Name: study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro
Uploaded: 2022-03-07T13:00:00
Description: Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

हम डॉ Tz-Ling चेन से तकनीकी सहायता के लिए आभारी हैं। हम shRNA lentivirus (http://rnai.genmed.sinica.edu.tw) प्रदान करने के लिए राष्ट्रीय आरएनएई कोर सुविधा (अकादमिक Sinica, ताइवान) को धन्यवाद देते हैं। इस काम को विज्ञान और प्रौद्योगिकी मंत्रालय, ताइवान (MOST 108-2320-B-002-037-MY3 और MOST 109-2320-B-002-054-MY3) द्वारा समर्थित किया गया था।

लेंटीवायरस की हैंडलिंग राष्ट्रीय ताइवान यूनिवर्सिटी कॉलेज ऑफ मेडिसिन के पर्यावरणीय स्वास्थ्य और सुरक्षा विभाग के विनियमन के अनुसार की जाती है।
1. अमर हेमटोपोइएटिक स्टेम और पूर्वज सेल लाइन?...

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

लेंटिवायरस-आधारित एसएचआरएनए वैक्टर का उपयोग अक्सर कोशिकाओं में वायरल ट्रांसडक्शन द्वारा जीन मौन के लिए किया जाता है और मेजबान जीनोम में स्थिर एकीकरण की अनुमति देता है। हालांकि, विभिन्न सेल प्रकारों ...

डीसी जन्मजात और अनुकूली प्रतिरक्षा 1 के प्रमुख नियामक हैं। डीसी को मुख्य रूप से दो कार्यात्मक रूप से अलग-अलग आबादी में वर्गीकृत किया जाता है, अर्थात् पीडीसी और सीडीसी। इसके अलावा, cDCs में दो सबसेट शामिल हैं, अर्थात्, टाइप I और टाइप II cDCs या cDC1s और cDC2s, क्रमशः। पीडीसी, बीएसटी 2, सिग्लेक-एच, और चूहों 3, 4 में सीडी 11 सी के मध्यवर्ती स्तरों को व्यक्त करते हुए, कोशिकाएं हैं जो सूजन और वायरल संक्रमण 5 के दौरान बड़ी मात्रा में आईएफएन-आई का स्राव कर सकती हैं। उनकी मजबूत आईएफएन-आई-उत्पादक क्षमता के कारण, उन्हें ऑटोइम्यून बीमारियों की प्रगति में महत्वपूर्ण भूमिका निभाने का भी संदेह है, जिसमें प्रणालीगत ल्यूपस एरिथेमेटोसस (एसएलई) 6 शामिल हैं। cDC1s, XCR1, CD8a, CLEC9A, और MICE7 में CD103 की सतह अभिव्यक्ति द्वारा परिभाषित, एंटीजन क्रॉस-प्रस्तुति के माध्यम से साइटोटोक्सिक CD8 + T कोशिकाओं (CTLs) के सक्रियण और ध्रुवीकरण में विशिष्ट हैं, जिससे इंट्रासेल्युलर रोगजनकों और कैंसर 8,9 के जवाब में प्रकार I प्रतिरक्षा शुरू होती है। दूसरी ओर, CDC2s, दोनों मनुष्यों और चूहों में CD11b और CD172α (जिसे Sirpα के रूप में भी जाना जाता है) को व्यक्त करते हुए, CD4 + T कोशिकाओं को सक्रिय कर सकते हैं और एलर्जीन और परजीवी 10 के खिलाफ टाइप II प्रतिरक्षा प्रतिक्रिया को बढ़ावा दे सकते हैं, साथ ही साथ बाह्य कोशिकीय बैक्टीरिया और माइक्रोबायोटा मान्यता 11,12 के बाद प्रकार III प्रतिरक्षा को संशोधित कर सकते हैं।
डीसी का विविधीकरण BM में हेमटोपोइएटिक स्टेम और पूर्वज कोशिकाओं (HSPCs) से TFs के एक समूह द्वारा निर्धारित किया जाता है। E2-2 (Tcf4 द्वारा एन्कोडेड) pDCs13,14 के विभेदन और कार्य के लिए एक मास्टर नियामक है। इसके विपरीत, डीएनए बाइंडिंग 2 (आईडी 2) का अवरोधक सीडीसी विनिर्देश को चलाता है और ई प्रोटीन गतिविधि को अवरुद्ध करने के माध्यम से पीडीसी विकास को रोकता है। इसके अलावा, cDC1s के विकास के लिए IRF8 और BATF3 की आवश्यकता होती है, जबकि cDC2s का विभेदन अत्यधिक IRF416 पर निर्भर करता है। हाल के कार्यों ने pDCs17 और cDCs की विषमता और उनके ट्रांसक्रिप्शनल विनियमन 18 का पता लगाया है। डीसी नेटवर्क की जटिलता के कारण, डीसी के विकास और कार्यक्षमता को नियंत्रित करने वाले अन्य टीएफ की पहचान करने के लिए एक मंच स्थापित करने की आवश्यकता है।
यहां, हमने एक आईएचएसपीसी का उपयोग किया जो बीएम कोशिकाओं में होक्सबी 8 के एस्ट्रोजन-विनियमित परमाणु स्थानांतरण को व्यक्त करके उत्पन्न किया गया था (जिसे होक्सबी 8-एफएल कोशिकाओं के रूप में भी जाना जाता है) 19। iHSPCs β-एस्ट्राडियोल और Flt3 लिगैंड (FL) की उपस्थिति में एक अविभाजित चरण में फैल सकते हैं और रह सकते हैं, जबकि वे β-एस्ट्राडियोल 19 की वापसी पर FL की उपस्थिति में विभिन्न डीसी प्रकारों में अंतर करना शुरू करते हैं। इस विशेषता के आधार पर, हम पूर्वज चरण में ब्याज के जीन को खटखटा सकते हैं, इसके बाद पीडीसी और सीडीसी के इन विट्रो भेदभाव पर प्रभाव की जांच कर सकते हैं। इसलिए, यह विधि उन जीनों की खोज करने के लिए एक शक्तिशाली उपकरण है जो डीसी के विकास और कार्य को विनियमित करते हैं।

