Name: constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43
Uploaded: 2020-09-11T14:00:00
Description: Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

ברצוננו להודות לקרן דלקת קרום המוח ול-MRC על מתן המימון לעבודה זו.

1. יצירת אמפליקון מוטציה על ידי SOE-PCR23 והגברה של קלטת ספקטינומיצין
<ol><li>התחל בביצוע PCR להגברה של זרועות ההומולוגיה (ply 5' (488 bp) ו- ply3' (715 bp) בהתאמה) של אזורי האיגוף של גן הרובד מזן 519/43. השתמש פריימרים plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGCCGGATCC AGAACCAAACTTGACCTTGA), ply3'F1_BamHI...

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

דלקת ריאות סטרפטוקוקוס, במיוחד סרוטיפ 1, ממשיכה להוות איום עולמי הגורם למחלת פנאומוקוק פולשנית ולדלקת קרום המוח. למרות הכנסת חיסונים שונים שאמורים להגן מפני סרוטיפ 1, באפריקה סרוטיפ זה עדיין מסוגל לגרום להתפרצויות שיובילו לתחלואה ותמותה גבוהה13. היכולת לבצע מניפולציה גנט...

סטרפטוקוקוס דלקת ריאות (S. pneumoniae, הפנאומוקוקוס) הוא אחד הגורמים העיקריים לתחלואה ולתמותה ברחבי העולם. עד לאחרונה התגלו קרוב ל-100 סרוטיפים של S. pneumoniae 1,2,3,4,5,6,7. מדי שנה, מחלת פנאומוקוק פולשנית (IPD) טוענת לכ -700,000 מקרי מוות, של ילדים מתחת לגיל5 שנים 8. S. pneumoniae הוא הגורם העיקרי לדלקת ריאות חיידקית, דלקת אוזניים, דלקת קרום המוח ואלח דם ברחבי העולם9.
בחגורת דלקת קרום המוח האפריקאית, סרוטיפ 1 אחראי להתפרצויות דלקת קרום המוח, כאשר סוג הרצף (ST) ST217, סוג רצף אלים ביותר, דומיננטי 10,11,12,13,14,15. חשיבותו בפתולוגיה של דלקת קרום המוח הושוותה לזו של Neisseria meningitidis בחגורת דלקת קרום המוח האפריקאית16. סרוטיפ 1 הוא לעתים קרובות הגורם העיקרי ל- IPD; עם זאת, הוא נמצא לעתים רחוקות מאוד בכרכרה. למעשה, בגמביה, סרוטיפ זה אחראי ל -20% מכלל המחלות הפולשניות, אך הוא נמצא רק ב -0.5% מהנשאים הבריאים 14,17,18,19. החלפה גנטית ורקומבינציה בפנאומוקוקים מוסמכים מתרחשת בדרך כלל בהובלה ולא במחלה פולשנית20. יתר על כן, סרוטיפ 1 הוכח כאחד משיעורי ההובלה הקצרים ביותר המתוארים בקרב פנאומוקוקים (9 ימים בלבד). לכן, הוצע כי סרוטיפ זה עשוי להיות בעל שיעור רקומבינציה נמוך בהרבה מאחרים21.
יש צורך במחקרי עומק כדי להבין את הסיבה לשיעור ההובלה הנמוך של זני סרוטיפ 1 ואת חשיבותו במחלות פולשניות באפריקה שמדרום לסהרה.
כאן אנו מדווחים על פרוטוקול המאפשר מוטגנזה כלל-גנומית של זן סרוטיפ 1 מסוים, 519/43. זן זה יכול בקלות לרכוש ולשלב מחדש דנ"א חדש בגנום שלו. שיטה זו עדיין אינה בין-זנית, אך היא יעילה מאוד כאשר היא נעשית ברקע 519/43 (מטרות אחרות עברו מוטציה, כתבי יד בהכנה). פשוט על ידי שימוש בזן 519/43, וניצול היכולת הטבעית שלו, כמו גם החלפת האופן שבו הדנ"א האקסוגני מסופק, הצלחנו לשנות את הגן pneumolysin (ply) בזן סרוטיפ 1 זה. שיטה זו מייצגת שיפור מזה שהוצג על ידי Harvey et al.22 כפי שהוא נעשה בשלב אחד ללא צורך להעביר את הדנ"א דרך סרוטיפ אחר. עם זאת, ובשל השונות בין הזנים, אף שיטה לא תוקנה לכל הזנים. היכולת לבצע מוטציה בגנים ספציפיים ולצפות בהשפעותיהם תאפשר הבנה מעמיקה של זני סרוטיפ 1 S. pneumoniae ותספק תשובות לתפקידם של זנים אלה בדלקת קרום המוח באפריקה שמדרום לסהרה.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotype 1 נותר בעיה עצומה במדינות בעלות הכנסה נמוכה ובינונית, במיוחד באפריקה שמדרום לסהרה. למרות חשיבותו, מחקרים בסרוטיפ זה עוכבו על ידי היעדר כלים גנטיים כדי לשנות אותו. במחקר זה אנו מתארים שיטה לשינוי גנטי של איזולט קליני של סרוטיפ 1 (זן 519/43). באופן מעניין, זה הושג על ידי ניצול יכולתו של הפנאומוקוק לרכוש דנ"א באופן טבעי. עם זאת, בניגוד לרוב הפנאומוקוקים, השימוש בדנ"א ליניארי לא היה מוצלח; כדי לשנות את הזן החשוב הזה, היה צורך להשתמש בפלסמיד מתאבד. מתודולוגיה זו סיפקה את האמצעים להבנה עמוקה יותר של סרוטיפ חמקמק זה, הן מבחינת הביולוגיה והן מבחינת הפתוגנים שלו. כדי לאמת את השיטה, הרעלן העיקרי הידוע של פנאומוקוק, פנאומוליזין, עבר מוטציה מכיוון שיש לו פנוטיפ ידוע וקל למעקב. הראינו שהמוטציה, כצפוי, איבדה את יכולתה ללדת תאי דם אדומים. על ידי היכולת לבצע מוטציה בגן חשוב בסרוטיפ המעניין, הצלחנו לצפות בפנוטיפים שונים לאובדן מוטציות תפקודיות בזיהומים תוך צפקיים ותוך אפיים מאלה שנצפו עבור סרוטיפים אחרים. לסיכום, מחקר זה מוכיח כי זן 519/43 (סרוטיפ 1) יכול להיות מהונדס גנטית.

