Name: study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro
Uploaded: 2022-03-07T13:00:00
Description: Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Tz-Ling Chen 박사의 기술 지원에 감사드립니다. 우리는 shRNA 렌즈바이러스 (http://rnai.genmed.sinica.edu.tw)를 제공하는 국립 RNAi 코어 시설 (학계 시니카, 대만)에 감사드립니다. 이 작품은 대만 과학기술부(대부분 108-2320-B-002-037-MY3 및 MOST 109-2320-B-002-002-054-MY3)에 의해 지원되었다.

렌티바이러스의 취급은 국립 대만 대학 의과 대학의 환경 보건 및 안전학과의 규정에 따라 수행됩니다.
1. 불멸의 조혈 줄기 및 선조 세포주 준비 (iHSPC)
<ol><li>100 ng/mL FL 및 1 μM β-estradiol을 포함하는 완전한 RPMI 1640 배지에서 iHSPC 세포줄을 유지합니다.</li>
	<li>3일마다 1:10의 비율로 세포를 통과합니다. 참고: 10% 태아 소 혈청(FBS), 5 x 10-5M β-메르카포에탄올, 10 μg/mL 젠?...

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

Lentivirus 기반 shRNA 벡터는 종종 세포로 바이러스 성 변환에 의해 유전자 침묵에 사용되며 숙주 게놈으로 안정적인 통합을 허용합니다. 그러나, 상이한 세포 모형에 있는 각종 감과 효율을 고려해야 하고, 이 문제점을 극복하기 위하여 접근의 다수가 취해졌습니다. 
폴리브레인은 세포막상에서 전하를 중화시킬 수 있는 다정화 폴리머로, 이를 통해 배관20 동안...

DC는 선천적이고 적응형 면역의 주요 레귤레이터입니다1. DC는 주로 두 개의 기능적으로 구별되는 인구, 즉 pDC 및 cDC로 분류됩니다. 또한 cDC는 각각 I 형 및 유형 II cDC 또는 cDC1 및 cDC2의 두 개의 하위 집합을 포함합니다2. pDC, 발현 BST2, Siglec-H, 및 mice3,4에서 CD11c의 중간 수준은 염증 및 바이러스 감염 동안 많은 양의 IFN-I를 분비할 수 있는 세포입니다5. 그들의 강력한 IFN-I 생산 능력 때문에, 그(것)들은 또한 전신 루푸스 홍반성 (SLE)6를 포함하여 자기 면역 질병의 진행에 있는 중요한 역할을 하기 위하여 의심됩니다. cDC1s는 XCR1, CD8a, CLEC9A 및 CD103의 표면 발현에 의해 정의된 마우스7, 항원 교차 프레젠테이션을 통해 세포독성 CD8+ T 세포(CTL)의 활성화 및 편광에 전문화되어, 세포내 병원체 및 암에 대한 응답으로 I 면역을 시공한다. 한편, 인간과 마우스 모두에서 CD11b 및 CD172α(Sirpα라고도 함)를 발현하는 cDC2s는 CD4+ T 세포를 활성화하고 알레르겐 및 기생충에 대한 II형 면역 반응을 촉진할 수 있으며, 세포외 박테리아 및 미생물 인식에 따른 변조형 III 면역성을 11,12로 촉진할 수 있다.
DC의 다양화는 BM. E2-2(Tcf4에 의해 인코딩)에서 조혈 줄기 및 선조 세포(HSPC)로부터의 TF그룹에 의해 결정되며 pDC13,14의 분화 및 기능에 대한 마스터 레귤레이터이다. 대조적으로, DNA 결합 2(ID2)의 억제제는 cDC 사양을 구동하고 E 단백질 활성을 차단하여 pDC 개발을 억제한다15. 또한 cDC1의 개발은 IRF8 및 BATF3가 필요하며 cDC2의 차별화는 IRF416에 따라 다릅니다. 최근 작품은 pDC17및 cDC와 그들의 전사 규정18의 이질성을 탐구했다. DC 네트워크의 복잡성으로 인해 DC의 개발 및 기능을 제어하는 다른 TF를 식별할 수 있는 플랫폼을 구축해야 합니다.
여기서, 우리는 BM 세포에서 Hoxb8의 에스트로겐 조절 핵 전좌를 표현하여 생성된 iHSPC를 (Hoxb8-FL 세포라고도 함)를 사용했다 19. iHSPC는 β 에스트라디올과 Flt3 리간드(FL)가 있는 상황에서 차별화되지 않은 단계에 남아 있는 반면, β-estradiol19의 철수 시 FL의 존재속에서 다른 DC 유형으로 차별화하기 시작합니다. 이 기능을 바탕으로, 우리는 전조 단계에서 관심의 유전자를 노크 할 수 있습니다, 다음 PDC와 CDC의 체외 분화에 미치는 영향을 검사. 따라서, 이 방법은 DC의 발달 과 기능을 조절하는 유전자를 발견하는 강력한 도구이다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Antibodies</td>
		</tr>
		<tr>
			<td>APC/Cy7 anti-mouse CD11c Antibody</td>
			<td>Biolegend</td>
			<td>117324</td>
			<td>(Clone: N418)</td>
		</tr>
		<tr>
			<td>FITC anti-mouse/human CD11b Antibody</td>
			<td>Biolegend</td>
			<td>101206</td>
			<td>(Clone: M1/70)</td>
		</tr>
		<tr>
			<td>PE anti-mouse/human B220 Antibody</td>
			<td>Biolegend</td>
			<td>103208</td>
			<td>(Clone: RA3-6B2)</td>
		</tr>
		<tr>
			<td colspan="4">Cell culture</td>
		</tr>
		<tr>
			<td>1.5 mL Micro tube</td>
			<td>&#160;ExtraGene</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate</td>
			<td>Falcon</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Corning</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium</td>
			<td>gibco</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Reagent</td>
		</tr>
		<tr>
			<td>&#946;-estradiol</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td>home-made</td>
			<td></td>
			<td>Formula: 1xPBS+0.5 %FBS+0.1%NaN3</td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)</td>
			<td>home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>Sigma-Aldrich</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invivogen</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIsure</td>
			<td>BIOLINE</td>
			<td>BIO-38032</td>
			<td></td>
		</tr>
		<tr>
			<td>shRNA (Taregt sequence/clone ID)</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shId2&#160; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

