Name: study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro
Uploaded: 2022-03-07T13:00:00
Description: Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

ونحن ممتنون للدعم التقني من الدكتور تز - لينغ تشن. نشكر المرفق الأساسي الوطني للحمض النووي الريبي (أكاديميا سينيكا ، تايوان) على توفير فيروس الحمض النووي الريبي (http://rnai.genmed.sinica.edu.tw). تم دعم هذا العمل من قبل وزارة العلوم والتكنولوجيا ، تايوان (MOST 108-2320-B-002-037-MY3 و MOST 109-2320-B-002-054-MY3).

يتم التعامل مع فيروس lentivirus وفقا لتنظيم قسم الصحة والسلامة البيئية في كلية الطب بجامعة تايوان الوطنية.
1. إعداد خطوط الخلايا الجذعية المكونة للدم والسلف الخالدة (iHSPCs)
<ol><li>الحفاظ على خط خلية iHSPC في وسط RPMI 1640 كامل يحتوي على 100 نانوغرام / مل FL و 1 ميكرومتر β-استراديول.</li>
	<li>مرور ال...

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

غالبا ما تستخدم ناقلات الحمض النووي الريبوزي المرسال القائمة على فيروس لينتي لإسكات الجينات عن طريق النقل الفيروسي إلى الخلايا وتسمح بالاندماج المستقر في الجينوم المضيف. ومع ذلك ، يجب النظر في كفاءة النقل المختلفة في أنواع الخلايا المختلفة ، وقد تم اتخاذ عدد من النهج للتغلب على هذه المشك...

والبلدان النامية هي المنظم الرئيسي للمناعة الفطرية والتكيفية1. وتصنف البلدان النامية أساسا إلى مجموعتين سكانيتين متميزتين وظيفيا، هما البلدان النامية النامية والبلدان النامية. وعلاوة على ذلك، تتألف البلدان النامية من مجموعتين فرعيتين، هما البلدان النامية من النوع الأول والثاني أو cDC1s و cDC2s، على التوالي2. pDCs ، التي تعبر عن BST2 ، Siglec-H ، والمستويات المتوسطة من CD11c في الفئران3,4 ، هي الخلايا التي يمكن أن تفرز كميات كبيرة من IFN-I أثناء الالتهاب والعدوى الفيروسية 5. نظرا لقدرتها القوية على إنتاج IFN-I ، يشتبه أيضا في أنها تلعب دورا رئيسيا في تطور أمراض المناعة الذاتية ، بما في ذلك الذئبة الحمامية الجهازية (SLE)6. cDC1s ، التي يتم تعريفها من خلال التعبير السطحي ل XCR1 و CD8a و CLEC9A و CD103 في الفئران7 ، متخصصة في تنشيط واستقطاب الخلايا التائية CD8 + السامة للخلايا (CTLs) من خلال العرض المتقاطع للمستضد ، وبالتالي بدء مناعة النوع الأول استجابة لمسببات الأمراض داخل الخلايا والسرطان8,9. من ناحية أخرى ، يمكن ل cDC2s ، التي تعبر عن CD11b و CD172α (المعروفة أيضا باسم Sirpα) في كل من البشر والفئران ، تنشيط خلايا CD4 + T وتعزيز الاستجابة المناعية من النوع الثاني ضد مسببات الحساسية والطفيليات10 ، وكذلك تعديل مناعة النوع الثالث بعد البكتيريا خارج الخلية والتعرف على الميكروبات11,12.
يتم تحديد تنويع DCs بواسطة مجموعة من TFs من الخلايا الجذعية والسلف المكونة للدم (HSPCs) في BM. E2-2 (المشفر بواسطة Tcf4) هو منظم رئيسي للتمايز ووظيفة pDCs13,14. وعلى النقيض من ذلك، فإن مثبط ربط الحمض النووي 2 (ID2) يدفع مواصفات cDC ويمنع تطور PDC من خلال منع نشاط البروتين E15. علاوة على ذلك ، يتطلب تطوير cDC1s IRF8 و BATF3 ، في حين أن التمايز بين cDC2s يعتمد بشكل كبير على IRF416. وقد استكشفت الأعمال الأخيرة عدم تجانس pDCs17 و cDCs ولوائحها النسخية18. ونظرا لتعقيد شبكة الاعتمادات المستندية، هناك حاجة لم تتم تلبيتها لإنشاء منصة لتحديد الأفرقة الفنية الأخرى التي تتحكم في تطوير البلدان النامية ووظائفها.
هنا ، استخدمنا iHSPC الذي تم إنشاؤه عن طريق التعبير عن النقل النووي المنظم لهرمون الاستروجين ل Hoxb8 في خلايا BM (يشار إليها أيضا باسم خلايا Hoxb8-FL)19. يمكن أن تتكاثر iHSPCs وتبقى في مرحلة غير متمايزة في وجود β-estradiol و Flt3 ligand (FL) ، في حين أنها تبدأ في التمايز إلى أنواع DC مختلفة في وجود FL عند سحب β-estradiol19. واستنادا إلى هذه الميزة، يمكننا أن نهدم الجينات ذات الأهمية في مرحلة السلف، تليها دراسة التأثير على التمايز في المختبر بين pDCs و cDCs. لذلك ، هذه الطريقة هي أداة قوية لاكتشاف الجينات التي تنظم تطور ووظيفة DCs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Antibodies</td>
		</tr>
		<tr>
			<td>APC/Cy7 anti-mouse CD11c Antibody</td>
			<td>Biolegend</td>
			<td>117324</td>
			<td>(Clone: N418)</td>
		</tr>
		<tr>
			<td>FITC anti-mouse/human CD11b Antibody</td>
			<td>Biolegend</td>
			<td>101206</td>
			<td>(Clone: M1/70)</td>
		</tr>
		<tr>
			<td>PE anti-mouse/human B220 Antibody</td>
			<td>Biolegend</td>
			<td>103208</td>
			<td>(Clone: RA3-6B2)</td>
		</tr>
		<tr>
			<td colspan="4">Cell culture</td>
		</tr>
		<tr>
			<td>1.5 mL Micro tube</td>
			<td>&#160;ExtraGene</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate</td>
			<td>Falcon</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Corning</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium</td>
			<td>gibco</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Reagent</td>
		</tr>
		<tr>
			<td>&#946;-estradiol</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td>home-made</td>
			<td></td>
			<td>Formula: 1xPBS+0.5 %FBS+0.1%NaN3</td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)</td>
			<td>home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>Sigma-Aldrich</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invivogen</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIsure</td>
			<td>BIOLINE</td>
			<td>BIO-38032</td>
			<td></td>
		</tr>
		<tr>
			<td>shRNA (Taregt sequence/clone ID)</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shId2&#160; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

