Name: isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis
Uploaded: 2021-03-12T14:30:00
Description: Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

जेड लिन को नेशनल इंस्टीट्यूट ऑफ हेल्थ एचएल 138454-01 और मेसोनिक मेडिकल रिसर्च इंस्टीट्यूट फंड द्वारा समर्थित किया गया था।

सभी चूहों को रोगज़नक़-मुक्त स्थितियों में बनाए रखा गया था, और सभी प्रक्रियाओं को मेसोनिक मेडिकल रिसर्च संस्थागत पशु देखभाल और उपयोग समिति (आईएसीयूसी) द्वारा अनुमोदित किया गया था। यूसीपी 1:: क्रे9<...

<ol>
	<li>Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical,+physiological,+and+functional+diversity+of+adipose+tissue.">Anatomical, physiological, and functional diversity of adipose tissue.</a> Cell Metabolism. 27, 68-83 (2018).</li><li>Symonds, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+growth+and+development.">Brown adipose tissue growth and development.</a> Scientifica. 2013, 305763 (2013).</li><li>Giralt, M., Villarroya, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=White,+brown,+beige/brite:+Different+adipose+cells+for+different+functions.">White, brown, beige/brite: Different adipose cells for different functions.</a> Endocrinology. 154, 2992-3000 (2013).</li><li>Cannon, B., Nedergaard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue:+function+and+physiological+significance.">Brown adipose tissue: function and physiological significance.</a> Physiological Reviews. 84, 277-359 (2004).</li><li>Cinti, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adipose+organ.">The adipose organ.</a> Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beige+adipocytes+are+a+distinct+type+of+thermogenic+fat+cell+in+mouse+and+human.">Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.</a> Cell. 150, 366-376 (2012).</li><li>Cypess, A. M., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+fat+as+a+therapy+for+obesity+and+diabetes.">Brown fat as a therapy for obesity and diabetes.</a> Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).</li><li>Schoettl, T., Fischer, I. P., Ussar, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+adipose+tissue+in+development+and+metabolic+function.">Heterogeneity of adipose tissue in development and metabolic function.</a> Journal of Experimental Biology. 221, (2018).</li><li>Kong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+is+a+key+thermogenic+transcriptional+partner+of+PGC-1&#945;.">IRF4 is a key thermogenic transcriptional partner of PGC-1&#945;.</a> Cell. 158, 69-83 (2014).</li><li>Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+origins+of+cold-induced+brown+adipocytes+in+adult+mice.">Cellular origins of cold-induced brown adipocytes in adult mice.</a> The FASEB Journal. 29, 286-299 (2015).</li><li>Kim, W. -. S., Park, H. -. S., Sung, J. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pivotal+role+of+PDGF+and+its+receptor+isoforms+in+adipose-derived+stem+cells.">The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells.</a> Histology and Histopathology. 30 (7), 793-799 (2015).</li><li>Hagberg, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+mouse+and+human+adipocytes+for+the+analysis+of+browning+and+cellular+heterogeneity.">Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity.</a> Cell Report. 24, 2746-2756 (2018).</li><li>Madisen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+high-throughput+Cre+reporting+and+characterization+system+for+the+whole+mouse+brain.">A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.</a> Nature Neuroscience. 13, 133-140 (2010).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Chey, S., Claus, C., Liebert, U. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+simultaneous+isolation+of+proteins+and+nucleic+acids.">Improved method for simultaneous isolation of proteins and nucleic acids.</a> Analytical Biochemistry. 411, 164-166 (2011).</li><li>Ford, T., Graham, J., Rickwood, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iodixanol:+A+nonionic+iso-osmotic+centrifugation+medium+for+the+formation+of+self-generated+gradients.">Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients.</a> Analytical Biochemistry. 220, 360-366 (1994).</li><li>Kovacovicova, K., Vinciguerra, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+senescent+cells+by+iodixanol+(OptiPrep)+density+gradient-based+separation.">Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation.</a> Cell Proliferation. 52, 12674 (2019).</li><li>Lock, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=versatile+manufacturing+of+recombinant+adeno-associated+viral+vectors+at+scale.">versatile manufacturing of recombinant adeno-associated viral vectors at scale.</a> Human Gene Therapy. 21, 1259-1271 (2010).</li><li>Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RELi+protocol:+Optimization+for+protein+extraction+from+white,+brown,+and+beige+adipose+tissues.">RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues.</a> MethodsX. 6, 918-928 (2019).</li><li>Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invited+Review:+effects+of+heat+and+cold+stress+on+mammalian+gene+expression.">Invited Review: effects of heat and cold stress on mammalian gene expression.</a> Journal of Applied Physiology. 92, 1725-1742 (2002).</li><li>Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+autonomous+myogenic+cell+populations+revealed+by+ablation+of+Myf5-expressing+cells+during+mouse+embryogenesis.">Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis.</a> Development. 135, 1597-1604 (2008).</li></ol>

