Name: constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43
Uploaded: 2020-09-11T14:00:00
Description: Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Nos gustaría agradecer al Meningitis Trust y al MRC por proporcionar fondos para este trabajo.

1. Generación del amplicón mutante por SOE-PCR23 y amplificación del casete de espectinomicina
<ol><li>Comience realizando PCR para la amplificación de los brazos de homología (ply 5' (488 pb) y ply3' (715 pb) respectivamente) de las regiones flanqueantes del gen ply de la cepa 519/43. Use imprimaciones plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5'R1_BamHI (CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGTTGA), ply3'F1_BamHI (TCAAGGTCAAGTTTGGTTCTGGATCC GCG...

<ol>
	<li>Bentley, S. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Analysis+of+the+Capsular+Biosynthetic+Locus+from+All+90+Pneumococcal+Serotypes.">Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes.</a> PLoS Genetics. 2 (3), 31 (2006).</li><li>Calix, J. J., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+pneumococcal+serotype,+11E,+has+a+variably+inactivated+wcjE+gene.">A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene.</a> The Journal of Infectious Diseases. 202 (1), 29-38 (2010).</li><li>Park, I. H., Pritchard, D. G., Cartee, R., Brandao, A., Brandileone, M. C. C., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+New+Capsular+Serotype+(6C)+within+Serogroup+6+of+Streptococcus+pneumoniae.">Discovery of a New Capsular Serotype (6C) within Serogroup 6 of Streptococcus pneumoniae.</a> Journal of Clinical Microbiology. 45 (4), 1225-1233 (2007).</li><li>Jin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Putative+Streptococcus+pneumoniae+Serotype+6D+among+Nasopharyngeal+Isolates+from+Fijian+Children.">First Report of Putative Streptococcus pneumoniae Serotype 6D among Nasopharyngeal Isolates from Fijian Children.</a> The Journal of Infectious Diseases. 200 (9), 1375-1380 (2009).</li><li>Oliver, M. B., vander Linden, M. P. G., K&#252;ntzel, S. A., Saad, J. S., Nahm, M. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Streptococcus+pneumoniae+Serotype+6+Variants+with+Glycosyltransferases+Synthesizing+Two+Differing+Repeating+Units.">Discovery of Streptococcus pneumoniae Serotype 6 Variants with Glycosyltransferases Synthesizing Two Differing Repeating Units.</a> Journal of Biological Chemistry. 288 (36), 25976-25985 (2013).</li><li>Calix, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serological+Characterization+of+Two+Capsule+Subtypes+among+Streptococcus+pneumoniae+Serotype+20+Strains.">Serological Characterization of Two Capsule Subtypes among Streptococcus pneumoniae Serotype 20 Strains.</a> Journal of Biological Chemistry. 287 (33), 27885-27894 (2012).</li><li>Park, I. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+Serological+Characterization+of+a+New+Pneumococcal+Serotype,+6H,+and+Generation+of+a+Pneumococcal+Strain+Producing+Three+Different+Capsular+Repeat+Units.">and Serological Characterization of a New Pneumococcal Serotype, 6H, and Generation of a Pneumococcal Strain Producing Three Different Capsular Repeat Units.</a> Clinical and Vaccine Immunology. 22 (3), 313-318 (2015).</li><li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> The Lancet. 374 (9693), 893-902 (2009).</li><li>Henriques-Normark, B., Tuomanen, E. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pneumococcus:+Epidemiology,+Microbiology,+and+Pathogenesis.">The Pneumococcus: Epidemiology, Microbiology, and Pathogenesis.</a> Cold Spring Harbor Perspectives in Medicine. 3 (7), 010215 (2013).