Name: dna tension probes to map the transient piconewton receptor forces by immune cells
Uploaded: 2021-03-20T15:00:00
Description: Watch this Scientific Journal Video about DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells at JoVE.com

تم دعم هذا العمل من قبل منح المعاهد الوطنية للصحة R01GM131099 و NIH R01GM124472 و NSF CAREER 1350829. نشكر مرفق المعاهد الوطنية للصحة Tetramer على روابط pMHC. تم دعم هذه الدراسة ، جزئيا ، من قبل Emory Comprehensive Glycomics Core.

توجد الفئران المعدلة وراثيا OT-1 في قسم مرفق الموارد الحيوانية في جامعة إيموري. تمت الموافقة على جميع التجارب وتنفيذها بموجب بروتوكول اللجنة المؤسسية لرعاية واستخدام الحيوان (IACUC).
1. إعداد قليل النوكليوتيد
<ol><li>قم بإذابة الحمض النووي لشريط الليجند في الماء (مقاومة 18.2 MΩ ، الم...

<ol>
	<li>Dustin, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T-cell+activation+through+immunological+synapses+and+kinapses.">T-cell activation through immunological synapses and kinapses.</a> Immunological Reviews. 221 (1), 77-89 (2008).</li><li>Spillane, K. M., Tolar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cell+antigen+extraction+is+regulated+by+physical+properties+of+antigen-presenting+cells.">B cell antigen extraction is regulated by physical properties of antigen-presenting cells.</a> Journal of Cell Biology. 216 (1), 217-230 (2017).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanosensing+drives+acuity+of+&#945;&#946;+T-cell+recognition.">Mechanosensing drives acuity of &#945;&#946; T-cell recognition.</a> Proceedings of the National Academy of Sciences. 114 (39), 8204-8213 (2017).</li><li>Hong, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TCR+mechanotransduction+signaling+loop+induces+negative+selection+in+the+thymus.">A TCR mechanotransduction signaling loop induces negative selection in the thymus.</a> Nature Immunology. 19 (12), 1379-1390 (2018).</li><li>Basu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytotoxic+T+cells+use+mechanical+force+to+potentiate+target+cell+killing.">Cytotoxic T cells use mechanical force to potentiate target cell killing.</a> Cell. 165 (1), 100-110 (2016).</li><li>Bashour, K. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD28+and+CD3+have+complementary+roles+in+T-cell+traction+forces.">CD28 and CD3 have complementary roles in T-cell traction forces.</a> Proceedings of the National Academy of Sciences. 111 (6), 2241-2246 (2014).</li><li>Ma, V. P. Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+nanotechnology+as+an+emerging+tool+to+study+mechanotransduction+in+living+systems.">DNA nanotechnology as an emerging tool to study mechanotransduction in living systems.</a> Small. 15 (26), 1900961 (2019).</li><li>Liu, Y., Yehl, K., Narui, Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tension+sensing+nanoparticles+for+mechano-imaging+at+the+living/nonliving+interface.">Tension sensing nanoparticles for mechano-imaging at the living/nonliving interface.</a> Journal of the American Chemical Society. 135 (14), 5320-5323 (2013).</li><li>Glazier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mechanotechnology+reveals+that+integrin+receptors+apply+pN+forces+in+podosomes+on+fluid+substrates.">DNA mechanotechnology reveals that integrin receptors apply pN forces in podosomes on fluid substrates.</a> Nature Communications. 10 (1), 1-13 (2019).</li><li>Galior, K., Liu, Y., Yehl, K., Vivek, S., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titin-based+nanoparticle+tension+sensors+map+high-magnitude+integrin+forces+within+focal+adhesions.">Titin-based nanoparticle tension sensors map high-magnitude integrin forces within focal adhesions.</a> Nano Letters. 16 (1), 341-348 (2016).</li><li>Zhang, Y., Ge, C., Zhu, C., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+digital+tension+probes+reveal+integrin+forces+during+early+cell+adhesion.">DNA-based digital tension probes reveal integrin forces during early cell adhesion.</a> Nature Communications. 5, 5167 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+nanoparticle+tension+sensors+reveal+that+T-cell+receptors+transmit+defined+pN+forces+to+their+antigens+for+enhanced+fidelity.">DNA-based nanoparticle tension sensors reveal that T-cell receptors transmit defined pN forces to their antigens for enhanced fidelity.</a> Proceedings of the National Academy of Sciences. 113 (20), 5610-5615 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Platelet+integrins+exhibit+anisotropic+mechanosensing+and+harness+piconewton+forces+to+mediate+platelet+aggregation.">Platelet integrins exhibit anisotropic mechanosensing and harness piconewton forces to mediate platelet aggregation.</a> Proceedings of the National Academy of Sciences. 115 (2), 325-330 (2018).</li><li>Huang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+kinetics+of+two-dimensional+TCR+and+pMHC+interactions+determine+T-cell+responsiveness.">The kinetics of two-dimensional TCR and pMHC interactions determine T-cell responsiveness.</a> Nature. 464 (7290), 932-936 (2010).</li><li>Ma, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+probes+that+store+mechanical+information+reveal+transient+piconewton+forces+applied+by+T+cells.">DNA probes that store mechanical information reveal transient piconewton forces applied by T cells.</a> Proceedings of the National Academy of Sciences. 116 (34), 16949-16954 (2019).</li><li>Hui, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+costimulatory+receptor+CD28+is+a+primary+target+for+PD-1-mediated+inhibition.">T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition.</a> Science. 355 (6332), 1428-1433 (2017).</li><li>Whitley, K. D., Comstock, M. J., Chemla, Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elasticity+of+the+transition+state+for+oligonucleotide+hybridization.">Elasticity of the transition state for oligonucleotide hybridization.</a> Nucleic Acids Research. 45 (2), 547-555 (2016).</li><li>Brockman, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live-cell+super-resolved+PAINT+imaging+of+piconewton+cellular+traction+forces.">Live-cell super-resolved PAINT imaging of piconewton cellular traction forces.</a> Nature Methods. 17 (10), 1018-1024 (2020).</li></ol>

