Name: isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis
Uploaded: 2021-03-12T14:30:00
Description: Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Z. Lin은 National Institutes of Health HL138454-01 및 Masonic Medical Research Institute 기금의 지원을 받았습니다.

모든 마우스는 병원체가없는 상태로 유지되었으며 모든 절차는 프리메이슨 의학 연구 기관 동물 관리 및 사용위원회 (IACUC)의 승인을 받았습니다. UCP1::Cre9 및 Rosa 26td토마토 마우스 라인13 이 이전에 보고되었다. 모든 마우스는 12 시간의 명암 주기로 실온에서 유지되었다.
1. 용액 및 갈색 지방 조직 (BAT) 준비
<ol><li>15mL 원심분리 튜?...

<ol>
	<li>Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anatomical,+physiological,+and+functional+diversity+of+adipose+tissue.">Anatomical, physiological, and functional diversity of adipose tissue.</a> Cell Metabolism. 27, 68-83 (2018).</li><li>Symonds, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue+growth+and+development.">Brown adipose tissue growth and development.</a> Scientifica. 2013, 305763 (2013).</li><li>Giralt, M., Villarroya, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=White,+brown,+beige/brite:+Different+adipose+cells+for+different+functions.">White, brown, beige/brite: Different adipose cells for different functions.</a> Endocrinology. 154, 2992-3000 (2013).</li><li>Cannon, B., Nedergaard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+adipose+tissue:+function+and+physiological+significance.">Brown adipose tissue: function and physiological significance.</a> Physiological Reviews. 84, 277-359 (2004).</li><li>Cinti, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adipose+organ.">The adipose organ.</a> Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beige+adipocytes+are+a+distinct+type+of+thermogenic+fat+cell+in+mouse+and+human.">Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.</a> Cell. 150, 366-376 (2012).</li><li>Cypess, A. M., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brown+fat+as+a+therapy+for+obesity+and+diabetes.">Brown fat as a therapy for obesity and diabetes.</a> Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).</li><li>Schoettl, T., Fischer, I. P., Ussar, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+adipose+tissue+in+development+and+metabolic+function.">Heterogeneity of adipose tissue in development and metabolic function.</a> Journal of Experimental Biology. 221, (2018).</li><li>Kong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+is+a+key+thermogenic+transcriptional+partner+of+PGC-1&#945;.">IRF4 is a key thermogenic transcriptional partner of PGC-1&#945;.</a> Cell. 158, 69-83 (2014).</li><li>Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+origins+of+cold-induced+brown+adipocytes+in+adult+mice.">Cellular origins of cold-induced brown adipocytes in adult mice.</a> The FASEB Journal. 29, 286-299 (2015).</li><li>Kim, W. -. S., Park, H. -. S., Sung, J. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pivotal+role+of+PDGF+and+its+receptor+isoforms+in+adipose-derived+stem+cells.">The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells.</a> Histology and Histopathology. 30 (7), 793-799 (2015).</li><li>Hagberg, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+mouse+and+human+adipocytes+for+the+analysis+of+browning+and+cellular+heterogeneity.">Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity.</a> Cell Report. 24, 2746-2756 (2018).</li><li>Madisen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+high-throughput+Cre+reporting+and+characterization+system+for+the+whole+mouse+brain.">A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.</a> Nature Neuroscience. 13, 133-140 (2010).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Chey, S., Claus, C., Liebert, U. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+simultaneous+isolation+of+proteins+and+nucleic+acids.">Improved method for simultaneous isolation of proteins and nucleic acids.</a> Analytical Biochemistry. 411, 164-166 (2011).</li><li>Ford, T., Graham, J., Rickwood, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iodixanol:+A+nonionic+iso-osmotic+centrifugation+medium+for+the+formation+of+self-generated+gradients.">Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients.</a> Analytical Biochemistry. 220, 360-366 (1994).</li><li>Kovacovicova, K., Vinciguerra, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+senescent+cells+by+iodixanol+(OptiPrep)+density+gradient-based+separation.">Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation.</a> Cell Proliferation. 52, 12674 (2019).</li><li>Lock, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=versatile+manufacturing+of+recombinant+adeno-associated+viral+vectors+at+scale.">versatile manufacturing of recombinant adeno-associated viral vectors at scale.</a> Human Gene Therapy. 21, 1259-1271 (2010).</li><li>Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RELi+protocol:+Optimization+for+protein+extraction+from+white,+brown,+and+beige+adipose+tissues.">RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues.</a> MethodsX. 6, 918-928 (2019).</li><li>Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invited+Review:+effects+of+heat+and+cold+stress+on+mammalian+gene+expression.">Invited Review: effects of heat and cold stress on mammalian gene expression.</a> Journal of Applied Physiology. 92, 1725-1742 (2002).</li><li>Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+autonomous+myogenic+cell+populations+revealed+by+ablation+of+Myf5-expressing+cells+during+mouse+embryogenesis.">Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis.</a> Development. 135, 1597-1604 (2008).</li></ol>

