Name: optical tweezers to study rna-protein interactions in translation regulation
Uploaded: 2022-02-12T13:00:00
Description: Watch this Scientific Journal Video about Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation at JoVE.com

हम अनुजा किबे और जून प्रोफेसर रेडमंड स्मिथ को पांडुलिपि की गंभीर रूप से समीक्षा करने के लिए धन्यवाद देते हैं। हम विशेषज्ञ तकनीकी सहायता के लिए तात्याना कोच को धन्यवाद देते हैं। हम प्रयोगात्मक वीडियो रिकॉर्डिंग के साथ मदद के लिए Kristyna Pekarkova धन्यवाद. हमारी प्रयोगशाला में काम हेल्महोल्ट्ज़ एसोसिएशन द्वारा समर्थित है और यूरोपीय अनुसंधान परिषद (ईआरसी) ग्रांट एनआर 948636 (नेकां के लिए) से वित्त पोषण करता है।

1. नमूना तैयारी
<ol><li>लैम्ब्डा डीएनए टुकड़े वाले वेक्टर में ब्याज के अनुक्रम को क्लोन करें, जो हैंडल अनुक्रमों (चित्रा 2) 43,50 के रूप में कार्य करता है।</li>
	<li>पहले पीसीआर ...

यहां, हम विभिन्न लिगैंडों के साथ आरएनए अणुओं के इंटरैक्शन और गतिशील व्यवहार का अध्ययन करने के लिए प्रतिदीप्ति-युग्मित ऑप्टिकल चिमटी के उपयोग का प्रदर्शन करते हैं। नीचे, वर्तमान तकनीक के महत्वपूर्ण च?...

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacterial Strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli HB101</td>
			<td>lab collection</td>
			<td>N/A</td>
			<td>cloning of the vectors</td>
		</tr>
		<tr>
			<td>Chemicals and enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma-Aldrich</td>
			<td>31424</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Biotin-16-dUTP</td>
			<td>Roche</td>
			<td>11093070910</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A4737</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Catalase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Melford Labs</td>
			<td>D11000</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>DNAse I from bovine pancreas</td>
			<td>Sigma-Aldrich</td>
			<td>D4527</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Th.Geyer</td>
			<td>11786181</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>E9884</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma-Aldrich</td>
			<td>11814320001</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270-1KG</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>Glucose-oxidase</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>Oxygen scavanger system</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>HN78.3</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Carl Roth</td>
			<td>2189.1</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Phusion DNA polymerase</td>
			<td>NEB</td>
			<td>M0530L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Merck</td>
			<td>529552-1KG</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>PrimeSTAR GXL DNA Polymerase</td>
			<td>Takara Bio Clontech</td>
			<td>R050A</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Pyrophosphotase, thermostabile, inorganic</td>
			<td>NEB</td>
			<td>M0296L</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>Molox</td>
			<td>1000379515</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>rNTPS</td>
			<td>life technologies</td>
			<td>R0481</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Sodium thiosulophate</td>
			<td>Sigma-Aldrich</td>
			<td>S6672-500G</td>
			<td>Bleach deactivation</td>
		</tr>
		<tr>
			<td>Sytox Green</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>confocal measurements</td>
		</tr>
		<tr>
			<td>T4 DNA Polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td>Biotinylation</td>
		</tr>
		<tr>
			<td>T5 exonuclease</td>
			<td>NEB</td>
			<td>M0363S</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>T7 RNA polymerase</td>
			<td>Produced in-house</td>
			<td>N/A</td>
			<td>in vitro transcription</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>NEB</td>
			<td>M0267S</td>
			<td>PCR</td>
		</tr>
		<tr>
			<td>Taq ligase</td>
			<td>Biozym</td>
			<td>L6060L</td>
			<td>Gibson assembly, cloning</td>
		</tr>
		<tr>
			<td>TWEEN 20 BioXtra</td>
			<td>Sigma-Aldrich</td>
			<td>P7949</td>
			<td>Buffers</td>
		</tr>
		<tr>
			<td>Kits</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive)</td>
			<td>Nanotemper</td>
			<td>MO-L011</td>
			<td>Used for ribosome labeling</td>
		</tr>
		<tr>
			<td>Purefrex 2.0</td>
			<td>GeneFrontier</td>
			<td>PF201-0.25-EX</td>
			<td>Ribosomes used for the labeling</td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#39; handle T7 forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CTTAATACGACTCACTATAGGTC 
			CTTTCTGTGGACGCC - 3&#8217;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -&#160; GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate OT in vitro transcription template in PCR 1</td>
		</tr>
		<tr>
			<td>5&#39; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - TCCTTTCTGTGGACGCCGC - 3&#39; , used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>5&#8217; handle reverse</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#8217; - CATAAATACCTCTTTACTAATATA 
			TATACCTTCGTAAGCTAGCGT - 3&#8217;, used to generate 5&#39; handle in PCR 2</td>
		</tr>
		<tr>
			<td>3&#8217; handle forward</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; - ATCCTGCAACCTGCTCTTCGCC 
			AG - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>3&#8217; handle reverse 5&#8217;labeled with digoxigenin</td>
			<td>Microsynth</td>
			<td>custom order</td>
			<td>5&#39; -[Dig]-GTCAAAGTGCGCCCCGTTATCC - 3&#39;, used to generate 3&#39; handle in PCR 3</td>
		</tr>
		<tr>
			<td>DNA vectors</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMZ_OT</td>
			<td>produced in-house</td>
			<td>N/A</td>
			<td>further description in &#34;Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control&#34; 
			Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley 
			bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035</td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Atom</td>
			<td>https://atom.io/packages/ide-python</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Bluelake</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Graphpad</td>
			<td>https://www.graphpad.com/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>InkScape 0.92.3</td>
			<td>https://inkscape.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Matlab</td>
			<td>https://www.mathworks.com/products/matlab.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>POTATO</td>
			<td>https://github.com/lpekarek/POTATO.git</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAstructure</td>
			<td>https://rna.urmc.rochester.edu/RNAstructure.html</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Spyder</td>
			<td>https://www.spyder-ide.org/</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Other</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin Coated Polystyrene Particles, 1.5-1.9 &#181;m, 5 ml, 1.0% w/v</td>
			<td>Spherotech</td>
			<td>SVP-15-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 &#181;m, 2 ml, 0.1% w/v</td>
			<td>Spherotech</td>
			<td>DIGP-20-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringes</td>
			<td>VWR</td>
			<td>TERUMO SS+03L1</td>
			<td></td>
		</tr>
		<tr>
			<td>Devices</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>C-trap</td>
			<td>Lumicks</td>
			<td>N/A</td>
			<td>&#160;optical tweezers coupled with confocal microscopy</td>
		</tr>
	</tbody>
</table>