इस अध्ययन में, जीन और प्रोटीन अभिव्यक्ति विश्लेषण के लिए बीए को अलग करने की एक नई विधि विकसित की गई थी।
एक प्रकाशित बीए अलगाव प्रोटोकॉल में, बीए12 को समृद्ध करने के लिए 3% बीएसए समाधान क?...

चूहों और मनुष्यों दोनों में दो प्रकार के वसा ऊतक होते हैं: सफेद वसा ऊतक (डब्ल्यूएटी) और भूरे रंग के वसा ऊतक (बीएटी)1। डब्ल्यूएटी सफेद एडिपोसाइट्स में ट्राइग्लिसराइड्स के रूप में ऊर्जा संग्रहीत करता है, और बीएटी के भूरे रंग के एडिपोसाइट्स (बीए) गर्मी2 के रूप में रासायनिक ऊर्जा को नष्ट करते हैं। उनके विकास की उत्पत्ति के आधार पर, बीए को आगे शास्त्रीय बीए (सीबीए) में वर्गीकृत किया जाता है जो भ्रूण के विकास के दौरान बनता है और सफेद एडिपोसाइट्स व्युत्पन्न बीए (बेज / ब्राइट कोशिकाएं, तनाव की स्थिति में सफेद एडिपोसाइट्स से परिवर्तित)3। बीए मल्टीलोकुलर हैं और थर्मोजेनिक प्रोटीन अनकपलिंग प्रोटीन 1 (यूसीपी 1)4 को व्यक्त करते हैं। इंटरस्केपुलर बैट (आईबीएटी) डिपो छोटे स्तनधारियों5 में प्राथमिक सीबीए डिपो में से एक है, जबकि बेज कोशिकाएं डब्ल्यूएटी6 के भीतर फैली हुई हैं। 
ऊर्जा को कम करने की उनकी प्रकृति के कारण, बीए को मोटापे को कम करने के लिए चिकित्सीय लक्ष्य के रूप में बहुत ध्यान दियागया है। मोटापे के इलाज के उद्देश्य से बीए का फायदा उठाने के लिए, आणविक तंत्र को समझना आवश्यक है जो बीए फ़ंक्शन, अस्तित्व और भर्ती को नियंत्रित करता है। बीएटी और डब्ल्यूएटी सहित वसा ऊतक विषम हैं। एडिपोसाइट्स को छोड़कर, वसा ऊतकों में कई अन्य सेल प्रकार होते हैं, जैसे एंडोथेलियल कोशिकाएं, मेसेनकाइमल स्टेम सेल और मैक्रोफेज8। यद्यपि चूहों बीए में विशेष रूप से उम्मीदवार जीन को कम करने के लिए आनुवंशिक उपकरण उपलब्ध हैं, जैसे कि यूसीपी 1:: क्रे लाइन9, बीएटी या डब्ल्यूएटी से बीए को शुद्ध करने की तकनीक सीमित है, जिससे एकल-कोशिका प्रकार के स्तर पर बीए का अध्ययन करना मुश्किल हो जाता है। इसके अतिरिक्त, शुद्ध बीए प्राप्त किए बिना, बीए और गैर-बीए के बीच संबंध स्पष्ट रूप से चित्रित नहीं होंगे। उदाहरण के लिए, प्लेटलेट-व्युत्पन्न विकास कारक रिसेप्टर अल्फा (पीडीजीएफआर) का उपयोग अविभाजित मेसेनकाइमल कोशिकाओं के लिए मार्कर के रूप में किया गया है, और यह बीएटी के एंडोथेलियल और अंतरालीय कोशिकाओं में व्यक्त किया जाता है। ठंडे तनावग्रस्त बीएटी में, पीडीजीएफआर सकारात्मक पूर्वज कोशिकाएं नए बीए10 को जन्म देती हैं। पीडीजीएफआर को इसके लिगैंड पीडीजीएफ द्वारा सक्रिय किया जाता है, एक विकास कारक जो मेसेनकाइमल कोशिकाओं के विकास और प्रसार को नियंत्रित करताहै 11; हालांकि, यह स्पष्ट नहीं है कि बीए पीडीजीएफ को स्रावित करके पीडीजीएफआर सकारात्मक पूर्वज कोशिकाओं के व्यवहार को प्रभावित करते हैं या नहीं। 
हाल ही में, एक बीए अलगाव प्रोटोकॉल प्रकाशित किया गया है, जो प्रतिदीप्ति-सक्रिय सेल सॉर्टिंग (एफएसीएस) 12 पर आधारित है। इस प्रोटोकॉल में, 3% गोजातीय सीरम एल्बुमिन (बीएसए) समाधान का उपयोग बीए को गैर-बीए से अलग करने के लिए किया गया था, और समृद्ध बीए को एफएसीएस द्वारा और शुद्ध किया गया था। इस प्रोटोकॉल का आवेदन एफएसीएस प्रक्रिया की आवश्यकता से सीमित है, जो उपकरण और एफएसीएस ऑपरेशन अनुभवों दोनों पर निर्भर करता है। इस अध्ययन में, बीएटी से बीए को अलग करने के लिए एक नया प्रोटोकॉल विकसित किया गया था। इस प्रोटोकॉल द्वारा अलग किए गए बीए का उपयोग सीधे जीन और प्रोटीन अभिव्यक्ति अध्ययन के लिए किया जा सकता है। इसके अलावा, इस अध्ययन के आंकड़ों से पता चलता है कि बीए एक प्रमुख पीडीजीएफ संसाधन हैं।