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Antibodies</td>
		</tr>
		<tr>
			<td>APC/Cy7 anti-mouse CD11c Antibody</td>
			<td>Biolegend</td>
			<td>117324</td>
			<td>(Clone: N418)</td>
		</tr>
		<tr>
			<td>FITC anti-mouse/human CD11b Antibody</td>
			<td>Biolegend</td>
			<td>101206</td>
			<td>(Clone: M1/70)</td>
		</tr>
		<tr>
			<td>PE anti-mouse/human B220 Antibody</td>
			<td>Biolegend</td>
			<td>103208</td>
			<td>(Clone: RA3-6B2)</td>
		</tr>
		<tr>
			<td colspan="4">Cell culture</td>
		</tr>
		<tr>
			<td>1.5 mL Micro tube</td>
			<td>&#160;ExtraGene</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate</td>
			<td>Falcon</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Corning</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium</td>
			<td>gibco</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Reagent</td>
		</tr>
		<tr>
			<td>&#946;-estradiol</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td>home-made</td>
			<td></td>
			<td>Formula: 1xPBS+0.5 %FBS+0.1%NaN3</td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)</td>
			<td>home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>Sigma-Aldrich</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invivogen</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIsure</td>
			<td>BIOLINE</td>
			<td>BIO-38032</td>
			<td></td>
		</tr>
		<tr>
			<td>shRNA (Taregt sequence/clone ID)</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shId2&#160; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