הפרוטוקול המתואר כאן מתחיל בשימוש ב- PCR כדי להגביר את זרועות ההומולוגיה השמאלית והימנית, תוך מחיקת 191 bp מהאזור האמצעי של גן הרובד . בעת ביצוע ה-PCR מציגים אתר BamHI ב-3' של זרוע ההומולוגיה השמאלית ובקצה ה-5' של זרוע ההומולוגיה הימנית (איור 1A). אחריו מגיע PCR-SOE, שבו זרועות הומולוגי...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

כאן אנו מתארים זן סרוטיפ 1 של S. pneumoniae serotype 1 519/43 שניתן להנדס גנטית באמצעות יכולתו לרכוש באופן טבעי DNA ופלסמיד מתאבד. כהוכחה עקרונית נוצרה מוטציה איזוגנית בגן הפנאומוליזין (ply).

בניית מוטנטים בסרוטיפ 1 סטרפטוקוקוס דלקת ריאות זן 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

באמצעות הדמיה Bioluminescent לחקור סינרגיזם בין Streptococcus pneumoniae ו שפעת וירוס עכברים תינוקות

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

הסקה Genotypic של כמיהות HIV-1 שימוש אוכלוסייה מבוססת רצף של V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

תא הדמיה חיה של Bacillus subtilis ו Streptococcus pneumoniae באמצעות מיקרוסקופית אוטומטי זמן לשגות

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

אפיון של תגובות דלקתיות במהלך קולוניזציה תוך-אפית עם דלקת ריאות סטרפטוקוקוס

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

ניטור שינויים בממברנה קוטביות, ממברנה יושרה, וריכוזי יון תאיים ב<em&gt; Streptococcus pneumoniae</em&gt; שימוש צבעי ניאון

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; שימוש תגובת Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

קופסית Serotyping של<em&gt; Streptococcus pneumoniae</em&gt; על ידי לאטקס התלכדות

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

A Murine Model of Group B Streptococcus Vaginal Colonization

מודל Murine של הקבוצה B<em&gt; סטרפטוקוקוס</em&gt; נרתיקי Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

מודל דלקת ריאות חזק במכרסמי immunocompetent להערכת יעילות אנטיבקטריאלי נגד<i&gt; S. pneumoniae</i&gt;,<i&gt; H. אינפלואנזה</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; או<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

שכפול של הוזמן, ספריית Nonredundant של Pseudomonas aeruginosa זן PA14 Transposon ההכנסה מוטציות

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...