이 연구에서는 유전자 및 단백질 발현 분석을 위해 BA를 분리하는 새로운 방법이 개발되었습니다.
공개된 BA 격리 프로토콜에서, 3% BSA 용액은 BAs12를 풍부하게 하기 위해 사용되었다. 그럼에도 불구하고, 이 공개된 프로토콜에 의해 달성된 농축 BA는 단백질 발현 분석에 직접 사용될 수 없었다. 이는 BAs 용액에 존재하는 농축된 BSA가 후속 단백질 추출을 방해하?...

생쥐와 인간 모두 백색 지방 조직(WAT)과 갈색 지방 조직(BAT)의 두 가지 유형의 지방 조직을 가지고 있습니다.1. WAT는 백색 지방 세포에 트리글리세리드 형태로 에너지를 저장하고 BAT의 갈색 지방 세포 (BA)는 화학 에너지를 열2로 발산합니다. 발달 기원에 따라 BA는 배아 발달 중에 형성된 고전 BA(cBA)와 백색 지방세포 유래 BA(베이지/브라이트 세포, 스트레스 조건에서 백색 지방세포에서 전환)3로 더 분류됩니다. BA는 다안선이며 열 발생 단백질 결합 해제 단백질 1 (UCP1)4을 발현합니다. 견갑간 BAT (iBAT) 저장소는 작은 포유류5의 1 차 cBA 저장소 중 하나 인 반면, 베이지 색 세포는 WAT6 내에 분산되어 있습니다. 
BA는 에너지를 발산하는 특성으로 인해 비만을 줄이기 위한 치료 표적으로 많은 주목을 받고 있습니다7. 비만 치료 목적으로 BA를 이용하려면 BA 기능, 생존 및 모집을 제어하는 분자 메커니즘을 이해하는 것이 필수적입니다. BAT 및 WAT를 포함한 지방 조직은 이질적입니다. 지방 세포를 제외하고, 지방 조직은 내피 세포, 중간엽 줄기 세포 및 대식세포와 같은 많은 다른 세포 유형을 함유한다8. UCP1::Cre line9와 같이 마우스 BA에서 후보 유전자를 특이적으로 고갈시키는 유전 도구를 사용할 수 있지만 BAT 또는 WAT에서 BA를 정제하는 기술은 제한적이어서 단일 세포 유형 수준에서 BA를 연구하기가 어렵습니다. 또한 순수 BA를 취득하지 않으면 BA와 비 BA 간의 관계가 명확하게 설명되지 않습니다. 예를 들어, 혈소판 유래 성장 인자 수용체 알파 (PDGFRα)는 미분화 중간 엽 세포의 마커로 사용되어 왔으며 BAT의 내피 및 간질 세포에서 발현됩니다. 저온 스트레스 BAT에서, PDGFRα 양성 전구 세포는 새로운 BAs10을 생성한다. PDGFRα는 그의 리간드 PDGF에 의해 활성화되고, 중간엽 세포의 성장 및 증식을 조절하는 성장 인자11; 그러나, BA가 PDGF를 분비함으로써 PDGFRα 양성 전구 세포의 행동에 영향을 미치는지는 불분명하다. 
최근에는 형광 활성화 세포 분류(FACS)12를 기반으로 하는 BA 분리 프로토콜이 발표되었습니다. 이 프로토콜에서, 3% 소 혈청 알부민(BSA) 용액을 사용하여 BA를 비-BA로부터 분리하고, 농축된 BA를 FACS에 의해 추가로 정제하였다. 이 프로토콜의 적용은 장비 및 FACS 운영 경험에 모두 의존하는 FACS 프로세스의 요구 사항에 의해 제한됩니다. 이 연구에서는 BAT에서 BA를 분리하기 위한 새로운 프로토콜이 개발되었습니다. 이 프로토콜에 의해 분리된 BA는 유전자 및 단백질 발현 연구에 직접 사용할 수 있습니다. 또한이 연구의 데이터는 BA가 주요 PDGF 자원임을 시사합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Antigen</td>
			<td>Company</td>
			<td>Catalog</td>
			<td></td>
		</tr>
		<tr>
			<td>PPAR&#947;</td>
			<td>LSBio</td>
			<td>Ls-C368478</td>
			<td></td>
		</tr>
		<tr>
			<td>PDGFRa</td>
			<td>Santa Cruz</td>
			<td>sc-398206</td>
			<td></td>
		</tr>
		<tr>
			<td>UCP1</td>
			<td>R&#38;D system</td>
			<td>IC6158P</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemical and solutions</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase, Type II</td>
			<td>Thermo Fisher Scientific</td>
			<td>17101015</td>
			<td></td>
		</tr>
		<tr>
			<td>1-Bromo-3-chloropropane</td>
			<td>Sigma-Aldrich</td>
			<td>B62404</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)&#160;</td>
			<td>Goldbio</td>
			<td>A-421-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride</td>
			<td>Bio Basic</td>
			<td>CT1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>IBI Scientific</td>
			<td>IB05040</td>
			<td></td>
		</tr>
		<tr>
			<td>Dispase II, protease</td>
			<td>Sigma-Aldrich</td>
			<td>D5693</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Bio Basic</td>