डेंड्राइटिक कोशिकाएं (डीसी) महत्वपूर्ण एंटीजन-प्रस्तुत करने वाली कोशिकाएं हैं जो जन्मजात और अनुकूली प्रतिरक्षा प्रतिक्रियाओं को जोड़ती हैं। डीसी विषम हैं और इन्हें पारंपरिक डीसी (सीडीसी) और प्लाज्मासाइटोइड डीसी (पीडीसी) में विभाजित किया जा सकता है। cDCs करने के लिए एंटीजन प्रस्तुत करने और भोले टी कोशिकाओं को सक्रिय करने में माहिर हैं. दूसरी ओर, पीडीसी वायरल संक्रमण के दौरान बड़ी मात्रा में टाइप I इंटरफेरॉन (IFN-I) का उत्पादन कर सकते हैं। डीसी का विनिर्देश अस्थि मज्जा (बीएम) में डीसी पूर्वजों के प्रारंभिक चरण में होता है और प्रतिलेखन कारकों (टीएफ) के नेटवर्क द्वारा परिभाषित किया जाता है। उदाहरण के लिए, cDCs अत्यधिक व्यक्त ID2, जबकि pDCs अत्यधिक E2-2 व्यक्त करते हैं। चूंकि डीसी के अधिक से अधिक सबसेट की पहचान की जा रही है, इसलिए डीसी विकास को नियंत्रित करने वाले विशिष्ट टीएफ को समझने में रुचि बढ़ रही है। यहां, हम एक अमर हेमटोपोइएटिक स्टेम और पूर्वज सेल (आईएचएसपीसी) लाइन में छोटे हेयरपिन आरएनए (shRNA) को ले जाने वाले लेंटीवायरस को वितरित करके विट्रो में डीसी भेदभाव के लिए महत्वपूर्ण टीएफ को स्क्रीन करने के लिए एक विधि स्थापित करते हैं। चयन और इन विट्रो भेदभाव के बाद, स्थिर नॉकडाउन सेल लाइनों की सीडीसी और पीडीसी क्षमता का विश्लेषण फ्लो साइटोमेट्री द्वारा किया जाता है। यह दृष्टिकोण विट्रो में पूर्वजों से संभावित रूप से डीसी भाग्य को नियंत्रित करने वाले जीन की पहचान करने के लिए एक मंच प्रदान करता है।

लेंटिवायरल वेक्टर pLKO.1-Puro का नक्शा दिखाया गया है (चित्र 1)। LacZ (एक गैर-लक्ष्यीकरण नियंत्रण), Tcf4, और iHSPCs में Id2 के खिलाफ shRNA व्यक्त lentivirus के वितरण के बाद, RT-qPCR द्वारा पुष्टि की नॉकडाउन दक्षता से पत?...

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

यहां हम इन विट्रो डीसी भेदभाव के लिए स्थिर नॉकडाउन सेल लाइनों को प्राप्त करने के लिए shRNA के लेंटिवारल ट्रांसडक्शन का उपयोग करके डेंड्राइटिक सेल (डीसी) के विकास में शामिल संभावित प्रतिलेखन कारकों की स्क्रीनिंग के लिए एक प्रोटोकॉल प्रदान करते हैं।

एक हेमटोपोइएटिक स्टेम और पूर्वज सेल लाइन इन विट्रो में शॉर्ट हेयरपिन आरएनए-मध्यस्थता जीन नॉकडाउन द्वारा डेंड्राइटिक सेल विकास का अध्ययन

