Name: using next generation sequencing to identify mutations associated with repair of a cas9-induced double strand break near the cd4 promoter
Uploaded: 2022-03-31T12:40:00
Description: Watch this Scientific Journal Video about Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter at JoVE.com

이 원고에보고 된 연구는 국립 보건원 (P20GM130448)의 국립 일반 의료 과학 연구소 (NAW 및 RP)의 지원을 받았다. 국립 보건원 국립 암 연구소 (NCI R15 CA242057 01A1); 캔자스 주립 대학의 존슨 암 연구 센터; 및 미국 국방부 (CMDRP PRCRP CA160224 (NAW)). 우리는 우리의 면역 형광 현미경 검사에 대한 KSU-CVM 공초점 코어와 조엘 산네만에게 감사드립니다. 내용은 전적으로 저자의 책임이며 반드시 이러한 자금 조달 기관의 공식 견해를 나타내는 것은 아닙니다.

1. 셀 도금
<ol><li>HFK LXSN 및 HFK 8E6 세포를 인간 각질세포 성장 보충제 (HKGS) 및 1% 페니실린/스트렙토마이신으로 케라티노사이트 배양 배지 (10 mL/플레이트)의 10cm 플레이트에서 성장시킨다. 세포를 5%CO2를 갖는 재킷 인큐베이터에서 37°C에서 약 80% 합류로 성장시킨다.</li>
	<li>배양 배지를 3mL의 트립신-EDTA(0.05%, 에틸렌디아민테트라아세트산)로 교체한다. 37°C에서 3분 동안 인큐베?...

