Name: transposon-insertion sequencing as a tool to elucidate bacterial colonization factors in a burkholderia gladioli symbiont of lagria villosa beetles
Uploaded: 2021-08-12T15:00:00
Duration: 9 min 55 s
Description: Watch this Scientific Journal Video about Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles at JoVE.co

이준범 교수님은 대장균 WM3064+pRL27 균주를 절차의 컨쥬게이션및 지도, 돌연변이 도서관 세대 의 문제 해결을 도운 카트린 허프마이어, 곤충 수집 및 허가 취득을 지원하는 안드레 로드리게스 교수에게 감사드립니다. 또한 레베카 얀케와 다그마르 클레브쉬에게 곤충의 수집과 사육을 지원해 주신 것에 대해서도 감사드립니다. 우리는 브라질 당국이 곤충 표본의 접근, 수집 및 수출에 대한 다음과 같은 허가를 부여한 것을 인정합니다: SISBIO 승인 Nr. 45742-1, 45742-7 및 45742-10, CNPq 공정 nº 01300.004320/2014-21 및 01300.0013848/2017-33, IBAMA Nr. 14BR01615151DF 205.20.20.20.20.20.25.20.20.20.20.20.20.20.20.20.20.20.23. 이 연구는 독일 과학 재단 (DFG) 연구 보조금 FL1051/1-1 및 KA2846/6-1의 자금 지원을 받았습니다.

<ol>
	<li>Cain, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+decade+of+advances+in+transposon-insertion+sequencing.">A decade of advances in transposon-insertion sequencing.</a> Nature Reviews Genetics. 21 (9), 526-540 (2020).</li><li>Chao, M. C., Abel, S., Davis, B. M., Waldor, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+design+and+analysis+of+transposon+insertion+sequencing+experiments.">The design and analysis of transposon insertion sequencing experiments.</a> Nature Reviews Microbiology. 14 (2), 119-128 (2016).</li><li>Barquist, L., Boinett, C. J., Cain, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+to+querying+bacterial+genomes+with+transposon-insertion+sequencing.">Approaches to querying bacterial genomes with transposon-insertion sequencing.</a> RNA Biology. 10 (7), 1161-1169 (2013).</li><li>Fl&#243;rez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic-producing+symbionts+dynamically+transition+between+plant+pathogenicity+and+insect-defensive+mutualism.">Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism.</a> Nature Communications. 8 (1), 15172 (2017).</li><li>Fl&#243;rez, L. V., Kaltenpoth, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symbiont+dynamics+and+strain+diversity+in+the+defensive+mutualism+between+Lagria+beetles+and+Burkholderia.">Symbiont dynamics and strain diversity in the defensive mutualism between Lagria beetles and Burkholderia.</a> Environmental Microbiology. 19 (9), 3674-3688 (2017).</li><li>Fl&#243;rez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+antifungal+polyketide+associated+with+horizontally+acquired+genes+supports+symbiont-mediated+defense+in+Lagria+villosa+beetles.">An antifungal polyketide associated with horizontally acquired genes supports symbiont-mediated defense in Lagria villosa beetles.</a> Nature Communications. 9 (1), 2478 (2018).</li><li>. FastQC A quality control tool for high throughput sequence data Available from: <a target="_blank" href="https://www.bioinformatics.babraham.ac.uk/projects/fastqc/">https://www.bioinformatics.babraham.ac.uk/projects/fastqc/</a> (2012)</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10-12 (2011).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+A+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: A flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nature Methods. 9 (4), 357-359 (2012).</li><li>Liao, Y., Smyth, G. K., Shi, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FeatureCounts:+An+efficient+general+purpose+program+for+assigning+sequence+reads+to+genomic+features.">FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features.</a> Bioinformatics. 30 (7), 923-930 (2014).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biology. 15 (12), 550 (2014).</li><li>Gayt&#225;n, M. O., Mart&#237;nez-Santos, V. I., Soto, E., Gonz&#225;lez-Pedrajo, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+three+secretion+system+in+attaching+and+effacing+pathogens.">Type three secretion system in attaching and effacing pathogens.</a> Frontiers in Cellular and Infection Microbiology. 6, 129 (2016).</li><li>Hachani, A., Wood, T. E., Filloux, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+VI+secretion+and+anti-host+effectors.">Type VI secretion and anti-host effectors.</a> Current Opinion in Microbiology. 29, 81-93 (2016).</li><li>Deep, A., Chaudhary, U., Gupta, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quorum+sensing+and+bacterial+pathogenicity:+From+molecules+to+disease.">Quorum sensing and bacterial pathogenicity: From molecules to disease.