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

डेंड्राइटिक कोशिकाएं, या डीसी, जन्मजात और अनुकूली प्रतिरक्षा प्रणाली को जोड़ने वाली प्रमुख प्रतिरक्षा कोशिकाएं हैं। जबकि डीसी विषम हैं, यह विधि हमें यह समझने में मदद करती है कि प्रतिलेखन कारकों सहित कौन से जीन डीसी विकास को विनियमित कर सकते हैं। यह तकनीक एक जीन की पहचान करने का एक सरल और त्वरित तरीका प्रदान करती है जो विट्रो में अपने पूर्वज से डीसी विकास को नियंत्रित करती है।शुरू करने के लिए, पूर्ण RPMI 1640 माध्यम में अमर हेमटोपोइएटिक स्टेम और पूर्वज कोशिकाओं या iHSPCs को बनाए रखने के लिए, FLT3 लिगैंड और एक माइक्रोमोलर बीटा एस्ट्राडियोल के प्रति मिलीलीटर 100 नैनोग्राम के साथ पूरक। लेंटिवायरल ट्रांसडक्शन के लिए, 12 अच्छी तरह से प्लेटों में आईएचएसपीसी को एक बार 10 के घनत्व पर प्लेट करें, प्रति अच्छी तरह से पांचवीं कोशिकाओं के लिए और FLT3 लिगैंड, बीटा एस्ट्राडियोल और पॉलीब्रेन युक्त पूर्ण माध्यम के एक मिलीलीटर। फिर, 100 के संक्रमण की बहुलता पर प्रत्येक अच्छी तरह से छोटे हेयरपिन आरएनए को ले जाने वाले लेंटीवायरस को जोड़ें।इसके बाद, प्लेट को 90 मिनट के लिए 1100 गुना ग्राम और 37 डिग्री सेल्सियस पर स्पिन करें, फिर संक्रमित कोशिकाओं को 37 डिग्री सेल्सियस पर रात भर इनक्यूबेट करें। अगले दिन, कोशिकाओं को सेंट्रीफ्यूजेशन में 15 मिलीलीटर ट्यूबों में इकट्ठा करके पॉलीब्रेन को हटा दें, मीडिया को FLT3 लिगैंड और बीटा एस्ट्राडियोल युक्त ताजा पूर्ण माध्यम के साथ बदलने के बाद। अतिरिक्त 24 घंटों के बाद, संक्रमित कोशिकाओं का चयन करने के लिए माध्यम में छह माइक्रोग्राम प्रति मिलीलीटर प्यूरोमाइसिन जोड़ें।हर तीन दिनों में चयन माध्यम को बदलें और स्थिर रूप से ट्रांसड्यूस किए गए iHSPCs का विस्तार करने के लिए कम से कम एक सप्ताह के लिए कोशिकाओं को बनाए रखें। उत्पन्न और FLT3 लिगैंड और बीटा एस्ट्राडियोल के साथ पूरक पूर्ण माध्यम में LacZ, Tcf4, और Id2 के लिए स्थिर नॉकडाउन iHSPCs बनाए रखने. इन विट्रो भेदभाव शुरू करने के लिए 15 मिलीलीटर ट्यूबों में अविभाजित आईएचएसपीसी एकत्र करें और सेंट्रीफ्यूजेशन द्वारा कोशिकाओं को गोली मार दें।centrifugation के बाद, supernatant त्यागें और PBS के 10 milliliters के साथ कोशिकाओं को दो बार धोएं। दूसरे धोने के बाद, केवल FLT3 लिगैंड युक्त पूर्ण माध्यम में कोशिकाओं को फिर से निलंबित करें, फिर उन्हें दो बार 10 के घनत्व पर बीज दें, पांचवें प्रति मिलीलीटर को 12 अच्छी तरह से प्लेट में बेचता है। तीन दिनों के बाद, FLT3 लिगैंड युक्त ताजा पूर्ण माध्यम का एक मिलीलीटर जोड़ें।एक अतिरिक्त दो दिनों के बाद, प्रवाह साइटोमेट्री द्वारा विभेदित कोशिकाओं का विश्लेषण करने के लिए आगे बढ़ें। प्रवाह साइटोमेट्रिक विश्लेषण के लिए, प्लेट में दो से तीन बार कोशिकाओं को ऊपर और नीचे पिपेट करें, फिर कोशिकाओं को 1.5 मिलीलीटर ट्यूबों में इकट्ठा करें। ट्यूबों को सेंट्रीफ्यूज करें और फैक्स बफर के 50 माइक्रोलीटर में कोशिकाओं को फिर से निलंबित करने से पहले supernatant को त्याग दें।इसके बाद, एंटी-सीडी 16 के 50 माइक्रोलीटर को 32 हाइब्रिडोमा सुपरनेटेंट द्वारा जोड़ें और बर्फ पर पांच से 10 मिनट के लिए इनक्यूबेट करें। फिर, कोशिकाओं में सीधे फ्लोरोसेंट डाई-संयुग्मित एंटीबॉडी जोड़ें और अंधेरे में बर्फ पर 15 मिनट के लिए इनक्यूबेट करें। इनक्यूबेशन बाद, फैक्स बफर के एक मिलीलीटर के साथ कोशिकाओं को धोएं और नमूने को सेंट्रीफ्यूज करें।centrifugation के बाद, फैक्स बफर के 100 माइक्रोलीटर में कोशिकाओं को फिर से निलंबित करें और प्रवाह साइटोमेट्री द्वारा नमूनों का विश्लेषण करें। आईएचएसपीसीएस में LacZ, Tcf4, और Id2 के छोटे हेयरपिन आरएनए-मध्यस्थता नॉकडाउन के बाद, RTQ-PCR द्वारा नॉकडाउन दक्षता की पुष्टि से पता चला है कि Tcf4 और Tcf4 नॉकडाउन iHSPCs की अभिव्यक्ति LacZ नॉकडाउन iHSPCs की तुलना में कम हो गई थी। इसी तरह के परिणाम Id2 नॉकडाउन iHSPCs में Id2 अभिव्यक्ति के लिए देखे गए थे।पांच दिनों के लिए LacZ नॉकडाउन iHSPCs को संवर्धित करने के बाद, CD11c सकारात्मक कोशिकाओं की आवृत्ति, जो डेंड्राइटिक सेल आबादी का प्रतिनिधित्व करती है, लगभग 95% थी, हालांकि, Tcf4 या Id2 को खटखटाने से CD11c-positive dendritic कोशिकाओं की पीढ़ी में थोड़ी कमी आई। LacZ नॉकडाउन iHSPCs से व्युत्पन्न CD11c-positive dendritic कोशिकाओं के आगे के विश्लेषण से पता चला कि 70% पारंपरिक डेंड्राइटिक कोशिकाएं थीं, जबकि 22% plasmacytoid dendritic कोशिकाएं थीं। Tcf4 नॉकडाउन iHSPCs plasmacytoid डेंड्राइटिक कोशिकाओं का काफी कम प्रतिशत उत्पन्न करता है जिसे LacZ नॉकडाउन नियंत्रित करता है।इसके विपरीत, Id2 नॉकडाउन iHSPCs ने LacZ नॉकडाउन नियंत्रणों की तुलना में पारंपरिक डेंड्राइटिक कोशिकाओं का काफी कम प्रतिशत उत्पन्न किया, लेकिन plasmacytoid डेंड्राइटिक कोशिकाओं का एक उच्च प्रतिशत। स्पिन संक्रमण iHSPCs में lentivirus-ले जाने shRNA की transduction दक्षता में वृद्धि. यह तकनीक प्रतिलेखन कारकों की भूमिका को संबोधित करती है और साइटोकाइन सिग्नलिंग ट्रांसडक्शन या चयापचय में अन्य जीनों के अध्ययन की सुविधा प्रदान करती है, जो डीसी विकास में शामिल होने की संभावना है।

