Werkzeugen behindert, um ihn zu modifizieren. In dieser Studie beschreiben wir eine Methode zur genetischen Modifikation eines klinischen Serotyp-1-Isolats (Stamm 519/43). Interessanterweise wurde dies erreicht, indem die Fähigkeit der Pneumokokken ausgenutzt wurde, DNA auf natürliche Weise zu erwerben. Im Gegensatz zu den meisten Pneumokokken war die Verwendung von linearer DNA jedoch nicht erfolgreich; Um diesen wichtigen Stamm zu mutieren, musste ein Selbstmord-Plasmid verwendet werden. Diese Methodik hat die Mittel für ein tieferes Verständnis dieses schwer fassbaren Serotyps geschaffen, sowohl in Bezug auf seine Biologie als auch auf seine Pathogenität. Um die Methode zu validieren, wurde das wichtigste bekannte Pneumokokken-Toxin, Pneumolysin, mutiert, da es einen bekannten und leicht zu verfolgenden Phänotyp aufweist. Wir zeigten, dass die Mutante erwartungsgemäß ihre Fähigkeit verlor, rote Blutkörperchen zu lysieren. Indem wir in der Lage waren, ein wichtiges Gen im interessierenden Serotyp zu mutieren, konnten wir verschiedene Phänotypen für Funktionsverlustmutanten bei intraperitonealen und intranasalen Infektionen beobachten, die für andere Serotypen beobachtet wurden. Zusammenfassend belegt diese Studie, dass der Stamm 519/43 (Serotyp 1) genetisch verändert werden kann.

Das hier beschriebene Protokoll beginnt mit der Verwendung von PCR zur Amplifikation des linken und rechten Homologiearms, während gleichzeitig 191 bp aus der mittleren Region des Lagengens gelöscht werden. Während der Durchführung der PCR wird eine BamHI-Stelle am 3'-Ende des linken Homologiearms und am 5'-Ende des rechten Homologiearms eingeführt (Abbildung 1A). Darauf folgt die PCR-SOE, bei der linke und rechte Homologiearme zu einem Amplikon fusioniert werden (<strong class...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Hier beschreiben wir einen S. pneumoniae Serotyp 1 Stamm 519/43, der genetisch verändert werden kann, indem er seine Fähigkeit nutzt, DNA und ein Suizid-Plasmid auf natürliche Weise zu erwerben. Als Prinzipienbeweis wurde eine isogene Mutante im Pneumolysin-Gen (Ply) hergestellt.

Konstruktion von Mutanten im Serotyp 1 Streptococcus pneumoniae Stamm 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Mit Bioluminescent Imaging, um Synergie von Untersuchen Streptococcus pneumoniae Und Influenza A Virus in Infant Mäuse

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Forschung

Immunologie und Infektion

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Genotypische Inference von HIV-1 Tropismus mit Populations-basierte Sequenzierung von V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Live Cell Imaging von Bacillus subtilis Und Streptococcus pneumoniae Verwendung von Automated Zeitraffer-Mikroskopie

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Charakterisierung von Entzündungsreaktionen während der intranasalen Kolonisation mit Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Überwachen von Änderungen in Membran-Polarity, Membrane Integrity und intrazelluläre Ionenkonzentrationen in<em&gt; Streptococcus pneumoniae</em&gt; Verwenden von Fluoreszenzfarbstoffen

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Kapsel Serotypisierung von<em&gt; Streptococcus pneumoniae</em&gt; Verwenden der Quellung Reaktion

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Kapsel Serotypisierung<em&gt; Streptococcus pneumoniae</em&gt; Durch Latexagglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

A Murine Model of Group B Streptococcus Vaginal Colonization

Ein Mausmodell der Gruppe B<em&gt; Streptococcus</em&gt; Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A Robust Pneumonia Modell in intaktem Immunsystem Nagetiere zur Bewertung antibakterieller Wirksamkeit gegen<i&gt; S. pneumoniae</i&gt;,<i&gt; H. influenzae</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; oder<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replikation von bestellt, Nonredundant Bibliothek von Pseudomonas Aeruginosa Stamm PA14 Transposon Insertion Mutanten

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...