</a> Journal of Laboratory Physicians. 3 (1), 4-11 (2011).</li><li>Silva, A. J., Benitez, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vibrio+cholerae+biofilms+and+cholera+pathogenesis.">Vibrio cholerae biofilms and cholera pathogenesis.</a> PLOS Neglected Tropical Diseases. 10 (2), 0004330 (2016).</li><li>Navarro-Garcia, F., Ruiz-Perez, F., Cataldi, &. #. 1. 9. 3. ;., Larz&#225;bal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+VI+secretion+system+in+pathogenic+Escherichia+coli:+structure,+role+in+virulence,+and+acquisition.">Type VI secretion system in pathogenic Escherichia coli: structure, role in virulence, and acquisition.</a> Frontiers in Microbiology. 10, 1965 (2019).</li><li>Ribet, D., Cossart, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+bacterial+pathogens+colonize+their+hosts+and+invade+deeper+tissues.">How bacterial pathogens colonize their hosts and invade deeper tissues.</a> Microbes and Infection. 17 (3), 173-183 (2015).</li><li>Schwarz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burkholderia+Type+VI+secretion+systems+have+distinct+roles+in+eukaryotic+and+bacterial+cell+interactions.">Burkholderia Type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions.</a> PLoS Pathogens. 6 (8), 1001068 (2010).</li><li>Jones, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kill+and+cure:+genomic+phylogeny+and+bioactivity+of+Burkholderia+gladioli+bacteria+capable+of+pathogenic+and+beneficial+lifestyles.">Kill and cure: genomic phylogeny and bioactivity of Burkholderia gladioli bacteria capable of pathogenic and beneficial lifestyles.</a> Microbial Genomics. 7 (1), 000515 (2021).</li><li>Takeshita, K., Kikuchi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Riptortuspedestris+and+Burkholderia+symbiont:+an+ideal+model+system+for+insect-microbe+symbiotic+associations.">Riptortuspedestris and Burkholderia symbiont: an ideal model system for insect-microbe symbiotic associations.</a> Research in Microbiology. 168 (3), 175-187 (2017).</li><li>Powell, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screen+identifies+host+colonization+determinants+in+a+bacterial+gut+symbiont.">Genome-wide screen identifies host colonization determinants in a bacterial gut symbiont.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (48), 13887-13892 (2016).</li><li>Brooks, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+discovery+of+colonization+determinants+in+the+squid+symbiont+Vibrio+fischeri.">Global discovery of colonization determinants in the squid symbiont Vibrio fischeri.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (48), 17284-17289 (2014).</li><li>Somprasong, N., McMillan, I., Karkhoff-Schweizer, R. R., Mongkolsuk, S., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+genetic+manipulation+of+Burkholderia+gladioli+pathovar+cocovenenans.">Methods for genetic manipulation of Burkholderia gladioli pathovar cocovenenans.</a> BMC Research Notes. 3 (308), (2010).</li><li>Garcia, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burkholderia+thailandensis:+Genetic+manipulation.">Burkholderia thailandensis: Genetic manipulation.</a> Current Protocols in Microbiology. 45, 1-15 (2017).</li><li>Headd, B., Bradford, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+conjugation+window+in+an+Escherichia+coli+K-12+strain+with+an+IncFII+plasmid.">The conjugation window in an Escherichia coli K-12 strain with an IncFII plasmid.</a> Applied and Environmental Microbiology. 86 (17), 00948 (2020).</li><li>Van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+A+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: A new tool for systems-level analysis of microorganisms.</a> Nature Reviews Microbiology. 11 (7), 435-442 (2013).</li><li>Gallagher, L. A., Ramage, E., Patrapuvich, R., Weiss, E., Brittnacher, M., Manoil, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence-defined+transposon+mutant+library+of+Burkholderia+thailandensis.">Sequence-defined transposon mutant library of Burkholderia thailandensis.</a> mBio. 4 (6), 00604-00613 (2013).</li><li>Wong, Y. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candidate+essential+genes+in+Burkholderia+cenocepacia+J2315+identified+by+genome-wide+TraDIS.">Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS.</a> Frontiers in Microbiology. 7, 1288 (2016).</li><li>Moule, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+saturation+mutagenesis+of+Burkholderia+pseudomallei+K96243+predicts+essential+genes+and+novel+targets+for+antimicrobial+development.">Genome-wide saturation mutagenesis of Burkholderia pseudomallei K96243 predicts essential genes and novel targets for antimicrobial development.</a> mBio. 5 (1), 00926 (2014).</li><li>Ding, Q., Tan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Himar1+transposon+for+efficient+random+mutagenesis+in+Aggregatibacter+actinomycetemcomitans.">Himar1 transposon for efficient random mutagenesis in Aggregatibacter actinomycetemcomitans.</a> Frontiers in Microbiology. 8, 1842 (2017).</li><li>Green, B., Bouchier, C., Fairhead, C., Craig, N. L., Cormack, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+site+preference+of+Mu,+Tn5,+and+Tn7+transposons.">Insertion site preference of Mu, Tn5, and Tn7 transposons.</a> Mobile DNA. 3, 3 (2012).</li><li>Lodge, J. K., Weston-Hafer, K., Berg, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+Tn5+target+specificity:+Preference+for+insertion+at+G/C+pairs.">Transposon Tn5 target specificity: Preference for insertion at G/C pairs.</a> Genetics. 120 (3), 645-650 (1988).</li><li>Ar&#225; Ujo, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequencing+and+transposon+mutagenesis+of+Burkholderia+seminalis+TC3.4.2R3+identify+genes+contributing+to+suppression+of+orchid+necrosis+caused+by+B.+gladioli.">Genome sequencing and transposon mutagenesis of Burkholderia seminalis TC3.4.2R3 identify genes contributing to suppression of orchid necrosis caused by B. gladioli.</a> Molecular Plant-microbe Interactions: MPMI. 29 (6), 435-446 (2016).</li><li>Dobritsa, A. P., Samadpour, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reclassification+of+Burkholderiainsecticola+as+Caballeroniainsecticola+comb.+nov.+and+reliability+of+conserved+signature+indels+as+molecular+synapomorphies.">Reclassification of Burkholderiainsecticola as Caballeroniainsecticola comb. nov. and reliability of conserved signature indels as molecular synapomorphies.</a> International Journal of Systematic and Evolutionary Microbiology. 69 (7), 2057-2063 (2019).</li><li>Ohbayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect's+intestinal+organ+for+symbiont+sorting.">Insect's intestinal organ for symbiont sorting.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (37), 5179-5188 (2015).</li><li>Ross, C., Scherlach, K., Kloss, F., Hertweck, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+conjugated+polyyne+biosynthesis+in+phytopathogenic+bacteria.">The molecular basis of conjugated polyyne biosynthesis in phytopathogenic bacteria.</a> Angewandte Chemie International Edition. 53 (30), 7794-7798 (2014).</li><li>Atkins, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutant+of+Burkholderia+pseudomallei,+auxotrophic+in+the+branched+chain+amino+acid+biosynthetic+pathway,+is+attenuated+and+protective+in+a+murine+model+of+melioidosis.">A mutant of Burkholderia pseudomallei, auxotrophic in the branched chain amino acid biosynthetic pathway, is attenuated and protective in a murine model of melioidosis.</a> Infection and Immunity. 70 (9), 5290-5294 (2002).</li></ol>

저자는 연구 와 관련된 이해 상충이 없다고 선언합니다.

B. gladioli 트랜스포슨 돌연변이 라이브러리는 L. villosa 딱정벌레와 B. gladioli 박테리아 사이의 공생 상호 작용에서 중요한 호스트 식민지 화 요인을 식별하기 위해 생성되었다. 프로토콜의 주요 단계는 연상, 호스트 감염, DNA 라이브러리 준비 및 시퀀싱이었습니다.
버크홀더리아의 많은 변종은24,25,트랜스포손 및 항생제 삽입 카세트를 운반하는 플라스미드가 대장균으로부터표적 B. gladioli Lv-StA 균주에 성공적으로 접합되었다. 전기포이션에 의한 이전의 변환 시도는 거의 B. gladioli 변압제로 매우 낮게 산출되었습니다. 많은 수의 변압제를 효율적으로 산출하기 위해 대상 유기체의 변형 기술을 최적화하는 것이 좋습니다.
한 라운드의 컨쥬게이션과 40개의 연상 반점은 B. gladioli Lv-StA에서 3,736개의 유전자를 중단시켰습니다. 뒤늦게, 인후의 여러 라운드는 7,468개의 유전자의 대부분을 중단하고 포화 된 라이브러리를 얻기 위해 필요할 것입니다. 특히, 컨쥬게이션 중 인큐베이션 시간은 B. gladioli의기하급수적 성장 단계의 끝인 12-18h를 초과할 수 없었다. 세균 세포의 기하급수적 성장 단계를 넘어 결합을 허용하면트랜스컨쥬펀트(26)를획득하는 성공 확률을 감소시킨다. 따라서, 균종의 성장에 따라 컨쥬게이션 기간을 조정해야 한다.
숙주에서 돌연변이 라이브러리의 감염을 성공적으로 수행하려면,감염1,2,27전에 라이브러리에 있는 식민지화 도중 세균성 인구 병목 현상 및 돌연변이의 다양성을 평가하는 것이 중요하다. 실험을 준비하기 위해 라이브러리의 각 돌연변이를 샘플링하고 식민지화할 수 있는 높은 기회를 갖기 위해 감염되어야 하는 딱정벌레의 최소 수를 추정했습니다. 생체 내 세균 발생 시간 및 실험 기간 동안세대 수에 대한 근사치도 계산하였다. 체외 문화는 인큐베이션 시간을 조정하여 비슷한 수의 세대까지 성장했습니다. 다른 비모델 호스트에서 유사한 감염 실험의 경우, 숙주 유기체의 실험실 배양 및 일정한 근원을 유지하는 능력이 바람직하다.