Research

JoVE Journal

Immunology and Infection

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Multivirus विशेष टी कोशिकाओं की पीढ़ी को रोकें / allogeneic hematopoietic स्टेम सेल प्रत्यारोपण के बाद वायरल संक्रमण का इलाज

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

एलर्जी airway सूजन फेफड़े के वृक्ष के समान सेल परिपक्वता और प्रवासन के दौरान विश्लेषण

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

संक्रमण को रोकने के लिए एक नई दृष्टिकोण के रूप में पीआरपी: तैयारी और<em&gt; इन विट्रो में</em&gt; रोगाणुरोधी संपत्तियों पीआरपी

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, ...

Generation of a Novel Dendritic-cell Vaccine Using Melanoma and Squamous Cancer Stem Cells

मेलानोमा और स्क्वैमस कैंसर स्टेम सेल का उपयोग करके एक उपन्यास डेंड्रिटिक-सेल वैक्सीन की पीढ़ी

We identified cancer stem cell (CSC)-enriched populations from murine melanoma D5 syngeneic to C57BL/6 mice and the squamous cancer SCC7 syngeneic to C3H ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

एक टेट्रासाइक्लिन विनियमित सेल लाइन विशेष रूप से वृक्ष के समान कोशिकाओं को लक्षित है कि उच्च टिटर lentiviral वैक्टर का उत्पादन

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

शुद्ध hematopoietic स्टेम / पूर्वपुस्र्ष कोशिकाओं में डीएनए म्यूटेशन की पहचान

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

Hematopoietic progenitors के दत्तक हस्तांतरण का उपयोग कर Peyer पैच में murine plasmacytoid वृक्ष के समान कोशिकाओं के विकास का आकलन

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

एक सरल और कुशल दृष्टिकोण उत्परिवर्ती चेचक वायरस वैक्टर का निर्माण करने के लिए

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

विकास और मानव न्युट्रोफिल व्युत्पन्न विशालकाय phagocytes के एक उपन्यास उप-जनसंख्या की पहचान<em&gt; इन विट्रो</em

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Vivo में मानव टी सेल याद प्रतिक्रियाओं का अध्ययन करने के लिए एक चूषण छाला प्रोटोकॉल

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...