Name: organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function
Uploaded: 2021-07-29T13:00:00
Description: Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

이 작업은 Topsector Life Sciences & Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) 공공 - 민간 파트너십 (PPP) 프로젝트 번호 LSHM16021 Organoids와 함께 네덜란드 LSH 부문의 수당을 Hubrecht Organoid Technology (HUB) 및 HUB 내부 자금 조달 질병 모델링 및 독성학 부서에 대한 독성학 모델링을위한 새로운 도구로 지원합니다. 우리는 Sabine Middendorp (소아 위장병학, Wilhelmina Children 's Hospital, UMC, Utrecht)와 Hugo R. de Jonge와 Marcel J.C. Bijvelds (위장병 및 간학과, Erasmus MC, Rotterdam)의 실험실에 멤브레인 삽입물에 단층을 설정하는 초기 기술 지원을 제공 한 것에 감사드립니다.

1. 배양용 시약 준비
참고: 생물 안전 캐비닛 내부의 모든 단계를 수행하고 세포 배양 작업에 대한 표준 지침을 따르십시오. 자외선은 생물 안전 캐비닛을 시작하기 전에 10 분 동안 사용됩니다. 사용 전후에 생물 안전 캐비닛의 표면을 70 % 에탄올에 적신 티슈 페이퍼로 청소합니다. 세포외 매트릭스 (ECM)의 3차원 방울의 형성을 용이하게 하기 위해, 96-, 24-, 및 6-웰 플레이트의 예?...