</li><li>Leimkugel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Outbreak+of+Serotype+1+Streptococcus+pneumoniae+Meningitis+in+Northern+Ghana+with+Features+That+Are+Characteristic+of+Neisseria+meningitidis+Meningitis+Epidemics.">An Outbreak of Serotype 1 Streptococcus pneumoniae Meningitis in Northern Ghana with Features That Are Characteristic of Neisseria meningitidis Meningitis Epidemics.</a> The Journal of Infectious Diseases. 192 (2), 192-199 (2005).</li><li>Yaro, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiological+and+Molecular+Characteristics+of+a+Highly+Lethal+Pneumococcal+Meningitis+Epidemic+in+Burkina+Faso.">Epidemiological and Molecular Characteristics of a Highly Lethal Pneumococcal Meningitis Epidemic in Burkina Faso.</a> Clinical Infectious Diseases. 43 (6), 693-700 (2006).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+epidemiology+of+pneumococci+obtained+from+Gambian+children+aged+2-29+months+with+invasive+pneumococcal+disease+during+a+trial+of+a+9-valent+pneumococcal+conjugate+vaccine.">Molecular epidemiology of pneumococci obtained from Gambian children aged 2-29 months with invasive pneumococcal disease during a trial of a 9-valent pneumococcal conjugate vaccine.</a> BMC Infectious Diseases. 8 (1), 81 (2008).</li><li>Kwambana-Adams, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+outbreak+of+pneumococcal+meningitis+among+older+children+(&#8805;5+years)+and+adults+after+the+implementation+of+an+infant+vaccination+programme+with+the+13-valent+pneumococcal+conjugate+vaccine+in+Ghana.">An outbreak of pneumococcal meningitis among older children (&#8805;5 years) and adults after the implementation of an infant vaccination programme with the 13-valent pneumococcal conjugate vaccine in Ghana.</a> BMC Infectious Diseases. 16 (1), 575 (2016).</li><li>Antonio, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seasonality+and+outbreak+of+a+predominant+Streptococcus+pneumoniae+serotype+1+clone+from+The+Gambia:+Expansion+of+ST217+hypervirulent+clonal+complex+in+West+Africa.">Seasonality and outbreak of a predominant Streptococcus pneumoniae serotype 1 clone from The Gambia: Expansion of ST217 hypervirulent clonal complex in West Africa.</a> BMC Microbiology. 8 (1), 198 (2008).</li><li>Staples, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+of+an+Australian+serotype+1+Streptococcus+pneumoniae+outbreak.">Molecular characterization of an Australian serotype 1 Streptococcus pneumoniae outbreak.</a> Epidemiology and Infection. 143 (2), 325-333 (2015).</li><li>Gessner, B. D., Mueller, J. E., Yaro, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=African+meningitis+belt+pneumococcal+disease+epidemiology+indicates+a+need+for+an+effective+serotype+1+containing+vaccine,+including+for+older+children+and+adults.">African meningitis belt pneumococcal disease epidemiology indicates a need for an effective serotype 1 containing vaccine, including for older children and adults.</a> BMC Infectious Diseases. 10 (1), 22 (2010).</li><li>Hill, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nasopharyngeal+carriage+of+Streptococcus+pneumoniae+in+Gambian+infants:+a+longitudinal+study.">Nasopharyngeal carriage of Streptococcus pneumoniae in Gambian infants: a longitudinal study.</a> Clinical Infectious Diseases. 46 (6), 807-814 (2008).</li><li>Ebruke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+in+nasopharyngeal+carriage+of+Streptococcus+pneumoniae+serotype+1+genotypes+in+healthy+Gambians+before+and+after+the+7-valent+pneumococcal+conjugate+vaccine.">Temporal changes in nasopharyngeal carriage of Streptococcus pneumoniae serotype 1 genotypes in healthy Gambians before and after the 7-valent pneumococcal conjugate vaccine.</a> PeerJ. 3, 90 (2015).