من خلال الإجراءات التفصيلية المقدمة هنا ، يمكن للمرء إعداد ركائز مسبار شد دبوس الشعر للحمض النووي لرسم خريطة وقياس توتر المستقبلات التي تنتجها الخلايا المناعية. عندما يتم طلاء الخلايا على ركيزة مسبار شد دبوس الشعر DNA ، فإنها تهبط وتلتصق وتنتشر عندما تستشعر المستقبلات الروابط كيميائيا وم?...

تدافع الخلايا المناعية ضد مسببات الأمراض والخلايا السرطانية عن طريق الزحف المستمر ومسح أسطح الخلايا المستهدفة بحثا عن المستضدات ، وترصيع سطحها 1,2. يبدأ التعرف على المستضد عند الارتباط بين مستقبل الخلايا التائية (TCR) ومركب التوافق النسيجي الببتدي الرئيسي MHC (pMHC) المعبر عنه على سطح الخلايا المستهدفة. نظرا لأن التعرف على TCR-pMHC يحدث عند التقاطع بين خليتين متحركتين ، فقد اشتبه منذ فترة طويلة في أنه يعاني من قوى ميكانيكية. علاوة على ذلك ، أدى ذلك إلى نموذج المستشعر الميكانيكي لتنشيط TCR ، مما يشير إلى أن قوى TCR تساهم في وظيفتها 3,4. لفهم متى وأين وكيف تساهم القوى الميكانيكية في وظيفة الخلايا التائية ، من الضروري تطوير أدوات لتصور القوى الجزيئية التي تنتقل بواسطة الخلايا التائية. تقليديا ، يتم استخدام طرق مثل مجهر قوة الجر (TFM) ومصفوفات micropillar للتحقيق في القوى الخلوية 5,6. ومع ذلك ، فإن حساسية القوة لمصفوفات TFM و micropillar تكون على مقياس nanonewton (nN) ، وبالتالي فهي غالبا ما تكون غير كافية لدراسة قوى piconewton الجزيئية (pN) التي تنتقل بواسطة مستقبلات الخلايا7. لتحسين القوة والدقة المكانية للكشف ، كان مختبرنا رائدا في تطوير مجسات التوتر الجزيئي ، والتي تم تصنيعها في البداية باستخدام بوليمرات البولي إيثيلين جلايكول (PEG)7. تتكون مجسات التوتر الجزيئي من "زنبرك" جزيئي قابل للتمديد (PEG ، بروتين ، حمض نووي) محاط بفلوروفور ومروي ومثبت على سطح. تؤدي القوى المطبقة على نهاية المسبار إلى امتداده ، وفصل الفلوروفور والتبريد ، وبالتالي توليد إشارة مضان قوية (الشكل 1 أ)8،9،10.
على مدار العقد الماضي ، قمنا بتطوير مكتبة من فئات مختلفة من مجسات التوتر الجزيئي مع عناصر زنبركية مصنوعة من الأحماض النووية11 والبروتينات10 والبوليمرات8. من بين هذه ، توفر مجسات التوتر القائمة على الحمض النووي أعلى نسبة إشارة إلى الضوضاء وأكبر حساسية للقوة ، والتي يمكن ضبطها بسهولة من بضعة pN إلى ~ 20 pN11. لقد استخدمنا مجسات توتر الحمض النووي في الوقت الفعلي لدراسة القوى الجزيئية الناتجة عن العديد من أنواع الخلايا المتنوعة ، بما في ذلك الخلايا الليفية والخلايا السرطانية والصفائح الدموية والخلايا المناعية11،12،13. ستصف هذه المخطوطة بروتوكولات لتجميع وتجميع مجسات توتر الحمض النووي على سطح لرسم خريطة لقوى المستقبلات الجزيئية بدقة قوة pN باستخدام مجهر مضان تقليدي. في حين أن الإجراء الحالي يتضمن تعديلات كيميائية على الحمض النووي لإدخال مراسل الفلورسنت (الشكل 1 ب) ، من المهم ملاحظة أن العديد من خطوات التعديل والتنقية يمكن الاستعانة بمصادر خارجية لشركات تخليق الحمض النووي المخصصة. لذلك ، فإن تقنية مجسات توتر الحمض النووي سهلة ، ويمكن الوصول إليها من قبل مجتمعات بيولوجيا الخلية والبيولوجيا الميكانيكية الأوسع.