<ol>
	<li>Haegebarth, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signaling,+lgr5,+and+stem+cells+in+the+intestine+and+skin.">Wnt signaling, lgr5, and stem cells in the intestine and skin.</a> The American Journal of Pathology. 174 (3), 715-721 (2009).</li><li>Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+intestinal+barrier+and+current+techniques+for+the+assessment+of+gut+permeability.">The intestinal barrier and current techniques for the assessment of gut permeability.</a> Cells. 9 (8), 1909 (2020).</li><li>Mart&#237;nez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HT29+Cell+Line.">HT29 Cell Line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+single+Lgr5(+)+liver+stem+cells+induced+by+Wnt-driven+regeneration.">In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration.</a> Nature. 11 (2), 179-194 (2013).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expanding+human+airway+organoids+for+disease+modeling.">Long-term expanding human airway organoids for disease modeling.</a> The EMBO Journal. 38 (4), 1-20 (2019).</li><li>Karthaus, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multipotent+luminal+progenitor+cells+in+human+prostate+organoid+cultures.">Identification of multipotent luminal progenitor cells in human prostate organoid cultures.</a> Cell. 159 (1), 163-175 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1-2), 324-338 (2015).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+living+biobank+of+breast+cancer+organoids+captures+disease+heterogeneity.">A living biobank of breast cancer organoids captures disease heterogeneity.</a> Cell. 172 (1-2), 373-386 (2018).</li><li>Vlachogiannis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+treatment+response+of+metastatic+gastrointestinal+cancers.">Patient-derived organoids model treatment response of metastatic gastrointestinal cancers.</a> Science. 359 (6378), 920-926 (2018).</li><li>Van De Wetering, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+derivation+of+a+living+organoid+biobank+of+colorectal+cancer+patients.">Prospective derivation of a living organoid biobank of colorectal cancer patients.</a> Cell. 161 (4), 933-945 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreatic+cancer+organoids+recapitulate+disease+and+allow+personalized+drug+screening.">Pancreatic cancer organoids recapitulate disease and allow personalized drug screening.</a> Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).</li><li>Tiriac, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+profiling+identifies+common+responders+to+chemotherapy+in+pancreatic+cancer.">Organoid profiling identifies common responders to chemotherapy in pancreatic cancer.</a> Cancer Discovery. 8 (9), 1112-1129 (2018).</li><li>d'Aldebert, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+colon+organoids+from+inflammatory+bowel+disease+patients.">Characterization of human colon organoids from inflammatory bowel disease patients.</a> Frontiers in Cell and Developmental Biology. 8, 363 (2020).</li><li>Dotti, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alterations+in+the+epithelial+stem+cell+compartment+could+contribute+to+permanent+changes+in+the+mucosa+of+patients+with+ulcerative+colitis.">Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis.</a> Gut. 66 (12), 2069-2079 (2017).</li><li>VanDussen, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+enhanced+human+gastrointestinal+epithelial+culture+system+to+facilitate+patient-based+assays.">Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays.</a> Gut. 64 (6), 911-920 (2015).</li><li>Noel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+primary+human+macrophage-enteroid+co-culture+model+to+investigate+mucosal+gut+physiology+and+host-pathogen+interactions.">A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions.</a> Scientific Reports. 7, 45270 (2017).</li><li>Bartfeld, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+human+gastric+epithelial+stem+cells+and+their+responses+to+bacterial+infection.">In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection.</a> Gastroenterology. 148 (1), 126-136 (2015).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signalling+induces+maturation+of+Paneth+cells+in+intestinal+crypts.">Wnt signalling induces maturation of Paneth cells in intestinal crypts.</a> Nature Cell Biology. 7 (4), 381-386 (2005).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dll1+marks+early+secretory+progenitors+in+gut+crypts+that+can+revert+to+stem+cells+upon+tissue+damage.">Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage.</a> Nature Cell Biology. 14 (10), 1099-1104 (2012).</li><li>de Lau, W. B. M., Snel, B., Clevers, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+R-spondin+protein+family.">The R-spondin protein family.</a> Genome Biology. 13 (3), 1-10 (2012).</li><li>Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+quiescence+of+Lgr5++stem+cells+in+intestinal+organoids+enables+differentiation+of+hormone-producing+enteroendocrine+cells.">Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells.</a> Cell Stem Cell. 20 (2), 177-190 (2017).</li><li>Beumer, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteroendocrine+cells+switch+hormone+expression+along+the+crypt-to-villus+BMP+signalling+gradient.">Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient.</a> Nature Cell Biology. 20 (8), 909-916 (2018).</li><li>Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Niche-independent+high-purity+cultures+of+Lgr5++intestinal+stem+cells+and+their+progeny.">Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny.</a> Nature Methods. 11 (1), 106-112 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forskolin-induced+swelling+in+intestinal+organoids:+An+in+vitro+assay+for+assessing+drug+response+in+cystic+fibrosis+patients.">Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients.</a> Journal of Visualized Experiments. (120), (2017).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+surrogate+Wnts+support+organoid+growth+and+deconvolute+Frizzled+pleiotropy+in+vivo.">Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo.</a> Cell Stem Cell. 27 (5), 840-851 (2020).</li><li>Srinivasan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TEER+measurement+techniques+for+in+vitro+barrier+model+systems.">TEER measurement techniques for in vitro barrier model systems.</a> Journal of Laboratory Automation. 20 (2), 107-126 (2015).</li><li>Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+corrected+transepithelial+electrical+resistance+(TEER)+measurement+to+quantify+rapid+changes+in+paracellular+permeability.">Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability.</a> Die Pharmazie. 65 (1), 19-24 (2010).</li><li>Lea, T., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caco-2+cell+line.">Caco-2 cell line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).</li><li>Heo, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+Cryptosporidium+infection+in+human+small+intestinal+and+lung+organoids.">Modelling Cryptosporidium infection in human small intestinal and lung organoids.</a> Nature Microbiology. 3 (7), 814-823 (2018).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li></ol>

이 프로토콜은 장 오가노이드의 일반적인 조작 및 유지뿐만 아니라 이러한 오가노이드로부터 유래된 상피 단일층의 준비 및 가능한 응용을 기술한다. 현재까지, 단층은 십이지장, 장폐색 및 정상 뿐만 아니라 이전에 그리고 활발하게 염증을 일으킨 장 조직으로부터 유래된 결장 오가노이드의 상이한 영역으로부터 성공적으로 제조되었다(공개되지 않은 데이터). 환자 유래 오가노이드 단일층의 ?...