수지상 세포 (DC)는 선천적이고 적응성 면역 반응을 연결하는 중요한 항원 제시 세포입니다. DC는 이질적이며 기존의 DC(cDC) 및 플라즈마 사이토이드 DC(pDC)로 나눌 수 있습니다. cDC는 순진한 T 세포를 위한 항원 제시를 전문으로 합니다. 한편, pDC는 바이러스 감염 시 다량의 타입 I 인터페론(IFN-I)을 생성할 수 있다. DC의 사양은 골수(BM)의 DC 전구체의 초기 단계에서 발생하며 전사 인자(TFs)의 네트워크에 의해 정의됩니다. 예를 들어, cDC는 높은 표현 ID2, PC는 높은 표현 E2-2 동안. 점점 더 많은 DC 하위 집합이 식별되고 있기 때문에 DC 개발을 제어하는 특정 TF를 이해하는 데 관심이 증가하고 있습니다. 여기서, 우리는 짧은 머리핀 RNA (shRNA)를 불멸의 조혈 줄기 및 선조 세포 (iHSPC) 라인으로 운반하는 렌즈 바이러스를 전달하여 시험관 내에서 DC 분화에 중요한 TFs를 선별하는 방법을 확립합니다. 안정적인 녹다운 세포 주 cDC 및 pDC 전위는 셀토메트리에 의해 분석된다. 이 접근은 시험관내선에서 선조에게서 DC 운명을 잠재적으로 지배하는 유전자를 확인하는 플랫폼을 제공합니다.