باختصار ، لتجميع مستشعرات توتر الحمض النووي ، يتم تهجين دبوس شعر الحمض النووي إلى حبلا يجند فلوري على ذراع واحدة وشريط مرساة مروي على الذراع الأخرى ثم يجمد على ركيزة زجاجية (الشكل 1 ج ، التوتر في الوقت الفعلي). في حالة عدم وجود قوة ميكانيكية ، يتم إغلاق دبوس الشعر ، وبالتالي يتم إخماد التألق. ومع ذلك ، عندما تكون القوة الميكانيكية المطبقة أكبر من F1/2 (القوة عند التوازن التي تؤدي إلى احتمال 50٪ للتكشف) ، يذوب دبوس الشعر ميكانيكيا ، ويتم إنشاء إشارة فلورسنت.
بناء على مستشعر توتر الحمض النووي في الوقت الفعلي، نصف أيضا بروتوكولات لرسم خريطة للقوى المتراكمة، وهو أمر مفيد بشكل خاص لدراسة التفاعلات بين المستقبلات على الخلايا المناعية ورباطها الطبيعي. وذلك لأن المستقبلات المناعية غالبا ما تعرض روابط قصيرة العمر 3,14. يتم تصوير القوى المتراكمة باستخدام حبلا "قفل" يرتبط بشكل تفضيلي بفتح دبابيس شعر الحمض النووي ويسمح بتخزين إشارات التألق المرتبطة بأحداث السحب الميكانيكية (الشكل 1C ، التوتر المقفل). تم تصميم حبلا القفل لربط موقع ربط خفي يتعرض عند ذوبان دبوس الشعر المستحث ميكانيكيا وقفل دبوس الشعر في الحالة المفتوحة عن طريق منع إعادة طي دبوس الشعر ، وبالتالي تخزين إشارة التوتر ، وتوليد خريطة توتر متراكمة. علاوة على ذلك ، تم تصميم حبلا القفل بإصبع قدم مكون من ثمانية نيوكليوتيدات ، مما يتيح تفاعل إزاحة حبلا بوساطة إصبع القدم مع مكمله الكامل ، حبلا "فتح". مع إضافة حبلا الفتح ، يتم تجريد حبلا القفل المربوط من بنية دبوس الشعر ، مما يؤدي إلى محو إشارة التوتر المخزنة وإعادة ضبط دبوس الشعر إلى حالة الوقت الفعلي.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62348/62348fig01.jpg"> الشكل 1: مخطط أحدث مجسات التوتر الجزيئي. (أ) التصميم العام لمسبار التوتر الجزيئي في الوقت الفعلي، (ب) خيوط بناء مسبار التوتر القائم على الحمض النووي، (ج) مجسات التوتر القائمة على الحمض النووي (DNA) وتبديلها بين الحالة في الوقت الفعلي والحالة المقفلة. <a href="https://www.jove.com/files/ftp_upload/62348/62348fig01large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
يتكون البروتوكول الرئيسي من أربعة أقسام رئيسية - إعداد قليل النوكليوتيد ، وإعداد السطح ، والتصوير ، وتحليل البيانات. تم إثبات هذا البروتوكول بنجاح من قبل مختبرنا وغيره في خلايا OT-1 CD8 + T الساذجة والمنشطة ، وخلايا OT-II CD4 + ، وكذلك الأورام الهجينة ، ويمكن تطبيقه لاستجواب مستقبلات الخلايا المناعية المختلفة بما في ذلك مستقبلات الخلايا التائية ، ومستقبلات موت الخلايا المبرمجة (PD1) ، وقوى المستضد 1 المرتبطة بوظيفة الخلايا الليمفاوية (LFA-1). تستخدم الخلايا التائية الساذجة OT-1 CD8 + كمثال على خط الخلية في هذه الورقة.