optical tweezers to study rna-protein interactions in translation regulation

आरएनए विविध संरचनात्मक सिलवटों को अपनाता है, जो इसके कार्यों के लिए आवश्यक हैं और इस प्रकार सेल में विभिन्न प्रक्रियाओं को प्रभावित कर सकते हैं। इसके अलावा, एक आरएनए की संरचना और कार्य को विभिन्न ट्रांस-एक्टिंग कारकों, जैसे कि प्रोटीन, मेटाबोलाइट्स या अन्य आरएनए द्वारा संशोधित किया जा सकता है। उदाहरण के लिए, फ्रेमशिफ्टिंग आरएनए अणु, कोडिंग क्षेत्रों में स्थित नियामक आरएनए हैं, जो राइबोसोम को एक वैकल्पिक खुले पढ़ने के फ्रेम में सीधे अनुवाद करते हैं, और इस तरह जीन स्विच के रूप में कार्य करते हैं। वे प्रोटीन या अन्य ट्रांस-कारकों के लिए बाध्य होने के बाद विभिन्न सिलवटों को भी अपना सकते हैं। अनुवाद में आरएनए-बाइंडिंग प्रोटीन की भूमिका को विच्छेदित करने के लिए और वे आरएनए संरचना और स्थिरता को कैसे संशोधित करते हैं, इन आरएनए-प्रोटीन परिसरों की इंटरप्ले और यांत्रिक विशेषताओं का एक साथ अध्ययन करना महत्वपूर्ण है। यह काम दिखाता है कि एक उच्च रिज़ॉल्यूशन पर आरएनए-प्रोटीन परिसरों के संरचनात्मक और थर्मोडायनामिक परिदृश्य का पता लगाने के लिए एकल-अणु-प्रतिदीप्ति-युग्मित ऑप्टिकल चिमटी को कैसे नियोजित किया जाए। एक उदाहरण के रूप में, सार्स-कोव -2 प्रोग्राम किए गए राइबोसोमल फ्रेमशिफ्टिंग तत्व की बातचीत जस्ता-उंगली एंटीवायरल प्रोटीन के ट्रांस-एक्टिंग फैक्टर शॉर्ट आइसोफॉर्म के साथ विस्तृत है। इसके अलावा, प्रतिदीप्ति-लेबल वाले राइबोसोम की निगरानी कॉन्फोकल इकाई का उपयोग करके की गई थी, जो अंततः अनुवाद बढ़ाव के अध्ययन को सक्षम करेगा। प्रतिदीप्ति युग्मित ओटी परख व्यापक रूप से विविध आरएनए-प्रोटीन परिसरों या ट्रांस-अभिनय कारकों का पता लगाने के लिए लागू किया जा सकता है जो अनुवाद को विनियमित करते हैं और आरएनए-आधारित जीन विनियमन के अध्ययन की सुविधा प्रदान कर सकते हैं।

इस अनुभाग में, फोकस मुख्य रूप से प्रतिदीप्ति ऑप्टिकल चिमटी द्वारा आरएनए-प्रोटीन / लिगैंड इंटरैक्शन के माप पर दिया जाता है। सामान्य आरएनए ऑप्टिकल चिमटी प्रयोगों और इसी प्रतिनिधि परिणामों के विवरण के ल?...