생체 내 및 시험관 내 및 샘플 수집에서 돌연변이 라이브러리의 성장에 따라, 트랜스포슨 삽입 시퀀싱을 위한 수정된 DNA 라이브러리 준비 프로토콜이 수행되었다. 프로토콜의 수정은 사용자 정의 PCR 프라이머를 설계하고 삽입 카세트를 포함하는 DNA 단편을 선택하는 PCR 단계를 추가하는 것을 포함했다. 프로토콜을 사용자 지정했기 때문에 프로토콜의 추가 PCR 주기는 최종 라이브러리에서 오버앰프 및 혼성 어댑터 조각의 위험을 증가시켰습니다. 따라서 이러한 조각을 제거하는 데 도움이 되므로 두 개의 PcR 후 최종 정리 단계(크기 선택 제외)가 권장됩니다. DNA 라이브러리의 크기 분포는 여전히 예상보다 광범위했습니다. 그러나 시퀀싱 깊이를 늘리면 생물정보학 분석 중에 필터링된 충분한 데이터가 제공되어 만족스러운 결과를 얻을 수 있습니다.
트랜스포슨 매개 돌연변이 발생은 단일 실험에서 수천 개의 무작위 삽입을 생성하므로 세균 성장에 필수적인 유전자가 중단된 돌연변이를 제외한 모든 돌연변이체 라이브러리를 생성할 수 있습니다. 우리는 버크 홀더리아 스프에 대한 다른 연구에서 필수 유전자의 추정을 감안할 때 포화 돌연변이 라이브러리와 함께 작동하지 않았을 가능성이 큽분입니다. 28,29. 그럼에도 불구하고 포화되지 않은 도서관은 표적 돌연변이 발생을 사용하여 추가 연구를 위한 다양한 후보 유전자를 탐구하는 데 도움이됩니다. 실험 전에, 일부 트랜스포슨에는게놈(30)의특정 좌엽에서 돌연변이의 풍부를 증가시키는 특정 삽입 표적 부위가 있다는 것을 기억하는 것도 중요하다. 마리너 트랜스포슨은삽입(31)에대한 AT 부위를 표적으로 하는 것으로 알려져 있으며, Tn5 트랜스포슨은 GC바이어스(32,33)를갖는다. 트랜스포슨 삽입에 대한 핫스팟을 인식하는 생물 정보학 분석 중에 단계를 포함하여 모든 분포 편향을 평가하는 데 도움이 됩니다.
좌절하는 경향이 있더라도, 잘 설계된 transposon 삽입 순서 분석 실험은 단 하나 실험 내의 박테리아에 있는 많은 조건부 로 중요한 유전자를 확인하는 강력한 공구일 수 있습니다. 예를 들어, 난초잎 괴사의 억제에 중요한 버크홀더리아 정액에 있는 12개의 유전자는 트랜스포손 돌연변이 발생 및 유전체학(34)을 결합하여 확인되었다. 버크홀더리아를 넘어, 여러 접착 및 운동 성 유전자와 수송은 아피스 멜라이프라 (허니비)22의 스노드 그라셀라 알비 공생에서 중요한 식민지 요인으로 확인되었으며, 유프리모 피셰리 공생 (하와이 밥테일 스퀴드)23 트랜스포지션을 사용하여 돌연변이 를 삽입하였다. 
대체 접근법으로, 트랜스포슨 돌연변이 발생은 시퀀싱 대신 선택적 매체를 사용하여 개별 돌연변이에 대한 검열에 의해 뒤따를 수 있다. 운동성, 생리활성 이차 대사 산물 생산 또는 특정 보조 트로피와 같은 결함을 식별하기 위한 페노티픽 스크리닝 또는 생체 학적 검사가 가능합니다. 예를 들어, 버크홀더리아 곤충콜라(카바예로니아 35)의검진은 공생이 립토르투스 페데스트리,곤충숙주(36)를식민지화하기 위한 운동성 유전자를 채택한다는 것을 확인하는 데 핵심적인 것으로 나타났습니다. 더욱이, 트랜스포슨 돌연변이 발생 및 페노티픽 스크리닝을 이용하여, 생합성 유전자 클러스터는 생활성 이차 대사산물 카요이넨신(Burkholderia caryophylli37)에서확인되었다. 버크홀더리아 의사말레이의 보조 돌연변이는 트랜스포손 돌연변이 발생 및 검진에 따라 확인되었으며, 인간과 동물의 위험한 질병인 멜리오이도증에 대하여 가능한 감쇠 백신후보이다 38. 따라서, 트랜스포손 돌연변이 발생 및 시퀀싱은 병원성 또는 상호 연관에서 각각의 호스트와의 상호 작용에 중요한 박테리아의 분자 특성을 연구하는 데 있어 귀중한 접근법이다.