<table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;3-hydroxypicolinic acid (3-HPA)</td>
			<td>Sigma</td>
			<td>56197</td>
			<td>maldi-TOF-MS matrix</td>
		</tr>
		<tr>
			<td>&#160;mPEG-SC</td>
			<td>Biochempeg</td>
			<td>MF001023-2K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>(3-Aminopropyl)triethoxysilane</td>
			<td>Acros</td>
			<td>AC430941000</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>10x Red blood cell lysis buffer</td>
			<td>Biolegend</td>
			<td>00-4333-57</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>8.8 nm gold nanoparticles, tannic acid</td>
			<td>Nanocomposix</td>
			<td>customized order</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Atto647N NHS ester</td>
			<td>Sigma</td>
			<td>18373-1MG-F</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Attofluor Cell Chamber, for microscopy</td>
			<td>Thermo Fisher Scientific</td>
			<td>A7816</td>
			<td>imaging</td>
		</tr>
		<tr>
			<td>BD Syringes only with Luer-Lok</td>
			<td>BD bioscience</td>
			<td>309657</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>biotinylated anti-mouse CD3e</td>
			<td>ebioscience</td>
			<td>13-0031-82</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>Biotinylated pMHC ovalbumin (SIINFEKL)</td>
			<td>NIH Tetramer Core Facility at Emory University</td>
			<td>NA</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>735078001</td>
			<td>block non-specific interactions</td>
		</tr>
		<tr>
			<td>Cell strainers</td>
			<td>Biologix</td>
			<td>15-1100</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, teflon</td>
			<td>Thermo Fisher Scientific</td>
			<td>C14784</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Cy3B NHS ester</td>
			<td>GE Healthcare</td>
			<td>PA63101</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS)</td>
			<td>Corning</td>
			<td>21-031-CM</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Sigma</td>
			<td>459836</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Hank&#8217;s balanced salts (HBSS)</td>
			<td>Sigma</td>
			<td>H8264</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>hydrogen peroxide</td>
			<td>Sigma</td>
			<td>H1009</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>LA-PEG-SC</td>
			<td>Biochempeg</td>
			<td>HE039023-3.4K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Midi MACS (LS) startup kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-301</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>mouse CD8+ T cell isolation kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-104-075</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Nanosep MF centrifugal devices</td>
			<td>Pall laboratory</td>
			<td>ODM02C35</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>No. 2 round glass coverslips</td>
			<td>VWR</td>
			<td>48382-085</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>NTA-SAM</td>
			<td>Dojindo Molecular Technologies</td>
			<td>N475-10</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>P2 gel</td>
			<td>Bio-rad</td>
			<td>1504118</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>sufuric acid</td>
			<td>EMD Millipore Corporation</td>
			<td>SX1244-6</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Sulfo-NHS acetate</td>
			<td>Thermo Fisher Scientific</td>
			<td>26777</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 &#956;m</td>
			<td>653950-702</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Barnstead Nanopure water purifying system</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>water</td>
		</tr>
		<tr>
			<td>CFI Apo 100&#215; NA 1.49 objective</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Cy5 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>evolve electron multiplying charge coupled device (EMCCD)</td>
			<td>Photometrics</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>High-performance liquid chromatography</td>
			<td>Agilent 1100</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Intensilight epifluorescence source</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS)</td>
			<td>Voyager STR</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nanodrop 2000 UV-Vis Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nikon Eclipse Ti inverted microscope</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Nikon Perfect Focus System</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>NIS Elements software</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>quad band TIRF 405/488/561/647 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>RICM cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm</td>
			<td>Coherent</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TRITC cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>oligo name</td>
			<td>5&#39; modification / 3&#39; modification</td>
			<td>sequence (5&#39; to 3&#39;)</td>
			<td>Use</td>
		</tr>
		<tr>
			<td>15mer amine locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer Atto647N locking strand</td>
			<td>5&#39; modification: Atto647N 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer non-fluoresccent locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>A AAA AAC ATT TAT AC</td>
			<td>locking real-time tension signal for quantitative analysis</td>
		</tr>
		<tr>
			<td>4.7 pN hairpin strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>GTGAAATACCGCACAGATGCGT 
 TTGTATAAATGTTTTTTTCATTTAT 
 ACTTTAAGAGCGCCACGTAGCC 
CAGC</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>amine ligand strand</td>
			<td>5&#39; modification: /5AmMC6/ 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>BHQ2 anchor strand</td>
			<td>5&#39; modification: /5ThiolMC6-D/ 
			3&#39; modification: /3BHQ_2/</td>
			<td>TTTGCTGGGCTACGTGGCGCTCTT</td>
			<td>&#160;&#160;&#160;hairpin probe</td>
		</tr>
		<tr>
			<td>Cy3B ligand strand</td>
			<td>5&#39; modification: Cy3B 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>unlocking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>TAG GTA GGG TAT AAA TGT TTT TTT C</td>
			<td>unlocking accumulated tension signal</td>
		</tr>
	</tbody>
</table>