الخلايا التغصنية (DCs) هي خلايا مهمة تقدم المستضدات تربط الاستجابات المناعية الفطرية والتكيفية. والبلدان النامية غير متجانسة ويمكن تقسيمها إلى بلدان متجانسة تقليدية (cDC) وبلدان بلازماسيتويد (pDC). cDCs متخصصة في تقديم المستضدات إلى الخلايا التائية الساذجة وتنشيطها. من ناحية أخرى ، يمكن أن تنتج PDCs كميات كبيرة من الإنترفيرون من النوع الأول (IFN-I) أثناء العدوى الفيروسية. تحدث مواصفات DCs في مرحلة مبكرة من أسلاف DC في نخاع العظم (BM) ويتم تعريفها من خلال شبكة من عوامل النسخ (TFs). على سبيل المثال ، تعبر cDCs بشكل كبير عن ID2 ، بينما تعبر pDCs بشكل كبير عن E2-2. وبما أنه يجري تحديد المزيد والمزيد من المجموعات الفرعية من البلدان النامية، فإن هناك اهتماما متزايدا بفهم أطر عمل محددة تتحكم في تنمية الاعتمادات المستندية. هنا ، أنشأنا طريقة لفحص TFs الحرجة لتمايز DCs في المختبر من خلال توصيل فيروس lenti الذي يحمل الحمض النووي الريبي القصير (shRNA) إلى خط جذعي مكون للدم وخلية سلفية (iHSPCs) مخلدة. بعد الاختيار والتمايز في المختبر ، يتم تحليل إمكانات cDC و pDC لخطوط الخلايا القاضية المستقرة بواسطة قياس التدفق الخلوي. يوفر هذا النهج منصة لتحديد الجينات التي يحتمل أن تحكم مصائر DC من السلف في المختبر.