</li><li>Adegbola, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+and+antimicrobial+susceptibility+patterns+of+isolates+of+Streptococcus+pneumoniae+causing+invasive+disease+in+The+Gambia+1996-2003.">Serotype and antimicrobial susceptibility patterns of isolates of Streptococcus pneumoniae causing invasive disease in The Gambia 1996-2003.</a> Tropical Medicine and International Health. 11 (7), 1128-1135 (2006).</li><li>Marks, L. R., Reddinger, R. M., Hakansson, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+of+Genetic+Recombination+during+Nasopharyngeal+Carriage+and+Biofilm+Formation+in+Streptococcus+pneumoniae.">High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae.</a> mBio. 3 (5), (2012).</li><li>Ritchie, N. D., Mitchell, T. J., Evans, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+different+about+serotype+1+pneumococci.">What is different about serotype 1 pneumococci.</a> Future Microbiology. 7 (1), 33-46 (2012).</li><li>Harvey, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+variable+region+of+pneumococcal+pathogenicity+island+1+is+responsible+for+unusually+high+virulence+of+a+serotype+1+isolate.">The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate.</a> Infection and Immunity. 84 (3), 822-832 (2016).</li><li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> BioTechniques. 8 (5), 528-535 (1990).</li><li>Alioing, G., Granadel, C., Morrison, D. A., Claverys, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competence+pheromone,+oligopeptide+permease,+and+induction+of+competence+in+Streptococcus+pneumoniae.">Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae.</a> Molecular Microbiology. 21 (3), 471-478 (1996).</li><li>Lund, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Enumeration and description of the strains belonging to the State Serum Institute, Copenhagen Denmark. , (1951).</li><li>Barany, F., Tomasz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+pneumoniae+by+heterologous+plasmid+deoxyribonucleic+acid.">Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.</a> Journal of Bacteriology. 144 (2), 698-709 (1980).</li><li>Terra, V. S., Homer, K. A., Rao, S. G., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+novel+&#946;-galactosidase+activity+that+contributes+to+glycoprotein+degradation+and+virulence+in+Streptococcus+pneumoniae.">Characterization of novel &#946;-galactosidase activity that contributes to glycoprotein degradation and virulence in Streptococcus pneumoniae.</a> Infection and Immunity. 78 (1), (2010).</li><li>Terra, V. S., Zhi, X., Kahya, H. F., Andrew, P. W., Yesilkaya, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+6-phospho-&#946;-glucosidase+(BglA3)+is+involved+in+virulence+and+nutrient+metabolism.">Pneumococcal 6-phospho-&#946;-glucosidase (BglA3) is involved in virulence and nutrient metabolism.</a> Infection and Immunity. 84 (1), (2015).</li><li>Harvey, R. M., Ogunniyi, A. D., Chen, A. Y., Paton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumolysin+with+Low+Hemolytic+Activity+Confers+an+Early+Growth+Advantage+to+Streptococcus+pneumoniae+in+the+Blood.">Pneumolysin with Low Hemolytic Activity Confers an Early Growth Advantage to Streptococcus pneumoniae in the Blood.</a> Infection and Immunity. 79 (10), 4122 (2011).</li><li>Terra, V. S., Plumptre, C. D., Wall, E. C., Brown, J. S., Wren, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+pneumolysin+deficient+mutant+in+Streptococcus+pneumoniae+serotype+1+strain+519/43+and+phenotypic+characterisation.">Construction of a pneumolysin deficient mutant in Streptococcus pneumoniae serotype 1 strain 519/43 and phenotypic characterisation.</a> Microbial Pathogenesis. 141, 103999 (2020).</li></ol>