dna tension probes to map the transient piconewton receptor forces by immune cells

تعتبر القوى الميكانيكية التي تنتقل عند التقاطع بين خليتين متجاورتين وعند التقاطع بين الخلايا والمصفوفة خارج الخلية ضرورية لتنظيم العديد من العمليات التي تتراوح من التطور إلى علم المناعة. لذلك ، فإن تطوير الأدوات اللازمة لدراسة هذه القوى على المستوى الجزيئي أمر بالغ الأهمية. طورت مجموعتنا مجموعة من مستشعرات التوتر الجزيئي لتحديد وتصور القوى التي تولدها الخلايا وتنتقل إلى روابط محددة. تتكون الفئة الأكثر حساسية من مستشعرات التوتر الجزيئي من دبابيس شعر حلقة جذعية للحمض النووي. تستخدم هذه المستشعرات أزواج الفلوروفور والتبريد للإبلاغ عن الامتداد الميكانيكي وتكشف دبابيس شعر الحمض النووي تحت القوة. يتمثل أحد التحديات التي تواجه مستشعرات شد دبوس الشعر في الحمض النووي في أنها قابلة للانعكاس مع إعادة طي دبوس الشعر السريع عند انتهاء التوتر وبالتالي يصعب تسجيل القوى العابرة. في هذه المقالة ، نصف بروتوكولات إعداد مستشعرات شد الحمض النووي التي يمكن "قفلها" ومنعها من إعادة الطي لتمكين "تخزين" المعلومات الميكانيكية. وهذا يسمح بتسجيل قوى piconewton العابرة للغاية ، والتي يمكن "محوها" لاحقا عن طريق إضافة الأحماض النووية التكميلية التي تزيل القفل. تكشف هذه القدرة على التبديل بين رسم خرائط التوتر في الوقت الفعلي وتخزين المعلومات الميكانيكية عن قوى ضعيفة وقصيرة العمر وأقل وفرة ، والتي تستخدمها الخلايا التائية بشكل شائع كجزء من وظائفها المناعية.