			<td>EB0107</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>IBI Scientific</td>
			<td>IB15724</td>
			<td></td>
		</tr>
		<tr>
			<td>LiQuant Universal Green qPCR Master Mix</td>
			<td>LifeSct</td>
			<td>LS01131905Y</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride Hexahydrate</td>
			<td>Boston BioProducts</td>
			<td>P-855</td>
			<td></td>
		</tr>
		<tr>
			<td>OneScrip Plus cDNA Synthesis SuperMix</td>
			<td>ABM</td>
			<td>G454</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep (Iodixanol)</td>
			<td>Cosmo Bio USA</td>
			<td>AXS-1114542</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x)</td>
			<td>Caisson Labs</td>
			<td>PBL07</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (1x)</td>
			<td>Caisson Labs</td>
			<td>PBL06</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce BCA Protein Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>23227</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Boston BioProducts</td>
			<td>P-1435</td>
			<td></td>
		</tr>
		<tr>
			<td>SimplyBlue safe Stain</td>
			<td>Invitrogen</td>
			<td>LC6060</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate (SDS)</td>
			<td>Sigma-Aldrich</td>
			<td>75746</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol reagent</td>
			<td>Life technoologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gene name (Species)&#160;</td>
			<td>Forward</td>
			<td>Reverse</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfra (Mouse)</td>
			<td>CTCAGCTGTCTCCTCACAgG</td>
			<td>CAACGCATCTCAGAGAAAAGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Pdgfa (Mouse)</td>
			<td>TGTGCCCATTCGCAGGAAGAG</td>
			<td>TTGGCCACCTTGACACTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>36B4(Mouse)</td>
			<td>TGCTGAACATCTCCCCCTTCTC</td>
			<td colspan="2">TCTCCACAGACAATGCCAGGAC</td>
		</tr>
		<tr>
			<td>Ucp1</td>
			<td>ACTGCCACACCTCCAGTCATT</td>
			<td>CTTTGCCTCACTCAGGATTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Application</td>
			<td></td>
		</tr>
		<tr>
			<td>Keyence BZ-X700</td>
			<td>Keyence</td>
			<td colspan="2">Imaging brown adipocytes</td>
		</tr>
		<tr>
			<td>Magnetic stirrer</td>
			<td>VWR</td>
			<td>Dissociate BAT</td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 6 Flex Real-Time PCR System</td>
			<td>Applied Biosystem</td>
			<td>Quantitative PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>The Odyssey Fc Imaging system</td>
			<td>LI-COR</td>
			<td>Western blot immaging</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolating brown adipocytes from murine interscapular brown adipose tissue for gene and protein expression analysis