장 상피는 장의 발광 함량과 기저 조직 사이의 물리적 장벽 역할을합니다. 이 장벽은 인접한 세포 사이에 강한 세포 간 연결을 확립하는 단단한 접합에 의해 연결되는 주로 흡수성 장세포의 단일 상피층을 포함한다. 이 세포들은 장의 정점 (루멘)과 기저변을 분리하는 편광 상피 내막을 형성하면서 동시에 소화 된 영양소와 대사 산물의 부세포 수송을 조절합니다. 장세포 이외에, 잔, 파네스 및 장내분비 세포와 같은 다른 중요한 상피 세포도 점액, 항균 펩티드 및 호르몬을 각각 생산함으로써 장 항상성에 기여한다. 장 상피는 류신이 풍부한 반복 함유 G-단백질 결합 수용체 5 양성 (LGR5+) 줄기 세포를 장내 크립트의 바닥에 나누어 지속적으로 보충하여 위쪽으로 이동하여 다른 세포 유형으로 분화되는 트랜스 증폭 (TA) 세포를 생산합니다1. 식품 알레르겐, 의약 화합물 및 미생물 병원균에 대한 노출과 같은 유전 적 및 환경 적 요인에 의한 장 상피 항상성의 붕괴는 장 장벽 기능의 중단으로 이어집니다. 이러한 상태는 염증성 장 질환 (IBD), 체강 질환 및 약물 유발 GI 독성2를 포함한 여러 장 질환을 유발합니다.
장 상피에 대한 연구는 막 삽입물, 장기 온 칩 시스템, Ussing 챔버 및 장 링과 같은 여러 시험관 내 플랫폼 시스템을 사용하여 수행됩니다. 이들 플랫폼은 형질전환된 세포주 또는 일차 조직을 모델로서 사용하여 막의 정점 및 기저측 양쪽 모두에 접근할 수 있는 편광된 상피 단층을 확립하는데 적합하다. 대장(adeno)암종 세포주인 Caco-2, T84 및 HT-29와 같은 형질전환 세포주는 어느 정도 편광된 장내세포 또는 점액 생성 세포로 분화할 수 있지만, 이들은 여러 세포 유형이 누락되고 다양한 수용체 및 운반체가 비정상적으로 발현됨에 따라 생체내 상피를 대표하지 않는다3 . 또한, 세포주는 단일 공여체로부터 유래되기 때문에, 이들은 환자간 이질성을 나타내지 않으며 감소된 복잡성 및 생리학적 관련성을 겪는다. Ussing 챔버 및 장 고리로 사용되는 일차 조직은 생체 내 상황을 더 대표하지만, 제한된 가용성, 단기 생존력 및 확장성 부족으로 인해 고처리량 (HT) 연구를위한 매개체로 부적합합니다.
오가노이드는 장, 신장, 간, 췌장 및 폐와 같은 다른 기관으로부터 확립된 시험관내 상피 배양물이다. 그들은 장기적이고 안정적인 확장성뿐만 아니라 유전 적 및 표현형 안정성을 갖는 것으로 입증되었으므로 외부 자극에 충실한 반응을 보이는 원래 기관의 상피의 대표적인 생물학적 미니어처입니다 4,5,6,7,8,9. 오가노이드는 절제되거나 생검된 정상, 병, 염증 또는 암성 조직으로부터 효율적으로 확립되며, 이질적인 환자 특이적 반응10,11,12,13,14,15,16을 나타낸다. 이 논문은 오가노이드 문화에서 유래 된 장 상피 단층을 확립하는 방법을 보여줍니다. 단층은 소장뿐만 아니라 결장 및 직장 오가노이드 문화에서 성공적으로 확립되었습니다. 이 모델은 상피 세포가 약물에 대한 수송 및 투과성뿐만 아니라 상피에 대한 독성 학적 영향을 연구 할 수있는 기회를 창출합니다. 또한이 모델은 면역 세포 및 박테리아와의 공동 배양을 통해 장 상피와의 상호 작용을 연구 할 수 있습니다17,18,19. 또한,이 모델은 환자 특정 방식으로 치료법에 대한 반응을 연구하고 상피 장벽 중심의 치료제의 다음 물결을 찾기 위해 스크리닝 노력을 시작하는 데 사용될 수 있습니다. 이러한 접근법은 클리닉으로 확장 될 수 있으며 개인화 된 치료를위한 길을 닦을 수 있습니다.
이 프로토콜의 상피 단층은 인간 정상 장 오가노이드로부터 제조되지만, 프로토콜은 다른 오가노이드 모델에 적용되고 최적화될 수 있다. 상피 오가노이드 단층은 줄기 세포 증식을 지원하고 장내 크립트 세포 조성물을 나타내기 위해 Wnt를 함유하는 장내 오가노이드 확장 배지에서 배양된다. 장내 오가노이드는 Wnt, Notch 및 표피 성장 인자 (EGF) 경로를 조절함으로써 장내분비 세포, 파네스, 잔 및 장내분비 세포와 같은 상이한 장 상피 운명을 갖도록 농축될 수 있다. 여기서, 확장 배지에서 단층의 확립 후에, 이들은 이전에 기술된 바와 같이 더 분화된 장 상피 세포,20,21,22,23,24,25로 구동된다. 스크리닝 목적을 위해, 관심있는 화합물의 작용 모드, 그의 표적 세포, 및 실험 조건에 따라, 단층은 관련 기능적 판독을 갖는 화합물의 효과를 측정하기 위해 선택된 세포 조성을 향해 구동될 수 있다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100% ethanol</td>
			<td>Fisher Emergo</td>
			<td>10644795</td>
			<td></td>
		</tr>
		<tr>
			<td>1250, 300, and 20 &#181;L low-retention filter-tips</td>
			<td>Greiner bio-one</td>
			<td>732-1432 / 732-1434 / 732-2383</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well HTS Fluoroblok Transwell plate (light-tight)</td>
			<td>Corning</td>
			<td>351156</td>
			<td rowspan="2">Plates require REMS AutoSampler for TEER measurements</td>
		</tr>
		<tr>
			<td>24-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>3378</td>
		</tr>
		<tr>
			<td>24-well plate with Transwell inserts</td>
			<td>Corning</td>
			<td>3470</td>
			<td>membrane inserts</td>
		</tr>
		<tr>
			<td>40 &#181;m cell strainer</td>
			<td>PluriSelect</td>
			<td>43-50040-01</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>657160</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black plate transparent bottom</td>
			<td>Greiner bio-one</td>
			<td>655090</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well fast thermal cycling plates</td>
			<td>Life Technologies Europe BV</td>
			<td>4346907</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Fluoroblok Transwell plate</td>
			<td>Corning</td>
			<td>351162</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>7369</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well transparent culture plate</td>
			<td>Greiner bio-one</td>
			<td>655180</td>
			<td></td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Bio-Techne Ltd</td>
			<td>2939</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase Cell Dissociation Reagent</td>
			<td>Life Technologies Europe BV</td>
			<td>A11105-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Advanced DMEM/F-12</td>
			<td>Life Technologies Europe BV</td>
			<td>12634028</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 supplement</td>
			<td>Life Technologies Europe BV</td>
			<td>17504001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture microscope (light / optical microscope)</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CellTiter-Glo</td>
			<td>Promega</td>
			<td>G9683</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 incubator</td>
			<td>PHCBI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich</td>
			<td>D5942</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC treated H2O</td>
			<td>Life Technologies Europe BV</td>
			<td>750024</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS) with Ca2+ and Mg2+</td>
			<td>Life Technologies Europe BV</td>
			<td>14040091</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, powder, no calcium, no magnesium</td>
			<td>Life Technologies Europe BV</td>
			<td>21600069</td>
			<td></td>
		</tr>
		<tr>
			<td>EnzChek Lysozyme Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>E22013</td>
			<td></td>
		</tr>
		<tr>
			<td>EVOM2 meter with STX electrode</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>Bio-Techne Ltd</td>
			<td>3006</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass pipettes</td>
			<td>Volac</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Life Technologies Europe BV</td>