<ol>
	<li>V&#237;tor, A. C., Huertas, P., Legube, G., de Almeida, S. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+DNA+double-strand+break+repair:+an+ever-growing+toolbox.">Studying DNA double-strand break repair: an ever-growing toolbox.</a> Frontiers in Molecular Biosciences. 7, (2020).</li><li>Giglia-Mari, G., Zotter, A., Vermeulen, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+damage+response.">DNA damage response.</a> Cold Spring Harbor Perspectives in Biology. 3 (1), 000745 (2011).</li><li>Khanna, K. K., Jackson, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-strand+breaks:+Signaling,+repair+and+the+cancer+connection.">DNA double-strand breaks: Signaling, repair and the cancer connection.</a> Nature Genetics. 27 (3), 247-254 (2001).</li><li>vanden Berg, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+limited+number+of+double-strand+DNA+breaks+is+sufficient+to+delay+cell+cycle+progression.">A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression.</a> Nucleic Acids Research. 46 (19), 10132-10144 (2018).</li><li>Chang, H. H. Y., Pannunzio, N. R., Adachi, N., Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-homologous+DNA+end+joining+and+alternative+pathways+to+double-strand+break+repair.">Non-homologous DNA end joining and alternative pathways to double-strand break repair.</a> Nature Reviews Molecular Cell Biology. 18 (8), 495-506 (2017).</li><li>Daley, J. M., Sung, P. 5. 3. B. P. 1. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA1,+and+the+choice+between+recombination+and+end+joining+at+DNA+double-strand+breaks.">BRCA1, and the choice between recombination and end joining at DNA double-strand breaks.</a> Molecular and Cellular Biology. 34 (8), 1380-1388 (2014).</li><li>Godin, S. K., Sullivan, M. R., Bernstein, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+insights+into+RAD51+activity+and+regulation+during+homologous+recombination+and+DNA+replication.">Novel insights into RAD51 activity and regulation during homologous recombination and DNA replication.</a> Biochemistry and Cell Biology = Biochimie et Biologie Cellulaire. 94 (5), 407-418 (2016).</li><li>Jette, N., Lees-Miller, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-dependent+protein+kinase:+a+multifunctional+protein+kinase+with+roles+in+DNA+double+strand+break+repair+and+mitosis.">The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis.</a> Progress in Biophysics and Molecular Biology. 117, 194-205 (2015).</li><li>Weterings, E., van Gent, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+non-homologous+end-joining:+A+synopsis+of+synapsis.">The mechanism of non-homologous end-joining: A synopsis of synapsis.</a> DNA Repair. 3 (11), 1425-1435 (2004).</li><li>Bhargava, R., Lopezcolorado, F. W., Tsai, L. J., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+non-homologous+end+joining+factor+XLF+promotes+chromosomal+deletion+rearrangements+in+human+cells.">The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells.</a> Journal of Biological Chemistry. 295 (1), 125-137 (2020).</li><li>Gunn, A., Bennardo, N., Cheng, A., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+end+use+during+end+joining+of+multiple+chromosomal+double+strand+breaks+is+influenced+by+repair+protein+RAD50,+DNA-dependent+protein+kinase+DNA-PKcs,+and+transcription+context.">Correct end use during end joining of multiple chromosomal double strand breaks is influenced by repair protein RAD50, DNA-dependent protein kinase DNA-PKcs, and transcription context.</a> Journal of Biological Chemistry. 286 (49), 42470-42482 (2011).</li><li>Simsek, D., Jasin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+end-joining+is+suppressed+by+the+canonical+NHEJ+component+Xrcc4-ligase+IV+during+chromosomal+translocation+formation.">Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation.</a> Nature Structural &amp; Molecular Biology. 17 (4), 410-416 (2010).</li><li>Certo, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+genome+engineering+outcome+at+individual+DNA+breakpoints.">Tracking genome engineering outcome at individual DNA breakpoints.</a> Nature Methods. 8 (8), 671-676 (2011).