갈색 지방 조직 (BAT)은 포유류에서 떨리지 않는 열 발생을 담당하며 갈색 지방 세포 (BA)는 BAT의 기능 단위입니다. BA는 다안 지질 방울과 풍부한 미토콘드리아를 모두 포함하며 결합 해제 단백질 1 (UCP1)을 발현합니다. BA는 기원에 따라 배아 유래 고전 BA(cBA)와 백색 지방 세포 유래 BA의 두 가지 하위 유형으로 분류됩니다. 상대적으로 밀도가 낮기 때문에 BA는 전통적인 원심분리 방법으로 BAT에서 분리할 수 없습니다. 이 연구에서는 유전자 및 단백질 발현 분석을 위해 마우스에서 BA를 분리하는 새로운 방법이 개발되었습니다. 이 프로토콜에서, 성인 마우스로부터의 interscapular BAT를 Collagenase 및 Dispase 용액으로 분해하고, 해리 된 BA를 6 % 요오 딕산 올 용액으로 풍부하게했다. 그런 다음 분리된 BA를 트리졸 시약으로 용해시켜 RNA, DNA 및 단백질을 동시에 분리했습니다. RNA 분리 후, 용해물의 유기상을 단백질 추출에 사용하였다. 우리의 데이터는 6% 요오드 딕산올 용액이 후속 유전자 및 단백질 발현 연구를 방해하지 않으면서 BA를 효율적으로 농축한다는 것을 보여주었습니다. 혈소판 유래 성장 인자 (PDGF)는 중간 엽 세포의 성장과 증식을 조절하는 성장 인자입니다. 갈색 지방 조직과 비교하여 분리 된 BA는 Pdgfa의 발현이 상당히 높았습니다. 요약하면,이 새로운 방법은 단일 세포 유형 수준에서 갈색 지방 세포의 생물학을 연구하기위한 플랫폼을 제공합니다.

갈색 지방세포 분리를 위한 개간골 BAT의 제조 갈색 지방세포(BA) 분리 과정은 도 1A에 도시되어 있다. BAT 및 분해/분리 용액 준비에서 분리 BA 획득에 이르기까지 전체 프로세스는 약 4시간이 소요됩니다.
성인 마우스에서는 견갑골 간 영역에 풍부한 BAT가 존재합니다. 이 견갑간 BAT(iBAT)는 근육층과 WAT로 덮여 있습니다(그림 1B<...

Watch this Scientific Journal Video about Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis at JoVE.com

Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

이 연구는 유전자 및 단백질 발현 분석을 위해 쥐 갈색 지방 세포를 분리하는 새로운 방법을 설명합니다.

유전자 및 단백질 발현 분석을 위해 쥐 견갑골 갈색 지방 조직에서 갈색 지방 세포 분리

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs ...