			<td>35050038</td>
			<td></td>
		</tr>
		<tr>
			<td>hEGF</td>
			<td>Peprotech</td>
			<td>AF-100-15</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Life Technologies Europe BV</td>
			<td>15630056</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Noggin</td>
			<td>Peprotech</td>
			<td>120-10C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Rspo3</td>
			<td>Bio-Techne Ltd</td>
			<td>3500-RS/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>IWP-2</td>
			<td>Miltenyi Biotec</td>
			<td>130-105-335</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 primary antibody</td>
			<td>Sanbio</td>
			<td>BSH-7302-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 secondary antibody</td>
			<td>Agilent</td>
			<td>K400111-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Kova International Glasstic Slide with Counting grids</td>
			<td>Fisher Emergo</td>
			<td>10298483</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow hood</td>
			<td>Thermo scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lucifer Yellow CH dilithium salt</td>
			<td>Sigma-Aldrich</td>
			<td>L0259</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel, Growth Factor Reduced (GFR)</td>
			<td>Corning</td>
			<td>356231</td>
			<td>extracellular matrix (ECM)</td>
		</tr>
		<tr>
			<td>MicroAmp Fast 8-Tube Strip, 0.1 mL</td>
			<td>Life Technologies Europe BV</td>
			<td>4358293</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 8-Cap Strips</td>
			<td>Life Technologies Europe BV</td>
			<td>4323032</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes</td>
			<td>Eppendorf</td>
			<td>0030 120 086</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettes (1000, 200, and 20 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-15334</td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 secondary antibody</td>
			<td>VWR</td>
			<td>VWRKS/DPVR-HRP</td>
			<td></td>
		</tr>
		<tr>
			<td>Multichannel pipette (200 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma-Aldrich</td>
			<td>A9165</td>
			<td></td>
		</tr>
		<tr>
			<td>NGS Wnt</td>
			<td>U-Protein Express</td>
			<td>N001-0.5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma-Aldrich</td>
			<td>N0636</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Forward</td>
			<td>Custom-made</td>
			<td>GGAGTTATCCTGCTCCCCAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Reverse</td>
			<td>Custom-made</td>
			<td>CTAGGAGGTGAAGGTCCAACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Forward</td>
			<td>Custom-made</td>
			<td>ACACGTACCCACAGAAGCTC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Reverse</td>
			<td>Custom-made</td>
			<td>GGAATGCAGGCCACTGAAAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Forward</td>
			<td>Custom-made</td>
			<td>AGGATCTGAAGAAGTGTGTCACTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Reverse</td>
			<td>Custom-made</td>
			<td>TAATGGAACAGATGTTGAAGTGCT</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Forward</td>
			<td>Custom-made</td>
			<td>ACGCCGAATATAATCCCAAGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Reverse</td>
			<td>Custom-made</td>
			<td>AAATCAGTGCCGTGGTTCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Optical adhesive covers</td>
			<td>Life Technologies Europe BV</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>PD0325901</td>
			<td>Stemcell Technologies</td>
			<td>72184</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/streptomycin</td>
			<td>Life Technologies Europe BV</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plate shaker</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Fisher Emergo</td>
			<td>A25776</td>
			<td></td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>InvivoGen</td>
			<td>ANT-PM-2</td>
			<td>antimicrobial formulation for primary cells</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>Q32852</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent reservoir for multichannel pipet</td>
			<td>Sigma-Aldrich</td>
			<td>CLS4870</td>
			<td></td>
		</tr>
		<tr>
			<td>REMS AutoSampler with 24-probe or 96C-probe</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit</td>
			<td>Thermo scientific</td>
			<td>87023</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-Free DNase Set</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>SB202190</td>
			<td>Sigma-Aldrich</td>
			<td>S7076</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettes</td>
			<td>Greiner bio-one</td>
			<td>606180 / 607180 / 760180</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettor (Pipet-Aid)</td>
			<td>Drummond</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Single edge razor blade</td>
			<td>GEM Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Superscript 1st strand system for RT-PCR</td>
			<td>Life Technologies Europe BV</td>
			<td>11904018</td>
			<td></td>
		</tr>
		<tr>
			<td>Tecan Spark 10M plate reader</td>
			<td>Tecan</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Life Technologies Europe BV</td>
			<td>15250-061</td>
			<td></td>
		</tr>
		<tr>
			<td>TrypLE Express Enzyme (1x)</td>
			<td>Life Technologies Europe BV</td>
			<td>12605-010</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Grant</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Y27632 (ROCK inhibitor)</td>
			<td>AbMole</td>
			<td>M1817</td>
			<td></td>
		</tr>
	</tbody>
</table>

organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function

과거에는 장 상피 모델 시스템이 형질전환 세포주 및 일차 조직으로 제한되었습니다. 이들 모델 시스템은 전자가 원래의 조직 생리학을 충실하게 나타내지 않기 때문에 내재적인 한계를 가지며, 후자의 이용가능성은 제한된다. 따라서 그들의 응용 프로그램은 기초 및 약물 개발 연구를 방해합니다. 성인 줄기 세포 기반 오가노이드 (이하 오가노이드라고 함)는 그들이 파생 된 정상 또는 병든 상피 조직의 미니어처입니다. 이들은 상이한 위장관 (GI) 관 영역에서 매우 효율적으로 확립될 수 있고, 장기간의 확장성을 가지며, 시험관내 치료에 대한 조직 및 환자 특이적 반응을 시뮬레이션할 수 있다. 여기서, 장 유래 오가노이드 유래 상피 단층의 확립은 상피 장벽 완전성, 투과성 및 수송성, 항균 단백질 분비 및 조직학을 측정하는 방법과 함께 입증되었다. 또한, 장 유래 오가노이드 단층은 증식하는 줄기 및 경이 증폭 세포뿐만 아니라 주요 분화 된 상피 세포로 농축 될 수 있습니다. 따라서, 이들은 표적 세포에 대한 화합물의 효과 및 그들의 작용 방식을 연구하도록 맞춤화될 수 있는 모델 시스템을 나타낸다. 오가노이드 배양은 세포주보다 기술적으로 더 까다 롭지 만, 일단 확립되면 생체 내 상피 복잡성과 환자 간 이질성을 진정으로 나타내기 때문에 약물 개발의 후기 단계에서 실패를 줄일 수 있습니다.

도 1A는 이를 동결 상태로부터 해동시킨 후의 장내 오가노이드의 대표적인 밝은 필드 이미지를 도시한다. 최적의 회복을 보장하기 위해 오가노이드를 고밀도로 해동하는 것이 중요합니다. 오가노이드는 약 10μL의 ECM 돔에 있는 24웰 또는 6웰 플레이트에 도금됩니다(그림 1B). 대부분의 정상적인 장 오가노이드는 낭성 형태를 가지고 있습니다. 해동 과정?...

Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function (Video) | JoVE

여기에서, 우리는 장 장벽 기능, 투과성 및 수송을 연구하기 위한 인간 오가노이드 유래 장 상피 단층의 제조를 기술한다. 오가노이드가 외부 자극에 대한 원래의 상피 조직 반응을 나타내기 때문에, 이들 모델은 세포주의 확장성과 일차 조직의 관련성 및 복잡성의 이점을 결합한다.