Watch this Scientific Journal Video about Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation at JoVE.com

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

यह प्रोटोकॉल ऑप्टिकल चिमटी का उपयोग करके आरएनए-प्रोटीन इंटरैक्शन का अध्ययन करने के लिए एक पूर्ण प्रयोगात्मक वर्कफ़्लो प्रस्तुत करता है। कई संभावित प्रयोगात्मक setups confocal माइक्रोस्कोपी के साथ ऑप्टिकल चिमटी के संयोजन सहित रेखांकित कर रहे हैं.

अनुवाद विनियमन में आरएनए-प्रोटीन इंटरैक्शन का अध्ययन करने के लिए ऑप्टिकल चिमटी

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Research

JoVE Journal

Biochemistry

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Oligonucleotide निर्देशित क्षालन का उपयोग कोशिकाओं से आत्मीय आरएनए प्रोटीन परिसरों का अलगाव

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

Fluorescence Anisotropy as a Tool to Study Protein-protein Interactions

एक उपकरण प्रोटीन, प्रोटीन बातचीत का अध्ययन करने के रूप में प्रतिदीप्ति एनिसोट्रॉपिक

Protein-protein interactions play an essential role in the function of a living organism. Once an interaction has been identified and validated it is ...

Time-resolved ElectroSpray Ionization Hydrogen-deuterium Exchange Mass Spectrometry for Studying Protein Structure and Dynamics

प्रोटीन संरचना और गतिशीलता के अध्ययन के लिए समय का समाधान electrospray ionization हाइड्रोजन-ड्यूटेरियम एक्सचेंज मास स्पेक्ट्रोमेट्री

Intrinsically disordered proteins (IDPs) have long been a challenge to structural biologists due to their lack of stable secondary structure elements. ...

Quantitative Immunofluorescence to Measure Global Localized Translation

मात्रात्मक इम्यूनोफ्लोरेसेंस वैश्विक स्थानीयकृत अनुवाद मापने के लिए

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biotinylated Cell-penetrating Peptides to Study Intracellular Protein-protein Interactions

Biotinylated सेल-मर्मज्ञ पेप्टाइड्स Intracellular प्रोटीन-प्रोटीन बातचीत का अध्ययन करने के लिए

Here we present a protocol to study intracellular protein-protein interactions that is based on the widely used biotin-avidin pull-down system. The ...

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Ribosome profiling द्वारा नवोदित खमीर में अनुवाद के जीनोम चौड़ा ठहराव

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

Using Three-color Single-molecule FRET to Study the Correlation of Protein Interactions

तीन रंग एकल अणु झल्लाहट का उपयोग प्रोटीन बातचीत के सहसंबंध का अध्ययन करने के लिए

Single-molecule F&#246;rster resonance energy transfer (smFRET) has become a widely used biophysical technique to study the dynamics of biomolecules. For ...

Small-Scale Colorimetric Assays of Intracellular Lactate and Pyruvate in the Nematode Caenorhabditis elegans

Small-Scale Colorimetric Assays of Intracellular Lactate and Pyruvate in the Nematode Caenorhabditis elegans

छोटे पैमाने पर वर्णमिति की परख Intracellular स्तनपान और पाइरूवेट में निमेटोड Caenorhabditis एलिगेंस

Lactate and pyruvate are key intermediates of intracellular energy metabolic pathways. Monitoring the lactate/pyruvate ratio in cells helps to determine ...

Interactions with and Membrane Permeabilization of Brain Mitochondria by Amyloid Fibrils

एमीलॉयड फाइब्रिल्स द्वारा मस्तिष्क माइटोकोंड्रिया के साथ और झिल्ली permeabilization के साथ बातचीत

A growing body of evidence indicates that membrane permeabilization, including internal membranes such as mitochondria, is a common feature and primary ...

In Vivo Hydroxyl Radical Protein Footprinting for the Study of Protein Interactions in Caenorhabditis elegans

In Vivo Hydroxyl Radical Protein Footprinting for the Study of Protein Interactions in Caenorhabditis elegans

कैनोरहैब्डिटिस एलिगेंस में प्रोटीन इंटरैक्शन के अध्ययन के लिए वीवो हाइड्रोक्सिल रेडिकल रेडिकल प्रोटीन फुटप्रिंटिंग में

Fast oxidation of proteins (FPOP) is a hydroxyl radical protein footprinting (HRPF) method used to study protein structure, protein-ligand interactions, ...