نعرض هنا صورا تمثيلية لمراقبة جودة السطح (الشكل 4). يجب أن يكون للسطح عالي الجودة خلفية نظيفة في قناة RICM (الشكل 4B) ، وشدة مضان موحدة في قناة Cy3B (الشكل 4C). مع نفس معدات التصوير وظروف اكتساب التصوير الفلوري المتطابقة ، يجب أن تكون شدة مضان الخلفية ...

Watch this Scientific Journal Video about DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells at JoVE.com

DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells

تصف هذه الورقة بروتوكولا مفصلا لاستخدام مجسات التوتر القائمة على الحمض النووي لتصوير قوى المستقبلات التي تطبقها الخلايا المناعية. يمكن لهذا النهج تعيين قوى المستقبلات >4.7pN في الوقت الفعلي ويمكنه دمج القوى بمرور الوقت.

مجسات توتر الحمض النووي لرسم خريطة لقوى مستقبلات بيكونيوتن العابرة بواسطة الخلايا المناعية

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical ...

يقدم هذا البروتوكول طريقة لرسم خريطة للقوى الجزيئية التي تولدها الخلايا وخاصة الخلايا المناعية. البروتوكول مهم للمختبرات المهتمة بدراسة النقل الميكانيكي في علم الأحياء الميكانيكي. الميزة الرئيسية لهذه التقنية هي أنها سهلة للغاية وتسمح للمرء باستخدام المجهر الفلوري التقليدي لتحديد انتقال القوة في الخلايا الخالدة والأولية.للبدء ، ضع أغطية 25 ملم على رف بولي تترافلورو إيثيلين في دورق سعة 50 ملليلتر واشطف أغطية الغطاء ثلاث مرات عن طريق غمرها في الماء. امزج كميات متساوية من الإيثانول والماء وأضف 40 ملليلترا من هذا المحلول إلى الكأس الزجاجية التي تحتوي على الرف وأغطية الغطاء. ثم أغلق الدورق باستخدام شريط بارافيلم.قم بتنظيف أغطية الغطاء عن طريق صوتنة الدورق لمدة 15 دقيقة في منظف بالموجات فوق الصوتية وتجاهل السائل بعد صوتنة. بعد ذلك ، اشطف الدورق الذي يحتوي على الرف وأغطية الأغطية بالماء ست مرات على الأقل لإزالة أي مذيب عضوي متبقي. لتحضير محلول سمكة البيرانا الطازج ، أضف 30 ملليلترا من حمض الكبريتيك إلى دورق 50 ملليلتر وأضف ببطء 10 ملليلتر من بيروكسيد الهيدروجين.امزج محلول سمكة البيرانا برفق باستخدام نهاية ماصة زجاجية. لبدء الحفر ، انقل الرف الذي يحمل أغطية الغطاء إلى الدورق الذي يحتوي على محلول سمكة البيرانا واحتضانه لمدة 30 دقيقة في درجة حرارة الغرفة لتنظيف وهيدروكسيل أغطية الغطاء. بعد ذلك ، انقل الحامل باستخدام ملاقط فولاذية أو بولي تترافلورو إيثيلين إلى دورق نظيف سعة 50 مل واشطفه بالماء ست مرات.لإزالة الماء تماما ، اغمر الرف الذي يحمل أغطية الغطاء في دورق سعة 50 ملليلتر مع 40 ملليلتر من الإيثانول. ثم تخلص من الإيثانول. بعد ذلك ، اغمر الحامل في 40 ملليلتر من الإيثانول الذي يحتوي على 3٪ أمينوبروبيل تريثوكسيسيلان لمدة ساعة واحدة في درجة حرارة الغرفة لبدء التفاعل مع مجموعة الهيدروكسيل على أغطية الغطاء.