</li><li>Murthy, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterizing+DNA+repair+processes+at+transient+and+long-lasting+double-strand+DNA+breaks+by+immunofluorescence+microscopy.">Characterizing DNA repair processes at transient and long-lasting double-strand DNA breaks by immunofluorescence microscopy.</a> JoVE Journal of Visualized Experiments. (136), e57653 (2018).</li><li>Wang, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+DNA+double-strand-break+repair+using+novel+single-molecule+forceps.">Dissection of DNA double-strand-break repair using novel single-molecule forceps.</a> Nature Structural &amp; Molecular Biology. , (2018).</li><li>Azzam, E. I., Jay-Gerin, J. -. P., Pain, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ionizing+radiation-induced+metabolic+oxidative+stress+and+prolonged+cell+injury.">Ionizing radiation-induced metabolic oxidative stress and prolonged cell injury.</a> Cancer Letters. 327, 48-60 (2012).</li><li>Kuo, L. J., Yang, L. -. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-H2AX+-+A+novel+biomarker+for+DNA+double-strand+breaks.">&#947;-H2AX - A novel biomarker for DNA double-strand breaks.</a> In Vivo. 5, (2008).</li><li>Sanders, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation-induced+DNA+damage+and+repair+effects+on+3D+genome+organization.">Radiation-induced DNA damage and repair effects on 3D genome organization.</a> Nature Communications. 11 (1), 6178 (2020).</li><li>Bellaiche, Y., Mogila, V., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=I-SceI+endonuclease,+a+new+tool+for+studying+DNA+double-strand+break+repair+mechanisms+in+Drosophila.">I-SceI endonuclease, a new tool for studying DNA double-strand break repair mechanisms in Drosophila.</a> Genetics. 152 (3), 1037-1044 (1999).</li><li>Wallace, N. A., Robinson, K., Howie, H. L., Galloway, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#946;-HPV+5+and+8+E6+disrupt+homology+dependent+double+strand+break+repair+by+attenuating+BRCA1+and+BRCA2+expression+and+foci+formation.">&#946;-HPV 5 and 8 E6 disrupt homology dependent double strand break repair by attenuating BRCA1 and BRCA2 expression and foci formation.</a> PLOS Pathogens. 11 (3), 1004687 (2015).</li><li>Hu, C., Bugbee, T., Gamez, M., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8E6+attenuates+non-homologous+end+joining+by+hindering+DNA-PKcs+activity.">Beta human papillomavirus 8E6 attenuates non-homologous end joining by hindering DNA-PKcs activity.</a> Cancers. 12 (9), 2356 (2020).</li><li>Hu, C., Bugbee, T., Dacus, D., Palinski, R., Wallace, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beta+human+papillomavirus+8+E6+allows+colocalization+of+non-homologous+end+joining+and+homologous+recombination+repair+factors.">Beta human papillomavirus 8 E6 allows colocalization of non-homologous end joining and homologous recombination repair factors.</a> PLOS Pathogens. 18 (3), 1010275 (2022).</li><li>Butler, T. A. J., Paul, J. W., Chan, E. -. C., Smith, R., Tolosa, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misleading+westerns:+Common+quantification+mistakes+in+western+blot+densitometry+and+proposed+corrective+measures.">Misleading westerns: Common quantification mistakes in western blot densitometry and proposed corrective measures.</a> BioMed Research International. 2019, 5214821 (2019).</li><li>Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., Bonner, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-stranded+breaks+induce+histone+H2AX+Phosphorylation+on+serine+139.">DNA double-stranded breaks induce histone H2AX Phosphorylation on serine 139.</a> Journal of Biological Chemistry. 273 (10), 5858-5868 (1998).</li><li>Taning, C. N. T., Van Eynde, B., Yu, N., Ma, S., Smagghe, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+in+insects:+Applications,+best+practices+and+biosafety+concerns.">CRISPR/Cas9 in insects: Applications, best practices and biosafety concerns.</a> Journal of Insect Physiology. 98, 245-257 (2017).</li><li>Ghezraoui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+translocations+in+human+cells+are+generated+by+canonical+nonhomologous+end-joining.">Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining.</a> Molecular Cell. 55 (6), 829-842 (2014).</li></ol>