تظهر خريطة ناقل الفيروس الخفيف pLKO.1-Puro (الشكل 1). بعد تسليم الفيروس اللينتي الذي يعبر عن shRNA ضد LacZ (عنصر تحكم غير مستهدف) و Tcf4 و Id2 في iHSPCs ، كشفت كفاءة الضربة القاضية التي أكدتها RT-qPCR أن التعبير عن Tcf4 قد انخفض في shTcf4 iHSPCs ، مقارنة ب shLacZ iHSPCs (ا...

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

نقدم هنا بروتوكولا لفحص عوامل النسخ المحتملة المشاركة في تطوير الخلايا التغصنية (DC) باستخدام نقل الفيروس اللاصق ل shRNA للحصول على خطوط خلايا ضربة قاضية مستقرة لتمايز DC في المختبر .

دراسة تطور الخلايا التغصنية بواسطة ضربة قاضية للجين القصير بوساطة الحمض النووي الريبي في جذع مكون للدم وخط خلية سلف في المختبر

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

الخلايا التغصنية ، أو DCs ، هي خلايا مناعية رئيسية تربط بين الجهاز المناعي الفطري والتكيفي. في حين أن DCs غير متجانسة ، فإن هذه الطريقة تساعدنا على فهم الجينات ، بما في ذلك عوامل النسخ ، التي قد تنظم تطور DC. توفر هذه التقنية طريقة بسيطة وسريعة لتحديد الجين الذي يتحكم في تطور التيار المستمر من سلفه في المختبر.للبدء ، حافظ على الخلايا الجذعية والسلفية المكونة للدم الخالدة أو iHSPCs في وسط RPMI 1640 الكامل ، مع استكمال 100 نانوغرام لكل ملليلتر من رباط FLT3 واستراديول بيتا ميكرومولار واحد. بالنسبة لنقل الفيروس ، قم بلوحة iHSPCs في 12 لوحة بئر بكثافة واحدة من 10 إلى الخلايا الخامسة لكل بئر وملليلتر واحد من الوسط الكامل الذي يحتوي على رابط FLT3 وبيتا استراديول والبوليبرين. ثم أضف فيروس lentivirus الذي يحمل الحمض النووي الريبي القصير في كل بئر في عدد كبير من العدوى يبلغ 100.بعد ذلك ، قم بتدوير اللوحة عند 1100 مرة g و 37 درجة مئوية لمدة 90 دقيقة ، ثم احتضن الخلايا المصابة بين عشية وضحاها عند 37 درجة مئوية. في اليوم التالي ، قم بإزالة البوليبرين عن طريق جمع الخلايا في أنابيب 15 ملليلتر في الطرد المركزي ، بعد استبدال الوسائط بوسط كامل جديد يحتوي على FLT3 ligand و beta estradiol. بعد 24 ساعة إضافية ، أضف ستة ميكروغرام لكل ملليلتر من البوروميسين إلى الوسط لتحديد الخلايا المصابة.استبدل وسيط التحديد كل ثلاثة أيام وحافظ على الخلايا لمدة أسبوع واحد على الأقل لتوسيع iHSPCs المحولة بثبات. قم بإنشاء والحفاظ على iHSPCs ضربة قاضية مستقرة ل LacZ و Tcf4 و Id2 في وسط كامل مكمل ب FLT3 ligand و beta estradiol. لبدء التمايز في المختبر ، قم بجمع iHSPCs غير المتمايزة في أنابيب 15 ملليلتر وتكوير الخلايا عن طريق الطرد المركزي.بعد الطرد المركزي ، تخلص من المادة الفائقة واغسل الخلايا مرتين ب 10 ملليلتر من PBS. بعد الغسيل الثاني ، أعد تعليق الخلايا في وسط كامل يحتوي فقط على رابط FLT3 ثم زرعها بكثافة مرتين 10 إلى الخامسة التي تباع لكل ملليلتر في صفيحة بئر 12. بعد ثلاثة أيام ، أضف ملليلتر واحد من الوسط الكامل الطازج الذي يحتوي على رابط FLT3.بعد يومين إضافيين ، انتقل إلى تحليل الخلايا المتمايزة عن طريق قياس التدفق الخلوي. لتحليل التدفق الخلوي ، قم بماصة الخلايا لأعلى ولأسفل مرتين إلى ثلاث مرات في اللوحة ثم قم بجمع الخلايا في أنابيب 1.5 ملليلتر. قم بطرد الأنابيب وتخلص من المادة الفائقة قبل إعادة تعليق الخلايا في 50 ميكرولتر من المخزن المؤقت للفاكس.بعد ذلك ، أضف 50 ميكرولتر من مضاد CD16 بواسطة 32 hybridoma supernatant واحتضن لمدة خمس إلى 10 دقائق على الجليد. ثم ، أضف الأجسام المضادة المترافقة بصبغة الفلورسنت مباشرة إلى الخلايا واحتضنها لمدة 15 دقيقة على الجليد في الظلام. بعد الحضانة ، اغسل الخلايا بمليلتر واحد من المخزن المؤقت للفاكس وقم بطرد العينة.بعد الطرد المركزي ، أعد تعليق الخلايا في 100 ميكرولتر من المخزن المؤقت للفاكس وقم بتحليل العينات عن طريق قياس التدفق الخلوي. بعد الضربة القاضية القصيرة بوساطة الحمض النووي الريبي ل LacZ و Tcf4 و Id2 في iHSPCS ، أظهر تأكيد كفاءة الضربة القاضية بواسطة RTQ-PCR أن التعبير عن الضربة القاضية Tcf4 و Tcf4 تم تقليله مقارنة بالضربة القاضية iHSPCs في LacZ. وقد لوحظت نتائج مماثلة للتعبير عن Id2 في الضربة القاضية Id2 iHSPCs.بعد زراعة LacZ ضربة قاضية iHSPCs لمدة خمسة أيام ، كان تواتر الخلايا الإيجابية CD11c ، التي تمثل مجموعة الخلايا التغصنية ، حوالي 95 ٪ ومع ذلك ، فإن هدم Tcf4 أو Id2 قلل قليلا من توليد الخلايا التغصنية الإيجابية CD11c. كشف مزيد من التحليل للخلايا التغصنية الإيجابية CD11c المشتقة من ضربة قاضية LacZ iHSPCs أن 70٪ كانت خلايا تغصنية تقليدية بينما كانت 22٪ خلايا تغصنية بلازماسيتويد. ولدت الضربة القاضية Tcf4 iHSPCs نسبة أقل بكثير من الخلايا التغصنية البلازمية التي تتحكم فيها ضربة LacZ.في المقابل ، ولدت iHSPCs الضربة القاضية Id2 نسبة أقل بكثير من الخلايا المتغصنة التقليدية من عناصر التحكم في ضربة قاضية LacZ ولكن نسبة أعلى من الخلايا التغصنية البلازميتويدية. تزيد عدوى الدوران من كفاءة نقل الحمض النووي الريبوزي المرسال الحامل للفيروس إلى iHSPCs. تتناول هذه التقنية دور عوامل النسخ وتسهل دراسة الجينات الأخرى في نقل إشارات السيتوكين أو التمثيل الغذائي ، والتي من المحتمل أن تشارك في تطوير DC.