버크홀더리아 글래디올리는 라그리아 빌로사 딱정벌레와의 공생 적대적 인 교제에 종사 할 수 있으며, 곤충 호스트4,5,6의미생물 길항제에 대한 방어에 중요한 역할을한다. 암컷 딱정벌레는 생식 계통에 특화된 땀샘 부속품에 B. gladioli의 몇몇 긴장을 수용합니다. 계란 누워시, 암컷은 B. gladioli에 의해 생성된 항균 화합물이 내모병원성 곰팡이4,6에의한 감염을 억제하는 계란 표면에 B. gladioli 세포를 얼룩지게 한다. 늦은 배아 발달 도중 또는 애벌레 부화 후에 일찌기, 박테리아는 애벌레의 등지 표면에 자구성 질을 식민지화합니다. 공생의 이러한 특수국화 및 수직 전송 경로에도 불구하고, L. villosa는 아마도 환경4에서수평으로 B. gladioli를 취득할 수 있습니다. 또한, B. gladioli의 적어도 3개의 긴장은 L. villosa4와관련하여,6. 이 중, B. gladioli Lv-StA는 시험관 내에서재배할 수 있는 유일한 사람입니다.
B. 라디올리 Lv-StA는 8.56 Mb6의 게놈 크기를 가지고 있으며 7,468개의 유전자를 함유하고 있습니다. 이 유전자의 어떤 딱정벌레 호스트를 식민지로 B. gladioli 박테리아에 대 한 중요 한? 이 질문에 대답하기 위해, 우리는 조건부 필수 미생물 유전자1,2,3을식별하는 탐색 적 방법 인 트랜스포손 삽입 시퀀싱 (Tn-seq)을 사용했습니다. B. gladioli Lv-StA의 돌연변이 라이브러리는 Tn5 트랜스포슨을 사용하여 만들어졌습니다. 대장균 기증자 세포로부터 B. gladioli Lv-StA로 의 결합을 통해 Tn5 트랜스포손과 반전된 반복에 의해 측면에 있는 항생제 내성 카세트를 운반하는 pRL27 플라스미드가 전송되었다(도1). 이에 따라 3,736개의 공생 유전자의 중단을 개별적으로 전달하는 돌연변이 세트가 생성되었다(그림2).
돌연변이 풀은 딱정벌레 계란에 감염되어 식민지 인자를 식별하고, 대조군으로서, 또한 킹스 B (KB) 배지에서 시험관내에서 성장하였다. 식민지화를 위한 충분한 시간을 허용한 후에, 부화한 애벌레는 DNA 추출을 위해 집합되고 풀화되었습니다. B. gladioli Lv-StA의 트랜스포슨 삽입 및 측면 게놈 영역을 포함하는 DNA의 단편은 시퀀싱을 위한 수정된 DNA 라이브러리 준비 프로토콜을 사용하여 선택되었다. 읽기 품질 처리 에 따른 DESeq2 분석은 알 표면을 통해 전송될 때 L. villosa 애벌레를 식민지화하기 위하여 B. gladioli Lv-StA에 중요한 특정 유전자를 확인하기 위하여 실행되었습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2,6- Diaminopimelic Acid</td>
			<td>Alfa Aesar</td>
			<td>B22391</td>
			<td>For E.coli WM3064+ pRL27</td>
		</tr>
		<tr>
			<td>Agar - Agar</td>
			<td>Roth</td>
			<td>5210</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Biozym</td>
			<td>840004</td>
			<td></td>
		</tr>
		<tr>
			<td>AMPure beads XP (magentic beads + polyethylene glycol + salts)</td>
			<td>Beckman Coulter</td>
			<td>A63880</td>
			<td>Size selection in step 6.6</td>
		</tr>
		<tr>
			<td>Bleach (NaOCl) 12%</td>
			<td>Roth</td>
			<td>9062</td>
			<td></td>
		</tr>
		<tr>
			<td>Bowtie2 v.2.4.2</td>
			<td></td>
			<td></td>
			<td>Bioinfromatic tool for read mapping. Reference 10 in main manuscript.</td>
		</tr>
		<tr>
			<td>Buffer-S</td>
			<td>Peqlab</td>
			<td>PEQL01-1020</td>
			<td>For PCRs</td>
		</tr>
		<tr>
			<td>Cell scraper</td>
			<td>Sarstedt</td>
			<td>83.1830</td>
			<td></td>
		</tr>
		<tr>
			<td>Cutadapt v.2.10</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for removing specific adapter sequences from the reads. Reference 8 in main manuscript.</td>
		</tr>
		<tr>
			<td>DESeq2</td>
			<td></td>
			<td></td>
			<td>RStudio package for assessing differential mutant abundance. Usually used for RNAseq analysis. Reference 12 in main manuscript.</td>
		</tr>
		<tr>
			<td>DNA ladder 100 bp</td>
			<td>Roth</td>
			<td>T834.1</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Life Technology</td>
			<td>R0182</td>
			<td>PCR for confirming success of conjugation</td>
		</tr>
		<tr>
			<td>EDTA, Di-Sodium salt</td>
			<td>Roth</td>
			<td>8043</td>
			<td></td>
		</tr>
		<tr>
			<td>Epicentre MasterPure Complete DNA and RNA Purification Kit</td>
			<td>Lucigen</td>
			<td>MC85200</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Roth</td>
			<td>2218.1</td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC v.0.11.8</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for assessing the quality of sequencing data. Reference 7 in main manuscript.</td>
		</tr>
		<tr>
			<td>FeatureCounts v.2.0.1</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool to obtain read counts per genomic feature. Reference 11 in main manuscript.</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Roth</td>