오가노이드 유래 상피 단층: 장 장벽 기능을 위한 임상적으로 관련된 시험관내 모델

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

오가노이드 유래 단층은 환자의 장 상피 장벽 기능을 재검토하고 각 환자의 기능 장애를 개선하기위한 치료법의 효과를 테스트하여 개인화 된 치료 전략을 식별 할 수있게합니다. 오가노이드 단층은 손상이 발생하는 측면 인 상피의 정점 측면에 대한 액세스를 제공하며 3D 구조로 성장하는 오가노이드에서 정상적이고 접근 할 수 있습니다. 모든 오가노이드는 다르므로 투쟁이 다릅니다.단단한 단층을 형성하려면 증식 단계에서 오가노이드를 사용하고 빠르게 소화하여 두 개에서 네 개의 세포로 구성된 클러스터를 형성하십시오. 모든 모델에 대해 세포 시딩을 적정하십시오. 이 절차를 시연하는 것은 HUB의 선임 연구원 인 Wies Van Dooremalen이 수행 할 것입니다.멤브레인 삽입물을 세포외 매트릭스 또는 ECM으로 코팅하여 시작합니다. 생물 안전 캐비닛에서 작업하면서 멤브레인 인서트를 지지판에 놓습니다. ECM 40X를 얼음처럼 차가운 DPBS에 칼슘과 마그네슘으로 희석한 다음, 희석된 ECM 150 마이크로리터를 각 삽입물의 정점 구획에 피펫한다.플레이트를 섭씨 37도에서 적어도 한 시간 동안 인큐베이션한다. 시딩을 위해 세포를 준비하려면 섭씨 37도 수조에서 세포 해리 시약의 분취량을 미리 준비하십시오. 여섯 웰 플레이트의 각 웰에 대해 두 밀리리터의 시약을 사용하십시오.오가노이드를 함유하는 배양 플레이트를 인큐베이터로부터 생물안전 캐비닛으로 옮긴다. 텍스트 원고에 설명 된대로 오가노이드를 처리하지만 여러 튜브를 하나의 튜브로 풀링하지 마십시오. 오가노이드를 수확 한 후, 기본 배지 또는 BM을 12 밀리리터에 첨가하고 85 배 G에서 원심 분리한 다음 상청액을 흡인하십시오.오가노이드가 들어있는 튜브를 최대 12 밀리리터의 DPBS로 채운 다음 10 밀리리터 피펫을 사용하여 10 번 위아래로 피펫하십시오. 섭씨 8도에서 5분 동안 85배 G에서 원심분리하고, 오가노이드 펠릿을 방해하지 않고 상층액을 흡인한다. 미리 가온된 세포 해리 시약을 오가노이드에 첨가하고 재현탁시킨 다음, 튜브를 섭씨 37도의 수조에서 5분 동안 대각선 또는 수평으로 인큐베이션한다.인큐베이션 후, 다섯 밀리리터 멸균 플라스틱 피펫 또는 P1000 피펫을 사용하여 10회 상하로 피펫을 상하로 피펫한다. 현미경으로 오가노이드 현탁액을 확인하여 단일 세포와 두 개 내지 네 개의 세포로 구성된 일부 세포 덩어리의 혼합물이 형성되었는지 확인하십시오. 세포 현탁액에 ROCK 억제제와 함께 최대 12 밀리리터의 BM을 첨가하여 세포 해리를 중지하십시오.세포를 원심분리한 다음, 세포 펠릿을 방해하지 않고 상청액을 흡인한다. 여러 튜브에서 동일한 오가노이드 배양물을 처리할 때, 세포 펠릿을 풀링한 후 12밀리리터의 BM에 재현탁시킨다. BM으로 미리 습윤된 40마이크로미터 스트레이너를 통해 세포 현탁액을 여과하고 50밀리리터 원뿔형 튜브로 유동 스루를 수확한 다음, 10밀리리터의 BM으로 스트레이너를 세척하고 동일한 튜브로 유동 스루를 수확합니다. 긴장된 세포 현탁액을 두 개의 새로운 15밀리리터 원뿔형 튜브로 옮기고 원심분리를 반복한다.세포 펠릿을 교란시키지 않고 상청액을 흡인하고, 출발 물질로 사용된 전체 배양 플레이트 당 10 마이크로몰 ROCK 억제제로 보충된 IEM의 네 밀리리터에 세포를 재현탁시킨다. 