Research

JoVE Journal

Immunology and Infection

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

توليد خلايا T - Multivirus محددة لمنع / علاج الالتهابات الفيروسية خيفي بعد زرع الخلايا الجذعية المكونة للدم

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

تحليل الرئوي نضوج خلية شجيري والهجرة خلال التهاب الشعب الهوائية التحسسي

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

بي ار بي كنهج جديد للوقاية من العدوى: إعداد و<em&gt; في المختبر</em&gt; الخصائص المضادة للميكروبات من PRP

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, ...

Generation of a Novel Dendritic-cell Vaccine Using Melanoma and Squamous Cancer Stem Cells

جيل من لقاح جديد للخلايا التشجرية باستخدام الميلانوما والخلايا الجذعية السرطانية الحرشفية

We identified cancer stem cell (CSC)-enriched populations from murine melanoma D5 syngeneic to C57BL/6 mice and the squamous cancer SCC7 syngeneic to C3H ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

خط خلية التتراسيكلين التنظيم وتنتج ناقلات lentiviral عالي عيار التي تستهدف على وجه التحديد خلايا الجذعية

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

تحديد الطفرات الحمض النووي في الخلايا الجذعية المكونة للدم تنقية / السلف

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

تقييم تطوير خلايا الفئران الجذعية بلازماوية في بقع باير طريق نقل بالتبني من أسلاف المكونة للدم

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

مقاربة بسيطة وفعالة لبناء ناقلات الفيروسات المسخ الوقس

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

التنمية وتحديد جزء من السكان رواية من المستمدة العدلات-الإنسان البالعات العملاق<em&gt; في المختبر</em

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

بروتوكول نفطة شفط لدراسة الخلية تي البشرية استدعاء الاستجابات في فيفو

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...