			<td>7530</td>
			<td></td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>Roth</td>
			<td>P749</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin sulfate</td>
			<td>Serva</td>
			<td>26899</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Merck</td>
			<td>4936</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Roth</td>
			<td>3904</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4.7H2O</td>
			<td>Roth</td>
			<td>PO27</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>Roth</td>
			<td>P030</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Merck</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBNext Multiplex Oligos for Illumina (Index primers set 1)</td>
			<td>New England Biolabs</td>
			<td>E7335S</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBNext Ultra II DNA library prep kit for Illumina</td>
			<td>New England Biolabs</td>
			<td>E7645S</td>
			<td></td>
		</tr>
		<tr>
			<td>Peptone (soybean)</td>
			<td>Roth</td>
			<td>2365</td>
			<td>For Burkholderia gladioli Lv-StA KB-medium</td>
		</tr>
		<tr>
			<td>peqGOLD &#39;Hot&#39; Taq- DNA Polymerase</td>
			<td>VWR</td>
			<td>PEQL01-1020</td>
			<td>PCR for confirming success of conjugation</td>
		</tr>
		<tr>
			<td>Petri plates - 145 x 20 mm</td>
			<td>Roth</td>
			<td>XH90.1</td>
			<td>For selecting transconjugants</td>
		</tr>
		<tr>
			<td>Petri plates - 90 x 16 mm</td>
			<td>Roth</td>
			<td>N221.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiaxcel (StarSEQ GmbH, Germany)</td>
			<td></td>
			<td></td>
			<td>Quality check after DNA library preparation</td>
		</tr>
		<tr>
			<td>Streptavidin beads</td>
			<td>Roth</td>
			<td>HP57.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>VWR</td>
			<td>01-1020</td>
			<td></td>
		</tr>
		<tr>
			<td>Trimmomatic v.0.36</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for trimming low quality reads and also adapter sequences. Reference 9 in main manuscript.</td>
		</tr>
		<tr>
			<td>Tris -HCl</td>
			<td>Roth</td>
			<td>9090.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>Roth</td>
			<td>2366</td>
			<td>For Escherichia coli WM3064+pRL27 LB medium</td>
		</tr>
		<tr>
			<td>Ultrasonicator</td>
			<td>Bandelin</td>
			<td>GM 70 HD</td>
			<td>For shearing</td>
		</tr>
		<tr>
			<td>USER enzyme (uracil DNA glycosylase + DNA glycosylase- lyase Endonuclease VIII)</td>
			<td>New England Biolabs</td>
			<td>E7645S</td>
			<td>Ligation step 6.5.2</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Roth</td>
			<td>2363</td>
			<td></td>
		</tr>
	</tbody>
</table>

transposon-insertion sequencing as a tool to elucidate bacterial colonization factors in a burkholderia gladioli symbiont of lagria villosa beetles

그들의 활동을 조작하여 유전자의 기능을 추론하는 것은 대부분의 생물학 프로세스의 유전 기초를 이해하기 위한 필수적인 공구입니다. 분자 미생물학의 발전은 유전자의 조작을 위한 다양한 돌연변이 발생 기술의 출현을 보았습니다. 그 중에서도, 트랜스포슨 삽입 시퀀싱(Tn-seq)은 무표적 방식으로 많은 후보 유전자의 기능을 동시에 평가하는 귀중한 도구이다. 이 기술은 여러 병원성 미생물과 몇 가지 유익한 공생에서 진핵 호스트의 식민지화를 위한 분자 메커니즘을 식별하는 열쇠가 되었습니다.
여기서 Tn-seq는 딱정벌레 라그리아 빌로사의상호 적인 부르크홀더리아 글래디올리 공생에서 식민지 화 요인을 식별하는 방법으로 설립된다. 인주에 의해, Tn5 트랜스포손 매개 삽입항생제 내성 카세트는 B. gladioli의무작위 게놈 위치에서 수행된다. 딱정벌레 숙주를 식민지화하는 박테리아의 능력에 대한 유전자 중단의 효과를 확인하기 위해 생성된 B. gladioli 트랜스포슨 돌연변이 라이브러리는 딱정벌레 계란에 접종되고, 액체 배양 배지에서 체외에서 대조군이 성장한다. 식민지화에 충분한 시간을 허용한 후, DNA는 생체 내 및 체외 재배 라이브러리에서 추출됩니다. DNA 라이브러리 준비 프로토콜에 따라 DNA 샘플은 트랜스포슨 삽입 시퀀싱을 위해 준비됩니다. 트랜스포슨 삽입 가장자리와 측면 세균 DNA를 포함하는 DNA 단편이 선택되고, 돌연변이 부위는 트랜스포슨 삽입 가장자리에서 멀리 시퀀싱하여 결정된다. 마지막으로, 생체 내 및 체외 라이브러리 사이의 각 돌연변이의 주파수를 분석하고 비교함으로써 딱정벌레 식민지 화 시 특정 공생 유전자의 중요성을 예측할 수 있습니다.