렌티바이러스 벡터 pLKO.1-Puro의 지도가 표시됩니다(도 1). lacZ에 대한 shRNA를 발현하는 렌즈바이러스(비표적 제어), Tcf4 및 iHSPCPc에서 IHSPCC에서 확인된 녹다운 효율은 tcf4의 발현이 shLacZ iHSPCPC(그림 2A)에 비해 shTcf4 iHSPC에서 감소된 것으로 나타났습니다. 한편, id2의 감소된 발현은 shLacZ iHSPC 제어(<strong c...

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

여기서 우리는 체외 DC 분화에 대한 안정적인 녹다운 세포주를 얻기 위해 shRNA의 렌즈바이러스 트랜스듀션을 사용하여 수지상 세포(DC)의 개발에 관여하는 잠재적 전사 인자를 선별하기 위한 프로토콜을 제공합니다.

대장포에이성 줄기및 전구세포주에서 짧은 헤어핀 RNA 중재 유전자 녹다운에 의한 수지상 세포 개발 연구

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

수지상 세포, 또는 DC는, 선천적이고 적응성 면역 계통을 연결하는 중요한 면역 세포입니다. DC는 이질적이지만,이 방법은 전사 요인을 포함하여 DC 개발을 조절 할 수있는 유전자를 이해하는 데 도움이됩니다. 이 기술은 시험관 내의 전구에서 DC 발달을 통제하는 유전자를 확인하는 간단하고 빠른 방법을 제공합니다.시작하려면, 완전한 RPMI 1640 배지에서 불멸의 조혈 줄기 및 선조 세포 또는 iHSPC를 유지, FLT3 리간드의 밀리리터 당 100 나노 그램과 하나의 마이크로 몰라 베타 estradiol로 보충. 렌티바이러스 트랜스듀션의 경우, iHSPC를 12개의 웰 플레이트에서 10배의 밀도로 잘 10배, FLT3 리간드, 베타 에스트라디올 및 폴리브레인을 함유한 완전한 배지의 1밀리리터를 잘 한다. 이어서, 100의 감염의 복합성에서 각각의 잘 짧은 머리핀 RNA를 운반하는 렌티바이러스를 추가한다.다음으로, 90분 동안 1100배, 섭씨 37도에서 플레이트를 돌린 다음, 감염된 세포를 섭씨 37도에서 하룻밤 동안 배양한다. 다음 날, 원심분리에서 15밀리리터 튜브로 세포를 수집하여 폴리브레인을 제거하고, FLT3 리간드 및 베타 estradiol을 포함하는 신선한 완전한 배지로 미디어를 대체한다. 추가 24 시간 후에, 감염된 세포를 선택하기 위하여 매체에 puromycin의 밀리리터 당 6 마이크로그램을 추가합니다.선택 매체를 3일마다 교체하고 안정적으로 변환된 iHSPC를 확장하기 위해 적어도 1주일 동안 셀을 유지관리한다. FLT3 리간드 및 베타 에스트라디올로 보완된 완전한 매체에서 LacZ, Tcf4 및 Id2용 안정적인 넉다운 iHSPC를 생성하고 유지합니다. 시험관 분화를 시작하려면 15 밀리리터 튜브로 미분화 iHSPC를 수집하고 원심분리에 의해 세포를 펠릿한다.원심 분리 후, 상체를 버리고 PBS의 10 밀리리터로 세포를 두 번 씻으십시오. 두 번째 세척 후, FLT3 리간드만 을 포함하는 완전한 배지에서 세포를 다시 중단한 다음 밀리리터당 2회 10~5분의 1의 밀도로 12개의 웰 플레이트로 셀을 종자한다. 3일 후 FLT3 리간드를 함유한 신선한 완전 배지 1밀리리터를 추가합니다.추가 이틀 후, 혈류 세포측정에 의해 분화된 세포를 분석하였다. 유동 세포 측정 분석을 위해, 플레이트에서 2~3회 위아래로 세포를 피펫한 다음 세포를 1.5 밀리리터 튜브로 수집합니다. 팩스 버퍼의 50 마이크로 리터에서 세포를 다시 중단하기 전에 튜브를 원심 분리하고 슈퍼 네티얼을 폐기하십시오.다음으로, 안티 CD16 의 50 마이크로 리터를 32 hybridoma 상수로 추가하고 얼음에 5 ~ 10 분 동안 배양합니다. 그런 다음, 형광 염료-컨쥬게이드 항체를 세포에 직접 추가하고 어둠 속에서 얼음에 15분 동안 배양한다. 인큐베이션 후, 팩스 버퍼의 1 밀리리터로 세포를 세척하고 샘플을 원심분리합니다.원심 분리 후, 팩스 버퍼의 100 마이크로 리터에서 세포를 다시 중단하고 흐름 세포 측정에 의해 샘플을 분석합니다. iHSPCS에서 LacZ, Tcf4 및 Id2의 짧은 헤어핀 RNA 매개 녹다운 후 RTQ-PCR에 의한 녹다운 효율확인은 LacZ 녹다운 iHSPC에 비해 Tcf4 및 Tcf4 넉다운 iHSPC의 발현이 감소한 것으로 나타났습니다. Id2 녹다운 iHSPC에서 Id2 발현에 대해 도유사한 결과가 관찰되었다.5일 동안 LacZ 녹다운 iHSPC를 배양한 후, 수지상 세포 집단을 나타내는 CD11c 양성 세포의 주파수는 약 95%였으며, Tcf4 또는 Id2를 쓰러뜨리면 CD11c 양성 수지상 세포의 생성이 약간 감소하였다. LacZ 녹다운 iHSPC에서 파생된 CD11c 양성 수지상 세포의 추가 분석에 따르면 70%는 종래의 수지상 세포였으며 22%는 플라즈마세포 이드 수지상 세포였습니다. Tcf4 녹다운 iHSPC는 LacZ 가래가 제어하는 플라즈마 세포 분해 수지상 세포의 상당히 낮은 비율을 생성했습니다.대조적으로, Id2 녹다운 iHSPC는 LacZ 녹다운 대조군보다는 기존의 수지상 세포의 상당히 낮은 비율을 생성하지만 플라즈마 세포 이드로이드 수지상 세포의 높은 비율을 생성하였다. 스핀 감염은 렌즈바이러스 운반 shRNA의 변환 효율을 iHSPC로 증가시다. 이 기술은 전사 요인의 역할을 해결하고 DC 개발에 관여 할 가능성이 있는 사이토카인 신호 변환 또는 신진 대사에 있는 그밖 유전자의 연구를 용이하게 합니다.