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antigen</td>
			<td>Company</td>
			<td>Catalog</td>
			<td></td>
		</tr>
		<tr>
			<td>PPAR&#947;</td>
			<td>LSBio</td>
			<td>Ls-C368478</td>
			<td></td>
		</tr>
		<tr>
			<td>PDGFRa</td>
			<td>Santa Cruz</td>
			<td>sc-398206</td>
			<td></td>
		</tr>
		<tr>
			<td>UCP1</td>
			<td>R&#38;D system</td>
			<td>IC6158P</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemical and solutions</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase, Type II</td>
			<td>Thermo Fisher Scientific</td>
			<td>17101015</td>
			<td></td>
		</tr>
		<tr>
			<td>1-Bromo-3-chloropropane</td>
			<td>Sigma-Aldrich</td>
			<td>B62404</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)&#160;</td>
			<td>Goldbio</td>
			<td>A-421-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride</td>
			<td>Bio Basic</td>
			<td>CT1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>IBI Scientific</td>
			<td>IB05040</td>
			<td></td>
		</tr>
		<tr>
			<td>Dispase II, protease</td>
			<td>Sigma-Aldrich</td>
			<td>D5693</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Bio Basic</td>
			<td>EB0107</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>IBI Scientific</td>
			<td>IB15724</td>
			<td></td>
		</tr>
		<tr>
			<td>LiQuant Universal Green qPCR Master Mix</td>
			<td>LifeSct</td>
			<td>LS01131905Y</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride Hexahydrate</td>
			<td>Boston BioProducts</td>
			<td>P-855</td>
			<td></td>
		</tr>
		<tr>
			<td>OneScrip Plus cDNA Synthesis SuperMix</td>
			<td>ABM</td>
			<td>G454</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep (Iodixanol)</td>
			<td>Cosmo Bio USA</td>
			<td>AXS-1114542</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x)</td>
			<td>Caisson Labs</td>
			<td>PBL07</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (1x)</td>
			<td>Caisson Labs</td>
			<td>PBL06</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce BCA Protein Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>23227</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Boston BioProducts</td>
			<td>P-1435</td>
			<td></td>
		</tr>
		<tr>
			<td>SimplyBlue safe Stain</td>
			<td>Invitrogen</td>
			<td>LC6060</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate (SDS)</td>
			<td>Sigma-Aldrich</td>
			<td>75746</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol reagent</td>
			<td>Life technoologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gene name (Species)&#160;</td>
			<td>Forward</td>
			<td>Reverse</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfra (Mouse)</td>
			<td>CTCAGCTGTCTCCTCACAgG</td>
			<td>CAACGCATCTCAGAGAAAAGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfa (Mouse)</td>
			<td>TGTGCCCATTCGCAGGAAGAG</td>
			<td>TTGGCCACCTTGACACTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>36B4(Mouse)</td>
			<td>TGCTGAACATCTCCCCCTTCTC</td>
			<td colspan="2">TCTCCACAGACAATGCCAGGAC</td>
		</tr>
		<tr>
			<td>Ucp1</td>
			<td>ACTGCCACACCTCCAGTCATT</td>
			<td>CTTTGCCTCACTCAGGATTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Application</td>
			<td></td>
		</tr>
		<tr>
			<td>Keyence BZ-X700</td>
			<td>Keyence</td>
			<td colspan="2">Imaging brown adipocytes</td>
		</tr>
		<tr>
			<td>Magnetic stirrer</td>
			<td>VWR</td>
			<td>Dissociate BAT</td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 6 Flex Real-Time PCR System</td>
			<td>Applied Biosystem</td>
			<td>Quantitative PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>The Odyssey Fc Imaging system</td>
			<td>LI-COR</td>
			<td>Western blot immaging</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis

ब्राउन एडीपोज ऊतक (बीएटी) स्तनधारियों में गैर-कंपकंपी थर्मोजेनेसिस के लिए जिम्मेदार है, और भूरे रंग के एडिपोसाइट्स (बीए) बीएटी की कार्यात्मक इकाइयां हैं। बीए में मल्टीलोकुलर लिपिड बूंदें और प्रचुर मात्रा में माइटोकॉन्ड्रिया दोनों होते हैं, और वे अनकपलिंग प्रोटीन 1 (यूसीपी 1) व्यक्त करते हैं। बीए को उनकी उत्पत्ति के आधार पर दो उप-प्रकारों में वर्गीकृत किया गया है: भ्रूण व्युत्पन्न शास्त्रीय बीए (सीबीए) और सफेद एडिपोसाइट्स व्युत्पन्न बीए। उनके अपेक्षाकृत कम घनत्व के कारण, बीए को पारंपरिक सेंट्रीफ्यूजेशन विधि के साथ बीएटी से अलग नहीं किया जा सकता है। इस अध्ययन में, जीन और प्रोटीन अभिव्यक्ति विश्लेषण के लिए चूहों से बीए को अलग करने के लिए एक नई विधि विकसित की गई थी। इस प्रोटोकॉल में, वयस्क चूहों से इंटरस्केपुलर बीएटी को कोलेजनेज और डिस्पेस समाधान के साथ पचाया गया था, और अलग किए गए बीए को 6% आयोडिक्सानोल समाधान से समृद्ध किया गया था। आरएनए, डीएनए और प्रोटीन के एक साथ अलगाव के लिए पृथक बीए को ट्राइज़ोल अभिकर्मक के साथ मिलाया गया था। आरएनए अलगाव के बाद, लाइसेट के कार्बनिक चरण का उपयोग प्रोटीन निष्कर्षण के लिए किया गया था। हमारे आंकड़ों से पता चला है कि 6% आयोडिक्सानोल समाधान ने अनुवर्ती जीन और प्रोटीन अभिव्यक्ति अध्ययनों में हस्तक्षेप किए बिना बीए को कुशलतापूर्वक समृद्ध किया। प्लेटलेट-व्युत्पन्न विकास कारक (पीडीजीएफ) एक विकास कारक है जो मेसेनकाइमल कोशिकाओं के विकास और प्रसार को नियंत्रित करता है। भूरे रंग के वसा ऊतक की तुलना में, पृथक बीए में पीडीजीएफए की काफी अधिक अभिव्यक्ति थी। सारांश में, यह नई विधि एकल सेल-प्रकार के स्तर पर भूरे रंग के एडिपोसाइट्स के जीव विज्ञान का अध्ययन करने के लिए एक मंच प्रदान करती है।

भूरे रंग के एडिपोसाइट्स अलगाव के लिए इंटरकैपुलर बैट की तैयारी भूरे रंग के एडिपोसाइट्स (बीए) अलगाव प्रक्रिया को चित्रा 1 ए में दर्शाया गया है। बीएटी और पाचन / पृथक्करण समाधान तैयार करन?...

Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

यह अध्ययन जीन और प्रोटीन अभिव्यक्ति विश्लेषण के लिए मुराइन ब्राउन एडिपोसाइट्स को अलग करने की एक नई विधि का वर्णन करता है।

जीन और प्रोटीन अभिव्यक्ति विश्लेषण के लिए मुराइन इंटरस्केपुलर ब्राउन एडीपोज ऊतक से ब्राउन एडिपोसाइट्स को अलग करना

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs ...

भूरे रंग के वसा ऊतक के जीव विज्ञान पहलुओं की जांच करने के लिए, शुद्ध भूरे रंग के वसा आकार को साफ करना आवश्यक है। वर्तमान में भूरे रंग के वसा आकार के शुद्धिकरण में कोई नहीं आया है और द्रव्यमान उपलब्ध हैं। इस अध्ययन में, हमने इस मुद्दे को संबोधित करने के लिए एक सीधा प्रोटोकॉल विकसित किया।अब, इस प्रोटोकॉल के लिए एक कौशल की आवश्यकता है। इसे अन्य तरीकों की तुलना में बहुत कम अध्ययन सामग्री की आवश्यकता होती है और शुद्ध भूरे रंग के वसा आकार का उपयोग सीधे जीन और प्रोटीन अभिव्यक्ति विश्लेषण के लिए किया जा सकता है। यह प्रोटोकॉल शास्त्रीय भूरे रंग के वसा आकार के जीव विज्ञान का अध्ययन करने के लिए एक नई विधि प्रदान करता है।इसे सफेद एडिपोसाइट्स ब्राउनिंग प्रक्रिया का अध्ययन करने के लिए भी लागू किया जा सकता है। प्रक्रिया का प्रदर्शन मेरी प्रयोगशाला से एक शोध सहायक अमांडा होगा। बैट और पाचन समाधान के साथ फ्लास्क को 30 मिनट के लिए 35 डिग्री सेल्सियस इनक्यूबेटर में 60 रोटेशन प्रति मिनट पर चुंबकीय हलचल पर रखकर शुरू करें।स्टिरर बार के चारों ओर बीएटी स्लाइस के समेकित ऊतक झुरमुट को बाधित करने के लिए एक मिलीलीटर पिपेट का उपयोग करें। पाचन के बाद, एक साफ 50 मिलीलीटर सेंट्रीफ्यूज ट्यूब के शीर्ष पर 70 माइक्रोमीटर छन्नी फ़िल्टर रखें और छन्नी के माध्यम से चार मिलीलीटर सेल निलंबन के आसपास पिपेट रखें। फिर इसे 12% आयोडिक्सानोल घोल के चार मिलीलीटर से धो लें।आयोडिक्सानोल समाधान के साथ कोशिकाओं को मिलाने के लिए पिपेट ऊपर और नीचे फिर सेल मिश्रण को दो स्पष्ट पांच मिलीलीटर पॉलीस्टीरिन टेस्ट ट्यूबों में स्थानांतरित करें। सेल मिश्रण वाले पॉलीस्टाइनिन ट्यूबों को एक घंटे के लिए बर्फ पर रखें, जिससे बीए शीर्ष पर एक परत बनाते हैं। माइक्रोस्कोप जांच के लिए पृथक बीए के 20 माइक्रोलीटर निकालें।आरएनए और प्रोटीन अलगाव के लिए, बीए परत को दो 1.7 मिलीलीटर माइक्रोसेंटरफ्यूज ट्यूबों में विभाजित करें। फिर बीए परत को बाधित किए बिना अत्यधिक आयोडिक्सोनल समाधान को सावधानीपूर्वक हटा दें। फिर आरएनए, डीएनए और प्रोटीन को एक साथ अलग करने के लिए सेल समाधान में एक मिलीलीटर टीआरआइज़ोल जोड़ें और कोशिकाओं को अलग करने के लिए पर्याप्त रूप से मिलाएं।चरणों को अलग करने के लिए, चार डिग्री सेल्सियस पर 10 मिनट के लिए 9,981 ग्राम पर ट्यूब में क्लोरोफॉर्म और सेंट्रीफ्यूज के 200 माइक्रोलीटर जोड़ें। सेंट्रीफ्यूजेशन के बाद, आरएनए अलगाव के लिए जलीय चरण का उपयोग करें। कार्बनिक चरण के 300 माइक्रोलीटर को दो मिलीलीटर माइक्रोसेंट्रीफ्यूज ट्यूब में स्थानांतरित करें और 100% इथेनॉल के 750 माइक्रोलीटर जोड़ें।10 सेकंड के लिए भंवर के बाद, 10 सेकंड के लिए फिर से 1-ब्रोमो -3-क्लोरोप्रोपेन और भंवर के 200 माइक्रोलीटर जोड़ें। 