شطف سطح أغطية ست مرات عن طريق غمرها في 40 ملليلتر من الإيثانول وتجفيفها في فرن على حرارة 80 درجة مئوية لمدة 20 دقيقة. قم بتغطية الجزء السفلي الداخلي من طبق بتري بشريط بارافيلم لمنع انزلاق الغطاء داخل طبق بتري. ثم ضع أغطية الغطاء المغطاة بالأمين بحيث يتم تشغيل الجانب مع مجسات شد الحمض النووي المتجهة لأعلى.قم بتغطية أغطية الغطاء عند 20 درجة مئوية للاستخدام في المستقبل. لتعديل مجموعات الأمين على أغطية الغطاء ، أضف حمض ليبويك PEG NHS و mPEG NHS واحتضان طبق بتري في درجة حرارة الغرفة لمدة ساعة واحدة. في نهاية الحضانة ، شطف السطح ثلاث مرات بالماء.بعد ذلك ، أضف 100 ميكرولتر من بيكربونات الصوديوم 0.1 مولار تحتوي على ملليغرام واحد لكل ملليلتر من Sulfo-NHS-Acetate إلى مجموعة من أغطية الساندويتش واحتضانها لمدة 30 دقيقة حتى يحدث التخميل. أضف 0.5 ملليلتر من جزيئات الذهب النانوية إلى كل غطاء واحتضانها لمدة 30 دقيقة في درجة حرارة الغرفة. بعد الحضانة ، شطف الغطاءزلات بالماء ثلاث مرات.بعد إضافة حبلا Black Hole Quencher 2 إلى مسبار شد الحمض النووي الملدن بنسبة عشرة إلى واحد ، أضف 100 ميكرولتر من الخليط لكل غطاءين لصنع الساندويتش. ضع بعناية كرة مناديل معملية مبللة في طبق بتري بعيدا عن أغطية الغطاء وأغلق الطبق بشريط بارافيلم لمنع المحلول من الجفاف. بعد ذلك ، غطي الطبق بورق واحتضانه عند أربع درجات مئوية طوال الليل.في اليوم التالي ، قم بتجميع غرفة التصوير ، مع الحرص على منع تشقق السطح أثناء شد الغرفة. ثم أضف 0.5 إلى ملليلتر واحد من محلول الملح المتوازن هانك إلى غرفة التصوير. استخدم قناة Cy3B بهدف 100X لالتقاط إشارات الفلورسنت للخلايا المطلية على مجسات توتر دبوس شعر الحمض النووي عندما تبدأ في الانتشار.بعد تحضير 100 ميكرومولار غير فلورسنت قفل حبلا ، في النقطة الزمنية المطلوبة ، أضفه إلى الخلايا بتركيز نهائي من ميكرو مولار واحد في غرفة التصوير لتخزين إشارة التوتر ومزجها مع الخلايا عن طريق الماصة. بعد حوالي 10 دقائق من القفل ، احصل على أفلام الفاصل الزمني أو صور نقطة النهاية في التألق لكل من رسم خرائط التوتر النوعي والتحليل الكمي. كان للسطح الناجح لون وردي باهت.تم عرض الجودة العالية للسطح بخلفية نظيفة ومجهر تباين تداخل الانعكاس أو قناة RICM وشدة مضان موحدة في قناة Cy3B. أشارت صور الفاصل الزمني لقفل التوتر إلى أن إشارات التوتر TCR المضادة ل CD3 epsilon و TCR-peptide-MHC قد تم تضخيمها بسبب قفل دبوس الشعر وتراكم الإشارات. سجل حبلا القفل أحداث سحب ميكانيكية قصيرة العمر لببتيد TCR MHCN4 بدءا من صفر دقيقة ، مما سهل التحليل الكمي وكشف عن النمط المميز لقوة TCR الببتيد MHC التي تشبه نمط بولسي إي للمشابك المناعية.في كل خطوة ، يحتاج إعداد ركيزة مسبار النية إلى الاهتمام بالتفاصيل والتعامل الدقيق مع المواد. تتيح هذه التقنية تصور القوى الجزيئية العابرة التي تحدث على سطح الخلية عندما تتفاعل مع البيئة ، خاصة في الخلايا المناعية التي تبحث عن المستضدات.