Research

JoVE Journal

Immunology and Infection

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Multivirus 특정 T 세포 생성 Allogeneic 조혈 줄기 세포 이식 후 바이러스 감염을 예방 / 치료

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

연구

면역학 및 감염병학

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

알레르기기도 염증 동안 폐 돌기 세포 성숙과 마이 그 레이션 분석

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

준비를 한 다음 감염을 방지하기 위해 새로운 접근 방식으로 PRP<em&gt; 체외에서</emPRP의&gt; 항균 속성

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, ...

Generation of a Novel Dendritic-cell Vaccine Using Melanoma and Squamous Cancer Stem Cells

흑색종과 편평상피암 줄기세포를 이용한 새로운 수지상 세포 백신의 생성

We identified cancer stem cell (CSC)-enriched populations from murine melanoma D5 syngeneic to C57BL/6 mice and the squamous cancer SCC7 syngeneic to C3H ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

항생 물질 규제 세포주 특히 수지상 세포를 대상으로 높은 titer의 렌티 바이러스 벡터를 생성

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

정제 된 조혈 줄기 / 전구 세포에 DNA 돌연변이를 확인

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

조혈 전구 세포의 입양 전송을 사용 Peyer의 패치에 쥐과 Plasmacytoid 수지상 세포의 개발을 평가

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

간단하고 효율적인 접근 방법은 돌연변이 백시 니아 바이러스 벡터를 구축하기

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

인간 호중구 유래 거 식세포의 소설 모집단의 개발 및 식별<em&gt; 체외</em

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

인간 T 세포 회수 응답에서 Vivo에서 공부 하는 흡입 물집 프로토콜

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...