10 सेकंड के लिए भंवर से पहले डबल डिस्टिल्ड पानी के 600 माइक्रोलीटर जोड़ें। मिश्रित घोल को कमरे के तापमान पर 10 मिनट तक खड़े रहने दें।सेंट्रीफ्यूजेशन के बाद, चार डिग्री सेल्सियस पर 10 मिनट के लिए 9,981 ग्राम जोड़ें। चरणों को मध्य परत में स्थानीयकृत प्रोटीन चरण के साथ अलग किया जाएगा। शीर्ष जलीय घोल को निकालें और शेष घोल में 100% इथेनॉल का एक मिलीलीटर जोड़ें।चार डिग्री सेल्सियस पर 10 मिनट के लिए 9,981 ग्राम पर सेंट्रीफ्यूजेशन के बाद, सतह पर तैरने वाले को छोड़ दें और 100% इथेनॉल के एक मिलीलीटर के साथ गोली धो लें। सेंट्रीफ्यूज 9,981 ग्राम पर 10 मिनट के लिए चार डिग्री सेल्सियस पर। सतह पर तैरने वाले को हटाने के बाद, कमरे के तापमान पर 10 मिनट के लिए गोली को हवा में सुखाएं और गीली गोली के वजन को मापें।20 माइक्रोलीटर प्रति मिलीग्राम पेलेट के अनुपात में 1% एसडीएस समाधान जोड़ें। पांच से 10 मिनट के लिए ट्यूब को 55 डिग्री सेल्सियस और 11 ग्राम पर गर्म शेकर में डालकर गोली को पूरी तरह से घोल दें। प्रोटोकॉल में, बीएटी से बीए को अलग करने के लिए 3% बीएसए युक्त पीबीएस का उपयोग किया गया था।पृथक कोशिकाएं रास्पबेरी के आकार की थीं, जिनके अंदर मल्टीओकुलर लिपिड बूंदें थीं और टीडीओएम पॉजिटिव थीं, जिससे पुष्टि होती है कि वे बीए थे। प्रोटीन को एक बेहतर जीटीपीसी प्रोटोकॉल के साथ बीए से अलग किया गया था और फिर एसडीएस-पेज जेल के साथ जांच की गई थी। बीए नमूने में बीएसए से जुड़ा एक प्रमुख बैंड देखा गया था, जो प्रोटीन निष्कर्षण में इसके हस्तक्षेप का सुझाव देता है।बीएसए हस्तक्षेप से बचने के लिए, बीए के अलगाव के लिए 6% आयोडिक्सोनल समाधान का उपयोग किया गया था, जिसमें एक विशिष्ट रास्पबेरी आकार था और इसमें मल्टीलोकुलर लिपिड बूंदें थीं। इन बीए से निकाले गए प्रोटीन को एसडीएस-पेज जेल में अच्छी तरह से अलग किया गया था। इन कोशिकाओं को टीडीटोमेटो पॉजिटिव पाया गया, जबकि गोली से बरामद कोशिकाएं बिना किसी स्पष्ट लिपिड बूंदों के साथ टीडीटोमाटो नकारात्मक थीं, जो गैर-वसा कोशिकाओं से बीए के कुशल पृथक्करण का सुझाव देती हैं।जीन अभिव्यक्ति विश्लेषण में, यूसीपी 1 और पीडीजीएफए के एमआरएनए स्तर पृथक बीए में काफी अधिक थे। लेकिन पीडीजीएफआरए के एमआरएनए का पता केवल बीएटी में लगाया गया था। यूसीपी 1 प्रोटीन पृथक बीए में समृद्ध पाया गया था।ईडीजीएफआर अल्फा बैट में पाया गया था, लेकिन पृथक बीए में नहीं। ये परिणाम बीए को अलग करने के लिए विधि की दक्षता की पुष्टि करते हैं और प्रदर्शित करते हैं कि पृथक बीए जीन और प्रोटीन अभिव्यक्ति अध्ययन के लिए उपयुक्त हैं। इस प्रोटोकॉल का प्रयास करते समय, भूरे रंग के वसा ऊतक को अलग करने और पाचन अवधि के दौरान ऊतक झुरमुट गठन से बचने के लिए ताजा पाचन बफर का उपयोग करें।यह नई विधि एकल सेल नल स्तर पर भूरे रंग के वसा ऊतक के जीव विज्ञान की जांच करना आसान बनाती है। इस विधि को लागू करके, कोई भी शुद्ध भूरे रंग के एडिपोसाइट्स के साथ जीएन और प्रोटीन अभिव्यक्ति अध्ययन कर सकता है, जो मूल रूप से नॉनफैट कोशिकाओं से संदूषण के बारे में चिंता किए बिना भूरे रंग के एडिपोसाइट्स जीन अभिव्यक्ति कार्यक्रम को ठीक से विच्छेदित करता है।