호스트 관련 박테리아는 접착, 운동성, 화학 요법, 스트레스 반응 또는 특정 운송업체를 포함한 여러 가지 요인을 사용하여 협회를 설립할 수 있습니다. 병원체 숙주 상호 작용에 중요한 요인은 여러 박테리아에 대해보고되었지만, 13,14,15,16,17,18,속 버크 홀더리아19의구성원을 포함,20,적은 연구는 식민지에 대한 유익한 공생에 의해 사용되는 분자 메커니즘을탐구했다 21,22,23 . 트랜스포슨 삽입 시퀀싱을 사용하여, 목표는 B. gladioli가 L. villosa 딱정벌레를 식민지화할 수 있게 하는 분자 요인을 확인하는 것이었습니다.
트랜스포손 매개 돌연변이 발생은 Tn5 트랜스포손과 반전 반복 부위에 의해 측면에 있는 카나마이신 저항 카세트를 운반하는 pRL27 플라스미드를 사용하여 수행되었다. 플라스미드는 플라스미드 기증자 E. 대장균 WM3064 균주와 의합으로써 표적 B. gladioli Lv-StA 세포로 도입되었다(도 1에도시된 바와 같이). 컨쥬게이션 후, B. gladioli 수신자와 대장균 기증자 세포를 포함하는 유도 믹스는 카나마이신을 포함하는 선택적 천판에 도금되었다. 플레이트상DAP의 부재로 기증자 대장균 세포와 성공적인 B. gladioli Lv-StA 트랜스컨저개를 위해 선택된 카나마이신의 존재가 제거되었습니다. 100,000개의 트랜스콘주간트 콜로니를 수확하여 얻은 풀링된 B. gladioli Lv-StA 돌연변이 라이브러리는 수정된 DNA 라이브러리 준비 키트 및 사용자 지정 프라이머를 사용하여 시퀀싱을 위해 준비되었다. 그림 2는 DNA 라이브러리 준비 단계를 강조합니다. 시퀀싱은 4 미오 페어링 읽기를 산출; B. gladioli Lv-StA에 있는 7,468의 유전자중 3,736의 유전자는 중단되었습니다.
호스트에서 식민지 결함이 있는 돌연변이를 확인하기 위해 B. gladioli Lv-StA 돌연변이 라이브러리는 딱정벌레 알에 감염되어 KB 배지에서 대조군으로 성장했습니다. 생체 내 식민지 병목 현상 크기는 실험 전에 계산하였다. 알려진 수의 B. gladioli Lv-StA 세포는 딱정벌레 계란에 감염되었고, 갓 부화한 첫 번째 인스타 애벌레에서 식민지 세포의 수는 각 애벌레로부터 현탁액을 도금하고 개별당 식민지 형성 단위를 계산하여 수득하였다. 이러한 계산은 식민지 세포의 수가 호스트를 식민지화하는 능력에 대한 라이브러리에서 돌연변이의 전부 또는 높은 비율을 평가하기에 충분한지 확인하기 위해 수행되었다. 추가적으로, 시험관 내및 생체 내 조건 사이 성장 시간은 이 견본을 비교하기 위하여 세균성 세대의 수에 근거를 두어 정규화되었습니다.
알이 부화한 후 13개의 수영장에서 1,296개의 유충이 수집되었습니다. 생체 내 돌연변이 배양은 글리세롤 주식으로 재배되고 저장되었다. 생체 내 및 체외 에서 재배된 돌연변이 라이브러리의 DNA를 초음파에서 추출하여 단편화시켰다. 도 3은 파편의 대부분이 예상대로 100에서 400 bp 사이에 걸쳐 있는 전단 된 DNA의 크기 분포를 보여줍니다. 이 단계는 시퀀싱을 위한 수정된 DNA 라이브러리 준비 프로토콜에 의해 뒤따랐다. 프로토콜의 각 단계에서, 남은 DNA의 농도는 단계가 올바르게 수행되었는지 확인하고 DNA의 손실을 추적하기 위해 검사되었다. 품질 검사 (재료의 표참조) 시퀀싱 전에 DNA 라이브러리는 예기치 않게 큰 (>800 bp) DNA 조각을 포함하고 있음을 밝혀, 이것은 생체 내 라이브러리에서 더 발음되었다. 시퀀싱 레인에서 조각의 클러스터링을 최적화하는 데 어려움을 감안할 때, 원하는 판독 횟수를 달성하기 위해 생체 내 라이브러리에서 10 개의 Mio 페어링 된 읽기로 시퀀싱 깊이를 증가시킬 필요가 있었습니다. 시퀀싱 결과의 분석은 생체 내 라이브러리에서 평균 4 개의 미오가 읽으며 시험관 내 3.1 Mio가 판독-1(표 9)의5'끝에 트랜스 포슨 가장자리를 포함하고 있는 것으로 나타났습니다. 원래 라이브러리에서 B. gladioli 게놈을 가로 질러 24,224 개의 고유 삽입의 분포는 도 4에도시된다. DESeq2를 사용하여 수행된 분석에 따르면 271개의 돌연변이체의 풍부도생체 내 및 체외 조건 간에 상당히 다른 것으로 나타났습니다.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62843/62843fig03.jpg"> 도 3: 돌연변이 및 DNA 라이브러리의 아가로즈 젤. (A)아가로즈 젤은 레인 x에서 돌연변이의 미광택 DNA와 스케일을 위한 1kbp 사다리를 가진 아가로즈 젤. (B)전철 DNA 라이브러리와 젤. 첫 번째 차선의 사다리의 밴드 크기는 왼쪽에 표시됩니다. 처음 세 차선 a, b 및 c에는 생체 내 라이브러리의 전조된 DNA 조각이 들어있습니다. 