소량의 세포 현탁액을 일대일 비율로 Trypan Blue와 혼합하여 계산 한 다음 세포를 계수하고 살아있는 세포의 총 수를 계산하여 각 개별 세포를 작은 덩어리로 계산합니다. 10 마이크로몰 ROCK 억제제로 보충된 IEM의 밀리리터 당 여섯 번째 살아있는 세포에 3X 10을 함유하는 세포 현탁액을 제조하였다.세포를 시드하려면 ECM 코팅 인서트에서 DPBS를 조심스럽게 흡인하여 플레이트를 수평으로 유지하십시오. ROCK 억제제로 보충된 IEM 800 마이크로리터를 각각의 기저측성 구획에 피펫하고, ECM 코팅된 막 상에 제조된 150 마이크로리터의 세포 현탁액을 정점 구획에 적가한다. 플레이트를 인큐베이터에 섭씨 37도 및 5 % 이산화탄소에 놓습니다.일단 세포가 막 상에 침전되면, 매일 경상피 전기 저항 또는 TEER를 측정하고 현미경을 사용하여 막 삽입물을 이미지화하십시오. 단층을 새로 고치려면, 막 삽입물을 함유하는 플레이트의 기저측성 구획으로부터 배지를 제거한 다음, 정점 구획으로부터 배지를 조심스럽게 흡인한다. 150 마이크로 리터의 신선한 IEM을 각 정점 구획에 떨어 뜨리고 800 마이크로 리터의 신선한 IEM을 각 기저 측부 구획에 첨가하십시오.수동 TEER 미터를 사용하는 경우 70 % 에탄올로 전극을 청소하고 생물 안전 캐비닛 내부에서 공기 건조시킨 다음 BM이 들어있는 튜브에 전극을 넣으십시오. 전극을 수동 TEER 미터에 연결하고 기능 스위치를 돌려 옴 단위로 측정하고 전원 스위치를 켭니다. 짧은 전극을 인서트의 정점 구획에 놓고 단층을 만지지 않고 기저측 구획에 긴 전극을 놓습니다. 빈 웰에서 저항을 측정 한 다음 나머지 샘플에서 저항을 측정하십시오.다른 조건을 가진 샘플 사이에서 BM으로 전극을 세척하십시오. 끝나면 데미 물과 70 % 에탄올로 전극을 닦은 다음 공기 건조하십시오. 이 프로토콜은 장내 오가노이드를 수확하고 상피 세포의 단층을 준비하는 데 사용되었습니다.IEM에서 여덟 일 동안 배양된 단층이 여기에 표시되어 있다. 단층을 장세포 분화 배지 또는 EDM에 노출시킬 때 구조가 관찰되는 반면, 조합 배지 또는 CDM에 노출된 단층은 더 매끄러운 구조를 나타낸다. 단층 형성은 정량적으로 TEER 측정에 뒤따랐다.완전히 합류한 단일층은 약 100 옴 센티미터 제곱의 TEER 값을 가졌고, 이는 어느 분화 배지에 노출될 때 증가하였다. 모든 중간 조건에서 단층은 루시퍼 황색에 대해 더 낮은 겉보기 투과성을 나타냈다. IEM에서 배양된 장폐색 단층에 의한 리소자임 분비는 EDM 또는 CDM에서 또 다른 나흘 동안 그리고 합류할 때까지 IEM에서 배양된 단층의 분비량보다 높았다.IEM, IEM 및 후속 EDM, 또는 IEM 및 후속 CDM에서 배양된 단층은 H&E, Ki67, MUC2 및 Alcian Blue 염색으로 관찰된 형태학의 차이를 보여준다. 분화 시, 증식성 세포는 감소한 반면, 잔 세포 및 장세포 마커 유전자 발현은 LGR5, MUC2 및 알칼리성 포스파타제 유전자 발현으로 나타낸 바와 같이 IEM 조건 하에서 관찰된 것에 비해 증가하였다. 단층을 준비 할 때, 소화 후 오가노이드의 anoikis를 예방하는 것이 중요합니다.추가적으로, 세포의 ECM은 트랜스웰 막에 고르게 분포되어야 한다. 오가노이드-유래 단일층은 환자 특이적 방식으로 상이한 형광 기질을 사용하는 분자 수송의 평가를 허용한다.