Research

JoVE Journal

Immunology and Infection

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with &beta;-arrestin

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with ÃƒÅ½Ã‚Â²-arrestin

Leukotriene बी के वास्तविक समय इमेजिंग 4 मध्यस्थता सेल प्रवासन और β-arrestin साथ BLT1 सहभागिता

G-protein coupled receptors (GPCRs) belong to the seven transmembrane protein family and mediate the transduction of extracellular signals to ...

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Bioluminescent इमेजिंग बीच योगवाहिता जांच स्ट्रैपटोकोकस निमोनिया इन्फ्लुएंजा और शिशु चूहे में एक वायरस

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

माउस बृहदांत्रशोथ में इम्यून और गैर प्रतिरक्षा कोशिकाओं से अस्थि मज्जा प्रत्यारोपण द्वारा जीन एक्सप्रेशन के कार्यात्मक भूमिका फर्क

To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice ...

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

अलग और immunostaining लिम्फोसाइटों और murine Peyer पैच से वृक्ष के समान कोशिकाओं

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Isolation of Adipose Tissue Immune Cells

वसा ऊतकों प्रतिरक्षा कोशिकाओं के अलगाव

The discovery of increased macrophage infiltration in  the adipose tissue (AT) of obese rodents and humans has led to an  intensification of interest in ...

Isolation of Murine Peritoneal Macrophages to Carry Out Gene Expression Analysis Upon Toll-like Receptors Stimulation

Murine पेरिटोनियल मैक्रोफेज के अलगाव टोल की तरह रिसेप्टर्स उत्तेजना पर जीन एक्सप्रेशन विश्लेषण बाहर ले जाने के लिए

During infection and inflammation, circulating monocytes leave the bloodstream and migrate into tissues, where they differentiate into macrophages. ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

जांच के लिए गुणात्मक और मात्रात्मक assays और प्रोटीन antimicrobials की विशेषता

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

एचआईवी -1 संक्रमित कोशिकाओं से Exosomes की SILAC आधारित प्रोटिओमिक विशेषता

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can ...

Isolating Lymphocytes from the Mouse Small Intestinal Immune System

अलग माउस से लिम्फोसाइटों छोटे आंत्र प्रतिरक्षा प्रणाली

The intestinal immune system plays an essential role in maintaining the barrier function of the gastrointestinal tract by generating tolerant responses to ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

अलगाव, विस्तार, और मानव Omental और चमड़े के नीचे वसा ऊतक से CD34 + CD31 + Endothelial कोशिकाओं के Adipogenic प्रेरण

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...