Streptococcus pneumoniae, en particular el serotipo 1, sigue siendo una amenaza mundial que causa enfermedad neumocócica invasiva y meningitis. A pesar de la introducción de varias vacunas que deberían ser protectoras contra el serotipo 1, en África, este serotipo todavía es capaz de causar brotes que conducen a una alta morbilidad y mortalidad13. La capacidad de manipular genéticamente este serotipo es de importancia crítica debido a su relevancia clínica. El método descrito en ...

Streptococcus pneumoniae (S. pneumoniae, el neumococo) es una de las principales causas de morbilidad y mortalidad a nivel mundial. Hasta hace poco, se han descubierto cerca de 100 serotipos de S. pneumoniae 1,2,3,4,5,6,7. Anualmente, la enfermedad neumocócica invasiva (EPI) se cobra alrededor de 700.000 muertes, de niños menores de 5 años8. S. pneumoniae es la principal causa de neumonía bacteriana, otitis media, meningitis y septicemia en todo el mundo9.
En el cinturón africano de la meningitis, el serotipo 1 es responsable de los brotes de meningitis, donde el tipo de secuencia (ST) ST217, un tipo de secuencia extremadamente virulento, es dominante 10,11,12,13,14,15. Su importancia en la patología de la meningitis ha sido comparada con la de Neisseria meningitidis en el cinturón africano de la meningitis16. El serotipo 1 es a menudo la causa principal de la EPI; Sin embargo, rara vez se encuentra en el transporte. De hecho, en Gambia, este serotipo es responsable del 20% de todas las enfermedades invasivas, pero solo se encontró en el 0,5% de los portadores sanos14,17,18,19. El intercambio genético y la recombinación en neumococos competentes ocurren generalmente en el transporte más que en la enfermedad invasiva20. Además, se ha demostrado que el serotipo 1 tiene una de las tasas de transporte más cortas descritas entre los neumococos (solo 9 días). Por lo tanto, se ha propuesto que este serotipo podría tener una tasa de recombinación mucho menor que otros21.
Se necesitan estudios en profundidad para comprender la razón detrás de la baja tasa de transporte de las cepas del serotipo 1 y su importancia en la enfermedad invasiva en el África subsahariana.
Aquí informamos un protocolo que permite la mutagénesis de todo el genoma de una cepa particular del serotipo 1, 519/43. Esta cepa puede adquirir y recombinar fácilmente nuevo ADN en su genoma. Este método aún no está inter-cepa, pero es muy eficiente cuando se hace en 519/43 fondo (otros objetivos han sido mutados, manuscritos en preparación). Simplemente utilizando la cepa 519/43 y explotando su competencia natural, así como sustituyendo la forma en que se proporciona el ADN exógeno, pudimos mutar el gen de la neumolisina (ply) en esta cepa del serotipo 1. Este método representa una mejora respecto al presentado por Harvey et al.22 ya que se realiza en un solo paso sin necesidad de pasar el ADN a través de un serotipo diferente. Sin embargo, y debido a la variabilidad entre cepas, no se ha estandarizado ningún método para todas las cepas. La capacidad de mutar genes específicos y observar sus efectos permitirá una comprensión profunda de las cepas de S. pneumoniae del serotipo 1 y proporcionará respuestas para el papel de estas cepas en la meningitis en el África subsahariana.

<table>
	<tbody>
		<tr>
			<td>AccuPrime Pfx DNA polymerase</td>
			<td>Invitrogen</td>
			<td>12344024</td>
			<td>Used for amplification of the fragments</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Sigma Aldrich</td>
			<td>A9518</td>
			<td>Used for bacterial selection on stage 1(pSD1)</td>
		</tr>
		<tr>
			<td>Blood Agar Base</td>
			<td>Oxoid</td>
			<td>CM0055</td>
			<td>Used to plate S. pneumoniae transformants</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine</td>
			<td>sigma</td>
			<td>55470</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Brain Heart Infusion</td>
			<td>Oxoid</td>
			<td>CM1135</td>
			<td>used to grow S. pneumoniae cells</td>
		</tr>
		<tr>
			<td>Calcium Chloride Cacl2</td>
			<td>Sigma</td>
			<td>449709</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Competence stimulating peptide 1</td>
			<td>AnaSpec</td>
			<td>AS-63779</td>
			<td>used for S. pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Luria Broth Agar</td>
			<td>Gibco</td>
			<td>22700025</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Luria Broth Base (Miller&#39;s formulation)</td>
			<td>Gibco</td>
			<td>12795027</td>
			<td>used for plating and selection of pSD1 and pSD2</td>
		</tr>
		<tr>
			<td>Monarch Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020S</td>
			<td>Used to extract the bands from the DNA gel</td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010S</td>
			<td>Used to extract plasmid from the cells</td>
		</tr>
		<tr>
			<td>pGEM T-easy</td>
			<td>Promega</td>
			<td>A1360</td>
			<td>used as suicide plasmid</td>
		</tr>
		<tr>
			<td>S.O.C.</td>
			<td>Invitrogen</td>
			<td>15544034</td>
			<td>used for recovery of cells after transformation</td>
		</tr>
		<tr>
			<td>Sodium Hydroxide (NaOH)</td>
			<td>Sigma</td>
			<td>S0899</td>
			<td>used for S.pneumoniae Transformation</td>
		</tr>
		<tr>
			<td>Spectinomycin Hydrochloride</td>
			<td>SigmaAldrich</td>
			<td>PHR1426</td>
			<td>Used for bacterial selection</td>
		</tr>
		<tr>
			<td>Subcloning Efficiency DH5&#945; Competent Cells</td>
			<td>Invitrogen</td>
			<td>18265017</td>
			<td>used for the creation of pSD1 and pSD2</td>
		</tr>
	</tbody>
</table>