제공된 정보의 깊이 외에도이 방법에는 몇 가지 장점이 있습니다. 첫째, DSB 복구는, 이론적으로, 관심있는 세포의 게놈을 변형시키지 않고 임의의 게놈 유전자좌에서 평가될 수 있다. 둘째, 수리에 대한 NGS 분석에 대한 액세스는 정의된 영역을 대상으로 하는 단일 DSB를 만들고 분석함으로써 제공되는 비용 절감 및 계산 노력으로 증가합니다. 마지막으로, 추가적인 유기체의 게놈이 일상적으로 이?...

게놈 안정성을 유지하는 것은 모든 살아있는 유기체에 매우 중요합니다. 정확한 DNA 복제와 강력한 DNA 손상 반응(DDR)은 유전 물질 1,2를 충실하게 전파하는 데 필요합니다. DNA 손상은 대부분의 세포 2,3에서 정기적으로 발생합니다. 이러한 손상이 감지되면 세포 주기 진행이 중단되고 DNA 복구 메커니즘이 활성화됩니다. DNA 또는 DSB의 이중 가닥 파단은 가장 독성이 강하고 돌연변이 유발 유형의 DNA 손상 3,4입니다.
몇몇 DDR 신호전달 경로가 이러한 병변을 복구할 수 있지만, 가장 철저하게 연구된 DSB 복구 경로는 상동성 재조합(HR) 및 비상동성 말단 접합(NHEJ)이다. HR은 자매 크로마티드를 상동성 주형으로 사용하여 DSB를 수리하는 크게 오류가 없는 경로입니다. 이것은 세포 주기 5,6,7의 S 단계 및 G2 단계에서 일어나는 경향이 있다. NHEJ는 오류가 발생하기 쉽지만 세포 주기 8,9에 걸쳐 발생할 수 있습니다. 특정 수리 메커니즘(10,11,12)의 효율을 측정하기 위해 다양한 리포터 분석법이 개발되었다. 이들 검정은 판독값11,13으로서 GFP 또는 mCherry를 사용하는 DSB 복구 경로 활성의 높은 처리량 측정을 위해 유세포 분석기에 의존하는 경향이 있다. 매우 효율적이지만 인위적으로 도입 된 DSB에서 발생하는 정식 수리에 의존합니다.
DSB 수리를 연구하는 데 사용되는 다양한 다른 방법이 있습니다. 이들 중 다수는 면역형광(IF) 현미경1,14에 의존한다. IF 현미경 검사는 DSB가 유전 독성 화학 물질 또는 이온화 방사선15,16에 노출되어 유도 된 후 수리 복합체를 대표하는 이산 핵 초점을 감지합니다. 이러한 초점의 형성 및 해결을 추적하는 것은 각각14,17 개의 수리 개시 및 완료의 표시를 제공한다. 그러나, DSB 유도의 이들 방법(즉, 화학물질 또는 이온화 방사선)은 게놈 내의 정의된 위치에서 DSB를 야기하지 않는다. 또한 DSB의 적은 수(예를 들어, 2-4개)만을 일관되게 유도하기 위해 이들을 사용하는 것도 기능적으로 불가능하다. 결과적으로, DSBs를 유도하는 가장 일반적으로 사용되는 방법은 게놈18 전체에 걸쳐 무작위로 분포된 다수의 병변을 야기한다. 소수의 DSB는 희귀 절단된 엔도뉴클레아제에 대한 인식 부위를 삽입하고 I-Sce119와 같은 관련 엔도뉴클레아제를 발현함으로써 도입될 수 있다. 불행하게도, 표적 부위의 요구되는 통합은 내인성 게놈 유전자좌에서 DSB의 검사를 방지한다.
이 원고는 사용자 정의 유전자좌에서 생성 된 DSB의 복구와 관련된 돌연변이를 탐지하는 방법을 설명합니다. 우리는 DSB와 관련된 돌연변이의 수를 증가시키는 바이러스 단백질의 능력을 평가하기 위해 적용된 접근법의 대표적인 예를 제공한다. 구체적으로, 본 원고는 인간 유두종 바이러스 유형 8(HFK 8E6)의 E6 단백질을 발현하는 벡터 조절(HFK LXSN) 및 HFK에서 인간 CD4 오픈 리딩 프레임에서 DSB를 유도하기 위해 CAS9 엔도뉴클레아제를 지시하기 위한 단일 가이드 RNA(sgRNA)의 사용을 기술한다. 파단을 둘러싸는 영역의 표적화된 차세대 염기서열 분석(NGS)은 병변의 복구와 관련된 돌연변이가 엄격하게 정의될 수 있게 한다. 이들 데이터는 바이러스 단백질이 DSB 복구 동안 돌연변이의 약 20배 증가를 야기한다는 것을 입증한다. 또한 전체 게놈 시퀀싱이 필요 없이 단일 유전자좌에서 DSB의 돌연변이 유발 결과의 편향되지 않은 특성화를 제공한다. 원칙적으로, 프로토콜은 게놈 유전자좌 또는 세포주 사이의 돌연변이의 상대적 위험을 비교하기 위해 용이하게 적응될 수 있었다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>6 Well Tissue Culture Plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td>Cell culture plate</td>
		</tr>
		<tr>
			<td>BCA Kit</td>
			<td>VWR</td>
			<td>89167-794</td>
			<td>BCA assay kit</td>
		</tr>
		<tr>
			<td>Centrifuge 5910 R</td>
			<td>Eppendorf</td>
			<td>2231000772</td>
			<td>Tabletop Centrifuge</td>
		</tr>
		<tr>
			<td>CLC Genomic Workbench</td>
			<td>Qiagen</td>
			<td>832001</td>
			<td>deep sequence data analysis software/indel caller/variant caller</td>
		</tr>
		<tr>
			<td>Digital Microplate Genie pulse</td>
			<td>Scientific industries</td>
			<td>SI-400A</td>
			<td>Plate shaker</td>
		</tr>
		<tr>
			<td>DYKDDDDK Tag Monoclonal Antibody (FG4R)</td>
			<td>ThermoFisher Scientific</td>
			<td>MA191878</td>
			<td>Anti-FLAG antibody</td>
		</tr>
		<tr>
			<td>Epilife CF Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>MEPICF500</td>
			<td>Cell cultrue media and supplements</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>VWR</td>
			<td>89510-194</td>
			<td>Cell culture supplement</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG</td>
			<td>ThermoFisher Scientific</td>
			<td>A-11012</td>