갈색 지방 조직의 생물학적 측면을 조사하려면 정제된 갈색 지방 크기를 제거하는 것이 필수적입니다. 현재 갈색 지방 크기 정제가 제공되지 않았으며 질량을 사용할 수 있습니다. 이 연구에서는 이 문제를 해결하기 위한 간단한 프로토콜을 개발했습니다.이제 이 프로토콜에 한 가지 기술이 필요합니다. 다른 방법보다 훨씬 적은 연구 재료가 필요하며 정제 된 갈색 지방 크기는 유전자 및 단백질 발현 분석에 직접 사용할 수 있습니다. 이 프로토콜은 고전적인 갈색 지방 크기의 생물학을 연구하는 새로운 방법을 제공합니다.백색 지방 세포 갈변 과정을 연구하는 데에도 적용 할 수 있습니다. 절차를 시연하는 것은 내 실험실의 연구 조교 인 Amanda가 될 것입니다. BAT와 소화 용액이 담긴 플라스크를 섭씨 35도 인큐베이터에서 분당 60회전으로 자석 교반기에 30분 동안 두는 것으로 시작합니다.1 밀리리터 피펫을 사용하여 교반기 바 주변의 BAT 슬라이스의 응집 된 조직 덩어리를 방해하십시오. 분해 후 깨끗한 50밀리리터 원심분리 튜브 위에 70마이크로미터 여과기 필터를 놓고 스트레이너를 통해 약 4밀리리터의 세포 현탁액을 피펫으로 만듭니다. 그런 다음 4 밀리리터의 12 % 요오드 딕산올 용액으로 씻으십시오.세포를 요오드 잔산 용액과 혼합하기 위해 위아래로 피펫 한 다음 세포 혼합물을 두 개의 투명한 5 밀리리터 폴리스티렌 시험관으로 옮깁니다. 셀 혼합물이 들어있는 폴리스티렌 튜브를 얼음 위에 1 시간 동안 놓아 BA가 상단에 층을 형성하도록합니다. 현미경 검사를 위해 분리된 BA 20마이크로리터를 꺼냅니다.RNA 및 단백질 분리를 위해 BA 층을 두 개의 1.7 밀리리터 마이크로 센터 퓨지 튜브에 피펫팅합니다. 그런 다음 BA 층을 손상시키지 않고 과도한 요오드 용액을 조심스럽게 제거하십시오. 그런 다음 1밀리리터의 TRIzol을 세포 용액에 첨가하여 RNA, DNA 및 단백질을 동시에 분리하고 세포를 용해시키기에 충분히 혼합합니다.상을 분리하려면 섭씨 4도에서 10 분 동안 9, 981 G의 튜브에 200 마이크로 리터의 클로로포름과 원심 분리기를 첨가하십시오. 원심분리 후, RNA 분리를 위해 수성 상을 사용한다. 300 마이크로 리터의 유기상을 2 밀리리터 마이크로 원심 분리 튜브로 옮기고 750 마이크로 리터의 100 % 에탄올을 첨가하십시오.10 초 동안 볼텍싱 한 후 200 마이크로 리터의 1- 브로 모 -3- 클로로 프로판을 넣고 10 초 동안 다시 와동시킵니다. 10초 동안 볼텍싱하기 전에 600마이크로리터의 이중 증류수를 추가합니다. 혼합 용액을 실온에서 10 분 동안 그대로 두십시오.원심 분리 후 섭씨 4도에서 10 분 동안 9, 981G을 첨가하십시오. 단계는 중간층에 국한된 단백질 상과 분리됩니다. 상단 수용액을 제거하고 나머지 용액에 100 % 에탄올 1 밀리리터를 첨가하십시오.섭씨 4도에서 10 분 동안 9, 981 G에서 원심 분리 한 후, 상청액을 버리고 100 % 에탄올 1 밀리리터로 펠렛을 세척한다. 섭씨 4도에서 10 분 동안 9, 981G에서 원심 분리기. 상층액을 제거한 후, 펠렛을 실온에서 10분 동안 자연 건조시키고 습윤 펠렛의 무게를 측정하였다.펠릿 밀리그램 당 1 마이크로 리터의 비율로 20 % SDS 용액을 첨가하십시오. 튜브를 섭씨 55도 및 11G의 가열 셰이커에 5-10분 동안 넣어 펠릿을 완전히 녹입니다. 프로토콜에서 3%BSA를 포함하는 PBS는 BAT에서 BA를 분리하는 데 사용되었습니다.분리된 세포는 내부에 다안 지질 방울이 있는 라즈베리 모양이었고 tdTom 양성으로 BA임을 확인했습니다. 단백질을 개선된 GTPC 프로토콜로 BAs로부터 분리한 다음, SDS-PAGE 겔로 검사하였다. BSA와 관련된 우성 밴드가 BA 샘플에서 관찰되었으며, 이는 단백질 추출에 대한 간섭을 시사합니다.BSA 간섭을 피하기 위해 전형적인 라즈베리 모양을 갖고 다안 지질 방울을 포함하는 BA의 분리를 위해 6% 요오드 용액을 사용했습니다. 이들 BA로부터 추출된 단백질은 SDS-PAGE 겔에서 잘 분리되었다. 이 세포는 tdTomato 양성인 반면 펠릿에서 회수된 세포는 명백한 지질 방울이 없는 tdTomato 음성으로 밝혀졌으며, 이는 비지방 세포에서 BA를 효율적으로 분리함을 시사합니다.유전자 발현 분석에서, UCP1 및 PDGFA의 mRNA 수준은 단리된 BA에서 유의하게 더 높았다. 그러나 PDGFRA의 mRNA는 BAT에서만 검출되었습니다. UCP1 단백질은 분리된 BA에서 풍부하게 발견되었다.EDGFR 알파는 BAT에서 검출되었지만 분리 된 BA에서는 검출되지 않았습니다. 이러한 결과는 BA를 분리하는 방법의 효율성을 확인하고 분리된 BA가 유전자 및 단백질 발현 연구에 적합하다는 것을 입증합니다. 이 프로토콜을 시도할 때 신선한 소화 완충액을 사용하여 갈색 지방 조직을 해리하고 소화 기간 동안 조직 덩어리 형성을 피하십시오.이 새로운 방법을 사용하면 단일 세포 탭 수준에서 갈색 지방 조직의 생물학을 쉽게 조사 할 수 있습니다. 이 방법을 적용하면 원래 무지방 세포에서 오염에 대한 걱정 없이 갈색 지방 세포 유전자 발현 프로그램을 정밀하게 해부하는 순수한 갈색 지방 세포로 GN 및 단백질 발현 연구를 수행할 수 있습니다.