Research

JoVE Journal

Bioengineering

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

تصميم مفاعل حيوي لضغط الدوري السابقين فيفو دراسة صمامات القلب الأورطي

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Attaching Biological Probes to Silica Optical Biosensors Using Silane Coupling Agents

ربط المسابر البيولوجي لأجهزة الاستشعار البصرية عن طريق وكلاء السيليكا اقتران silane

In order to interface with biological environments, biosensor platforms, such as the popular Biacore system (based on the Surface Plasmon Resonance (SPR) ...

Mass Cytometry: Protocol for Daily Tuning and Running Cell Samples on a CyTOF Mass Cytometer

الخلوي الجماعي: بروتوكول لضبط اليومية وعينات الخلايا تشغيل عداد الكريات الشامل على CyTOF

In recent years, the rapid analysis of single cells has commonly been performed using flow cytometry and fluorescently-labeled antibodies. However, the ...

Measurement of Tension Release During Laser Induced Axon Lesion to Evaluate Axonal Adhesion to the Substrate at Piconewton and Millisecond Resolution

قياس الافراج عن التوتر أثناء المستحثة بالليزر اكسون الآفات لتقييم التصاق محور عصبي إلى الركيزة في Piconewton والقرار ملي

The formation of functional connections in a developing neuronal network is influenced by extrinsic cues. The neurite growth of developing neurons is ...

Insertion of Flexible Neural Probes Using Rigid Stiffeners Attached with Biodissolvable Adhesive

إدراج مرنة العصبية عن طريق مجسات التقوية الصلبة المرفقة مع اصق Biodissolvable

Microelectrode  arrays for neural interface devices that are made of biocompatible thin-film  polymer are expected to have extended functional lifetime ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

جيل من القص التصاق خريطة طريق SynVivo شبكات الاوعية الدموية الدقيقة الاصطناعية

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Studying the Stoichiometry of Epidermal Growth Factor Receptor in Intact Cells using Correlative Microscopy

دراسة رياضيات الكيمياء من البشرة عامل نمو مستقبلات في الخلايا السليمة باستخدام الميكروسكوب المتلازم

This protocol describes the labeling of epidermal growth factor receptor (EGFR) on COS7 fibroblast cells, and subsequent correlative fluorescence ...

An Experimental Protocol for Assessing the Performance of New Ultrasound Probes Based on CMUT Technology in Application to Brain Imaging

وضع بروتوكول تجريبي لتقييم أداء جديدة المسابير الموجات فوق الصوتية على أساس تكنولوجيا كمات في التطبيق لتصوير الدماغ

The possibility to perform an early and repeatable assessment of imaging performance is fundamental in the design and development process of new ...

Probing the Roles of Physical Forces in Early Chick Embryonic Morphogenesis

استكشاف أدوار القوى المادية في أوائل Morphogenesis الجنينية الفرخ

Embryonic development is traditionally studied from the perspective of biomolecular genetics, but the fundamental importance of mechanics in morphogenesis ...

Imaging Integrin Tension and Cellular Force at Submicron Resolution with an Integrative Tension Sensor

التصوير إنتغرين التوتر وقوة الخلوية في القرار Submicron مع جهاز استشعار توتر التكاملية

Molecular tension transmitted by integrin-ligand bonds is the fundamental mechanical signal in the integrin pathway that plays significant roles in many ...