			<td>Secondary antibody</td>
		</tr>
		<tr>
			<td>HighPrep PCR Clean-up system</td>
			<td>MagBio</td>
			<td>AC-60005</td>
			<td>Bead-based PCR cleanup kit</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix PCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK2600</td>
			<td>PCR mastermix/PCR assay</td>
		</tr>
		<tr>
			<td>MagAttract HMW DNA kit</td>
			<td>Qiagen</td>
			<td>67563</td>
			<td>High Molecular Weight DNA extraction kit</td>
		</tr>
		<tr>
			<td>Magnetic Stand-96</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM10027</td>
			<td>96-Well Magnetic Rack</td>
		</tr>
		<tr>
			<td>MiniAmp Thermal Cycler</td>
			<td>Applied Biosystems</td>
			<td>A37834</td>
			<td>Thermal Cycler</td>
		</tr>
		<tr>
			<td>Miseq</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td>Sequencer</td>
		</tr>
		<tr>
			<td>Miseq v2 300 cycle reagent kit</td>
			<td>Illumina</td>
			<td>MS-102-2002</td>
			<td>300-cycle cartridge/sequencing reagents</td>
		</tr>
		<tr>
			<td>Nextera XT DNA Library Prep kit</td>
			<td>Illumina</td>
			<td>FC-131-1024</td>
			<td>Library preparation kit</td>
		</tr>
		<tr>
			<td>Nextera XT Kit v2 Set A</td>
			<td>Illumina</td>
			<td>20027215</td>
			<td>Indexes</td>
		</tr>
		<tr>
			<td>Nunc 96-well polypropylene DeepWell Stroage plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260251</td>
			<td>deep well 96-well plates</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin Solution (100X)</td>
			<td>Calsson Labs</td>
			<td>PSL02-6X100ML</td>
			<td>Antibiotics for cell culture</td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (PBS)</td>
			<td>Bio Basic</td>
			<td>PD8117</td>
			<td>PBS</td>
		</tr>
		<tr>
			<td>px330-CD4</td>
			<td>Addgen</td>
			<td>136938</td>
			<td>SgRNA/CAS9 plasmids targeting 5&#8217;- GGCGTATCTGTGTGAGGACT</td>
		</tr>
		<tr>
			<td>QIAxcel Advanced System</td>
			<td>Qiagen</td>
			<td>9001941</td>
			<td>capillary electrophersis machine</td>
		</tr>
		<tr>
			<td>QIAxcel DNA screening kit</td>
			<td>Qiagen</td>
			<td>929004</td>
			<td>DNA buffer/ capillary electrophersis tubes</td>
		</tr>
		<tr>
			<td>Qubit 1x ds HS Assay Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>Q23851</td>
			<td>Fluorometer reagents/1x dsDNA solution</td>
		</tr>
		<tr>
			<td>Qubit 4 Fluorometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Q33238</td>
			<td>Fluorometer</td>
		</tr>
		<tr>
			<td>Qubit Assay Tubes</td>
			<td>Thermo Fisher Scientific</td>
			<td>Q32856</td>
			<td>Fluorometer assay tubes</td>
		</tr>
		<tr>
			<td>RIPA Lysis Buffer</td>
			<td>VWR</td>
			<td>VWRVN653-100ML</td>
			<td>Lysis buffer for protein extraction</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA (0.05%), phenol red</td>
			<td>ThermoFisher Scientific</td>
			<td>25300054</td>
			<td>Trypsin</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific industries</td>
			<td>SI-0236</td>
			<td>Vortex</td>
		</tr>
		<tr>
			<td>Xfect Transfection Reagent</td>
			<td>Takara Bio</td>
			<td>631318</td>
			<td>Transfection reagent</td>
		</tr>
		<tr>
			<td>genomic data analysis software</td>
			<td>QIAGEN</td>
			<td>CLC Workbench v21.0.</td>
			<td>Data analysis software</td>
		</tr>
	</tbody>
</table>