Research

JoVE Journal

Immunology and Infection

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with &beta;-arrestin

Real-time Imaging of Leukotriene B4 Mediated Cell Migration and BLT1 Interactions with ÃƒÅ½Ã‚Â²-arrestin

Leukotriene B의 실시간 영상 4 중재 셀 마이 그 레이션 및 β - arrestin로 BLT1 상호 작용

G-protein coupled receptors (GPCRs) belong to the seven transmembrane protein family and mediate the transduction of extracellular signals to ...

연구

면역학 및 감염병학

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

Using Bioluminescent Imaging to Investigate Synergism Between Streptococcus pneumoniae and Influenza A Virus in Infant Mice

사이 Synergism을 맡은 이후로 발광 생물 이미징을 사용하여 연쇄상 구균 pneumoniae</em유아 마우스에서>와 인플루엔자 바이러스

During the 1918 influenza virus pandemic, which killed approximately 50 million people worldwide, the majority of fatalities were not the result of ...

Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

골수 이식으로 마우스 대장염에서 면역 및 비 면역 세포에서 유전자 발현의 기능 역할을 차별화

To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice ...

Isolating And Immunostaining Lymphocytes and Dendritic Cells from Murine Peyer's Patches

림프구와 손쥐 Peyer의 패치에서 수지상 세포를 분리하고 Immunostaining

Peyer's  patches (PPs) are integral components of the gut-associated lymphoid tissues  (GALT) and play a central role in intestinal immunosurveillance and ...

Isolation of Adipose Tissue Immune Cells

지방 조직 면역 세포의 분리

The discovery of increased macrophage infiltration in  the adipose tissue (AT) of obese rodents and humans has led to an  intensification of interest in ...

Isolation of Murine Peritoneal Macrophages to Carry Out Gene Expression Analysis Upon Toll-like Receptors Stimulation

쥐 복막 대 식세포의 분리는 수신자 같은 수용체 자극하면 유전자 발현 분석을 수행하기

During infection and inflammation, circulating monocytes leave the bloodstream and migrate into tissues, where they differentiate into macrophages. ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

정성 및 정량 검출을위한 시험 법 및 단백질 항생제 특성

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

HIV-1에 감염된 세포에서 엑소 좀의 SILAC 기반 단백체 특성

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can ...

Isolating Lymphocytes from the Mouse Small Intestinal Immune System

마우스 작은 장의 면역 시스템에서 세포를 분리

The intestinal immune system plays an essential role in maintaining the barrier function of the gastrointestinal tract by generating tolerant responses to ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

절연, 확장, 및 Adipogenic CD34 + CD31 + 인간의 Omental 및 피하 지방 조직에서 내 피 세포의 유도

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...