Research

JoVE Journal

Biology

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP (Video) | JoVE

RNA 정제에 의한 염색질 절연 (처프)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

연구

생물학

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA (Video) | JoVE

Ribosome 바운드 초기 Polypeptides의 분리<em&gt; 체외에서</em&gt; mRNA 함께 Translational 일시 중지 사이트를 식별하려면

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration (Video) | JoVE

헤어 재생시 상피 - 중간 엽 시그널링의 빠른 유전 분석

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein (Video) | JoVE

정제 된 야생형과 돌연변이 체 CFTR 단백질의 기능의 재구성 및 채널 활동 측정

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Methods to Study Epithelial Transport Protein Function and Expression in Native Intestine and Caco-2 Cells Grown in 3D

Methods to Study Epithelial Transport Protein Function and Expression in Native Intestine and Caco-2 Cells Grown in 3D (Video) | JoVE

방법은 3D로 재배 원주민 소장과 카코 2 세포에서 상피 전송 단백질의 기능과 발현을 연구하는

The intestinal epithelium has important transport and barrier functions that play key roles in normal physiological functions of the body while providing ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability (Video) | JoVE

생체 외에서 그리고 Vivo에서 접근 장 상피 세포 침투성을 결정 하

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

A Mouse Model of Intestinal Partial Obstruction

A Mouse Model of Intestinal Partial Obstruction (Video) | JoVE

장 부분 방해의 마우스 모델

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A)

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A EYFP-CENP-A (Video) | JoVE

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer ...

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes (Video) | JoVE

항생제 치료 모기를 가진 세균성 구강 먹이 분석

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

In Vitro Analysis of E3 Ubiquitin Ligase Function

In Vitro Analysis of E3 Ubiquitin Ligase Function (Video) | JoVE

시험관 내 E3 유비퀴틴 리가제 기능 분석

The covalent attachment of ubiquitin (Ub) to internal lysine residue(s) of a substrate protein, a process termed ubiquitylation, represents one of the ...