using next generation sequencing to identify mutations associated with repair of a cas9-induced double strand break near the cd4 promoter

DNA의 이중 가닥 파단 (DSBs)은 DNA 손상의 가장 세포 독성 유형입니다. 무수한 모욕이 이러한 병변 (예 : 복제 스트레스, 이온화 방사선, 복구되지 않은 UV 손상)을 초래할 수 있기 때문에 DSB는 매일 대부분의 세포에서 발생합니다. 세포 사멸 이외에도, 복구되지 않은 DSB는 게놈 완전성을 감소시키고 생성된 돌연변이는 종양 발생을 유도할 수 있다. 이러한 위험과 DSB의 유병률은 세포가 이러한 병변을 복구하는 메커니즘에 대한 조사에 동기를 부여합니다. 차세대 시퀀싱은 이온화 방사선에 의한 DSB의 유도와 쌍을 이루어 DSB 수리 결함과 관련된 돌연변이를 정확하게 정의하는 강력한 도구를 제공합니다. 그러나 이러한 접근법은 이온화 방사선과 관련된 무작위로 발생하는 DSB의 복구를 검출하기 위해 계산적으로 어렵고 비용이 많이 드는 전체 게놈 시퀀싱이 필요합니다. I-Sce1과 같은 희귀 절단 엔도뉴클레아제는 단일 DSB를 생성하는 능력을 제공하지만, 이들의 인식 부위는 관심 게놈에 삽입되어야 한다. 결과적으로 수리 현장은 본질적으로 인위적입니다. 최근의 진보는 가이드 RNA (sgRNA)가 Cas9 엔도뉴클레아제를 관심있는 임의의 게놈 유전자좌로 향하게 할 수있게합니다. 이는 DSB 복구 연구에 적용될 수 있으며, Cas9 유도 DSB를 플랭킹하는 DNA에 초점을 맞출 수 있도록 함으로써 차세대 시퀀싱을 보다 비용 효율적으로 만들 수 있습니다. 원고의 목표는 CD4 유전자의 DSB 상류의 복구로부터 유래하는 돌연변이를 정의할 수 있는 프로토콜을 제시함으로써 이러한 접근법의 실현 가능성을 입증하는 것이다. 이 프로토콜은 비교적 제한된 계산 요구 사항을 가진 복구 억제제, 바이러스 단백질 발현, 돌연변이 및 환경 노출과 같은 외인성 인자와 관련된 DSB의 돌연변이 유발 잠재력의 변화를 결정하도록 적응될 수 있다. 일단 유기체의 게놈이 시퀀싱되면, 이 방법은 이론적으로 임의의 게놈 유전자좌 및 형질감염될 수 있는 그 유기체의 임의의 세포 배양 모델에서 사용될 수 있다. 접근법의 유사한 적응은 동일한 유전 적 배경에서 다른 유전자좌 사이의 복구 충실도의 비교를 허용 할 수 있습니다.

이 프로토콜에 대한 세 가지 대표적인 결과가 제시됩니다. 도 1 은 HFK 대조군(LXSN) 및 HFK 발현 베타-HPV 8E6(8E6)에서 CAS9의 발현을 확인한 면역블랏이다. 형질감염 48시간 후, 전체 세포 용해물을 수확하고, 이어서 항-CAS9 항체 (또는 로딩 대조군으로서 GAPDH)로 프로빙하였다. 결과는 HFK LXSN 및 HFK 8E6이 유사한 양의 CAS9를 발현한다는 것을 보여주며, 이는 형?...

Watch this Scientific Journal Video about Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter at JoVE.com

Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter

여기에 제시된 것은 CD4 프로모터 근처의 이중 가닥 파단 복구와 관련된 돌연변이를 확인하는 데 사용할 수있는 sgRNA/CAS9 엔도뉴클레아제 및 차세대 시퀀싱 프로토콜입니다.