constructing mutants in serotype 1 streptococcus pneumoniae strain 519/43

Streptococcus pneumoniae serotipo 1 sigue siendo un gran problema en los países de ingresos bajos y medios, particularmente en el África subsahariana. A pesar de su importancia, los estudios en este serotipo se han visto obstaculizados por la falta de herramientas genéticas para modificarlo. En este estudio, describimos un método para modificar genéticamente un aislado clínico de serotipo 1 (cepa 519/43). Curiosamente, esto se logró explotando la capacidad del neumococo para adquirir ADN de forma natural. Sin embargo, a diferencia de la mayoría de los neumococos, el uso de ADN lineal no tuvo éxito; Para mutar esta importante cepa, se tuvo que usar un plásmido suicida. Esta metodología ha proporcionado los medios para una comprensión más profunda de este esquivo serotipo, tanto en términos de su biología como de patogenicidad. Para validar el método, la principal toxina neumocócica conocida, la neumolisina, fue mutada porque tiene un fenotipo bien conocido y fácil de seguir. Demostramos que el mutante, como era de esperar, perdió su capacidad de lisar los glóbulos rojos. Al poder mutar un gen importante en el serotipo de interés, pudimos observar diferentes fenotipos para la pérdida de función mutantes en infecciones intraperitoneales e intranasales de los observados para otros serotipos. En resumen, este estudio demuestra que la cepa 519/43 (serotipo 1) puede ser modificada genéticamente.

El protocolo descrito aquí comienza utilizando PCR para amplificar los brazos de homología izquierda y derecha, mientras que simultáneamente elimina 191 pb de la región media del gen ply . Durante la realización de la PCR se introduce un sitio BamHI en los 3' del brazo de homología izquierdo y en el extremo 5' del brazo de homología derecho (Figura 1A). Esto es seguido por PCR-SOE donde los brazos de homología izquierda y derecha se fusionan en un amplicón (<strong class="x...

Watch this Scientific Journal Video about Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43 at JoVE.com

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Aquí, describimos una cepa 519/43 del serotipo 1 de S. pneumoniae que puede modificarse genéticamente utilizando su capacidad para adquirir ADN de forma natural y un plásmido suicida. Como prueba de principio, se hizo un mutante isogénico en el gen de la neumolisina (ply).

Construcción de mutantes en el serotipo 1 Streptococcus pneumoniae cepa 519/43

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, ...

Research

JoVE Journal

Immunology and Infection

Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Utilizando imágenes bioluminiscentes encargado de investigar la sinergia entre Streptococcus pneumoniae Y el Virus de la Influenza en ratones lactantes

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Investigación

Inmunología e Infección

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Inferencia genotípica del VIH-1 tropismo utilizando la población basada en la secuencia de V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy

Imágenes de células vivas de Bacillus subtilis Y Streptococcus pneumoniae Automatizada utilizando Time-lapse microscopía

During the last few years scientists became increasingly aware that average data obtained from microbial population based experiments are not ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Caracterización De Las Respuestas Inflamatorias Durante La Colonización Intranasal Con Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Monitoring Changes in Membrane Polarity, Membrane Integrity, and Intracellular Ion Concentrations in Streptococcus pneumoniae Using Fluorescent Dyes

Vigilar los cambios en la polaridad de la membrana, membrana Integridad, e intracelular de iones concentraciones en<em&gt; Streptococcus pneumoniae</em&gt; Uso de tintes fluorescentes

Membrane depolarization and ion fluxes are events that have been studied extensively in biological systems due to their ability to profoundly impact ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular serotipificación de<em&gt; Streptococcus pneumoniae</em&gt; Uso de la Reacción Quellung

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotipificación de<em&gt; Streptococcus pneumoniae</em&gt; Por partículas de látex

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

A Murine Model of Group B Streptococcus Vaginal Colonization

A Murine Model of Group B Streptococcus Vaginal Colonization

Un modelo murino de Grupo B<em&gt; Streptococcus</em&gt; Colonización vaginal

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

Un modelo de neumonía en inmunocompetentes robusta roedores para evaluar Eficacia antibacteriana contra<i&gt; S. pneumoniae</i&gt;,<i&gt; H. influenzae</i&gt;,<i&gt; K. pneumoniae</i&gt;,<em&gt; P. aeruginosa</em&gt; o<em&gt; A. baumannii</em

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Replicación de la ordena, no redundante biblioteca de Pseudomonas aeruginosa cepa PA14 mutantes de inserción de transposones

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...