차세대 시퀀싱을 사용하여 CD4 프로모터 근처의 CAS9 유도 이중 가닥 파단의 복구와 관련된 돌연변이 확인

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication ...

이 프로토콜은 단일 가이드 RNA 및 CAS9에 의해 유도된 이중 가닥 파단의 복구 중에 발생하는 돌연변이를 식별하는 데 도움이 됩니다. 이 기술의 가장 큰 장점은 특정 게놈 유전자좌에서 돌연변이를 탐지하는 비용 효율적이고 강력한 방법이라는 것입니다. 우리는 인간 각질세포를 예로 들지만, 이 프로토콜은 임의의 형질감염 가능한 세포주에 적응될 수 있다.이 프로토콜을 시연하는 것은 우리 실험실의 학부 조교 인 Taylor Bugbee가 될 것입니다. 시작하기 위해, HFK LXSN 및 HFK 8E6 세포를 섭씨 37도의 10센티미터 플레이트에서 5% 이산화탄소와 함께 인간 각질세포 성장 보충제 및 1% 페니실린 스트렙토마이신과 함께 케라티노사이트 배양 배지를 함유하는 재킷 배양기에서 배양한다. 배양 배지를 3밀리리터의 트립신-EDTA로 교체하고 섭씨 37도에서 3분 동안 배양한다.그런 다음 동일한 양의 FBS 보충 배지로 트립신을 중화하십시오. 이제 세포를 15 밀리리터 원심분리 튜브로 옮기고 300 배 G에서 5 분 동안 원심 분리하십시오. 인간 각질세포 성장 보충제로 10 밀리리터의 각질세포 배양 배지로 세포를 재현탁시키고 혈구분석기로 세포의 농도를 결정한다.그 후, HFK LXSN 및 HFK 8E6 세포에 대해 각각 두 개의 플레이트를 인간 각질세포 성장 보충제 및 1% 페니실린 스트렙토마이신과 함께 4밀리리터의 케라티노사이트 배양 배지에 시드한다. 시딩 후, 세포를 섭씨 37도, 5% 이산화탄소에서 재킷 인큐베이터에서 배양한다. 형질 감염 당일, 3 밀리리터의 항생제가없는 보충 배지로 배지를 교체하고 재킷 인큐베이터에서 섭씨 37도에서 두 시간 동안 배양하십시오.세포를 형질감염시키기 위해, 트랜스펙션 시약을 실온으로 가온하고 사용하기 전에 부드럽게 피펫한다. 적절한 양의 형질감염 완충액을 각 세포주에 대해 두 개의 멸균 1.5밀리리터 원심분리 튜브에 놓고 이를 튜브 하나와 모의 트랜스펙션, 또는 튜브 둘로 라벨링한다. 이어서, 플라스미드 DNA 발현, CAS9, 단일-가이드, RNA-표적화 인간 CD4의 두 마이크로그램을 튜브 하나와 피펫에 첨가하여 완전히 혼합한다.같은 양의 멸균수를 튜브 두 개에 넣으십시오. 적절한 양의 트랜스펙션 시약을 DNA 혼합물로 튜브 하나와 모의 트랜스펙션 또는 튜브 두개에 첨가한다. 피펫을 사용하여, 이들을 완전히 부드럽게 혼합하고 실온에서 15 내지 30분 동안 인큐베이션하여 복합체를 형성한다.트랜스펙션 혼합물을 플레이트에 적가하고, 배양 플레이트를 일분 동안 부드럽게 흔들어 트랜스펙션 혼합물을 고르게 분배한다. 트립신화에 의해 세포를 수확하기 위해, 배양 배지를 트립신 EDTA 한 밀리리터로 교체하고 섭씨 37도에서 3분 동안 배양한다. 그런 다음 동일한 양의 FBS 보충 배지로 트립신을 중화하십시오.세포의 각 플레이트에 대해, 세포 현탁액을 동일한 분취량으로 두 개의 미세원심분리 튜브로 옮기고 5분 동안 300배 G에서 원심분리한다. 원심분리 후, 시퀀싱을 위해 한 밀리리터의 PBS에 한 밀리리터의 PBS에 세포 펠릿을 재현탁시키고, 면역블롯을 위해 얼음처럼 차가운 PBS로 다른 튜브에 재현탁시킨다. 면역블롯 분석은 형질감염되지 않은 HFK 세포와 형질감염된 HFK 세포에서의 CAS9 발현을 비교하기 위해 수행되었다.결과는 형질감염되지 않은 HFK 세포가 유사한 양의 CAS9를 발현한다는 것을 보여주며, 이는 형질감염 효율이 두 세포주 사이에서 유사하다는 것을 나타낸다. SgRNA/CAS9 형질감염된 세포 및 형질감염되지 않은 대조군에서 인산화된 히스톤 H2AX S139의 면역형광 현미경 이미지를 수득하였다. 결과는 두 개의 이중 가닥 파단이 CAS9 SgRNA에 의해 유도되었음을 나타내었다.게놈 변이는 HFK LXSN 및 HFK 8E6에서의 돌연변이 사건의 유형별로 분류되었고, 여기서 게놈 변이의 각 그룹과 HFK LXSN과 HFK 8E6 사이의 총 변이의 수를 비교하였다. 결과는 8E6이 CAS9로 유도된 이중 가닥 파단 주위에서 200킬로베이스 내에서 게놈 변이를 증가시킨다는 것을 보여주었으며, 이는 HPV 8E6이 이중 가닥 파괴 복구를 조절하지 않고 게놈 불안정성을 증가시킨다는 것을 나타낸다. 면역 블롯의 목적은 데이터 분석 중에 고려되어야하는 형질감염 효율을 측정하는 것입니다.형질감염 효율 이외에, 면역형광 현미경은 마커로서 포스포-H2AX를 사용하여 이중 가닥 파단 유도를 확인하기 위해 사용될 수 있었다. 우리는 베타 HPV 8E6을 예로 사용합니다. 이 기술은 소분자 억제제와 같은 다른 시약에 의해 유발되는 돌연변이 빈도 또는 유형의 변화를 검출하는데 사용될 수 있다.

Research

JoVE Journal

Genetics

Wild-type Blocking PCR Combined with Direct Sequencing as a Highly Sensitive Method for Detection of Low-Frequency Somatic Mutations

와일드 형은 PCR은 낮은 주파수 체세포 돌연변이의 검출을위한 고감도 방법으로 직접 시퀀싱과 결합 블로킹

Accurate detection and identification of low frequency mutations can be problematic when assessing residual disease after therapy, screening for emerging ...

연구

유전학

Detection of Copy Number Alterations Using Single Cell Sequencing

단일 셀 시퀀싱을 사용하여 복사 번호 수선의 검출

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Optimization and Comparative Analysis of Plant Organellar DNA Enrichment Methods Suitable for Next-generation Sequencing

차세대 시퀀싱에 적합한 식물성 세포질 DNA 농축 방법의 최적화 및 비교 분석

Plant organellar genomes contain large, repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Chromatin Immunoprecipitation을 이용한 c-KIT 리간드 프로모터 분석

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

네이티브 Chromatin Immunoprecipitation Nucleosome 밀도 분석을 위한 라이브러리를 시퀀싱의 세대

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

유전자 교란 mutans 연쇄 상 구 균 긴장 없이 유전자 복제의 생성

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

강력한 DNA 고립과 표 본관 표본에 대 한 높은 처리량 시퀀싱 도서관 건축

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease

다음-세대 시퀀싱과 생물 정보학 파이프라인 헌법 질병의 유전 결정 요인 평가 대상

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

발기인 캡처 안녕-c: 고해상도, 게놈 넓은 발기인 상호 작용의 프로 파일링

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

다음-세대 시퀀싱에 대 한 전체 길이 HIV-1 Proviruses 근처의 증폭

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...