차선 d, e, f 및 g에는 체외 라이브러리의 전단 DNA 조각이 포함되어 있습니다. <a href="https://www.jove.com/files/ftp_upload/62843/62843fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62843/62843fig04.jpg"> 그림 4: 버크홀더리아 글래디올리 Lv-StA 게놈의 4개의 규충에 걸쳐 원래 라이브러리에 고유 삽입 사이트의 위치. x축을 따라 있는 각 막대는 삽입 사이트에 있습니다. y축을 따라 막대의 높이는 해당 사이트와 연결된 읽기 수에 해당합니다. 두 개의 염색체와 두 개의 플라스미드가 전체 길이로 표시되므로 x 축에 다른 비늘이 있습니다. <a href="https://www.jove.com/files/ftp_upload/62843/62843fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="2">킹스 B 중간/ 한천</td>
		</tr>
<tr>
<td>펩톤 (대두)</td>
			<td>20 g/L</td>
		</tr>
<tr>
<td>K2HPO4
</td>
			<td>1.5 g/L</td>
		</tr>
<tr>
<td>MgSO4.7H2O</td>
			<td>1.5 g/L</td>
		</tr>
<tr>
<td>아가르 (Agar)</td>
			<td>15 g/L</td>
		</tr>
<tr>
<td colspan="2">증류수에 용해</td>
		</tr>
<tr>
<td colspan="2">LB 미디엄/한천</td>
		</tr>
<tr>
<td>트립톤</td>
			<td>10 g/L</td>
		</tr>
<tr>
<td>효모 추출물</td>
			<td>5 g/L</td>
		</tr>
<tr>
<td>나Cl</td>
			<td>10 g/L</td>
		</tr>
<tr>
<td colspan="2">증류수에 용해</td>
		</tr>
</tbody></table>표 1: 미디어 구성 요소입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>아니요.</td>
			<td>뇌관</td>
			<td colspan="2">순서</td>
			<td>PCR 어닐링 온도. (°C)</td>
		</tr>
<tr>
<td>1</td>
			<td>tpnRL17-1RC</td>
			<td colspan="2">5'-CGTTACATCCCTCTGTT-3'</td>
			<td rowspan="2">58.2</td>
		</tr>
<tr>
<td>2</td>
			<td>tpnRL13-2RC</td>
			<td colspan="2">5'-TCGTGA아가그GTTGCTG-3'</td>
		</tr>
</tbody></table>표 2: 연상의 성공을 확인하는 프라이머.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>구성 요소</td>
			<td>부피(μL)</td>
		</tr>
<tr>
<td>HPLC 정제수</td>
			<td>4.92</td>
		</tr>
<tr>
<td>10x 버퍼 S(높은 특이성)</td>
			<td>1</td>
		</tr>
<tr>
<td>MgCl2 (25 mM)</td>
			<td>0.2</td>
		</tr>
<tr>
<td>dNTP (2mM)</td>
			<td>1.2</td>
		</tr>
<tr>
<td>프라이머 1 (오후 10시/μL)</td>
			<td>0.8</td>
		</tr>
<tr>
<td>프라이머 2 (10 pmol/μL)</td>
			<td>0.8</td>
		</tr>
<tr>
<td>타크 (U/μL 5개)</td>
			<td>0.08</td>
		</tr>
<tr>
<td>마스터믹스 합계</td>
			<td>9</td>
		</tr>
<tr>
<td>템플렛</td>
			<td>1</td>
		</tr>
</tbody></table>표 3: PCR 마스터 믹스는 컨쥬게이션의 성공을 확인합니다. 약어: HPLC = 고성능 액체 크로마토그래피; dNTP = 탈옥뉴클레오사이드 트리호스페이트.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>단계</td>
			<td>온도 °C</td>
			<td>시간</td>
			<td>사이클</td>
		</tr>
<tr>
<td>초기 성하</td>
			<td>95</td>
			<td>3분</td>
			<td>1</td>
		</tr>
<tr>
<td>변성</td>
			<td>95</td>
			<td>40 s</td>
			<td></td>
		</tr>
<tr>
<td>어 닐 링</td>
			<td>58.2</td>
			<td>40 s</td>
			<td>30 ~35</td>
		</tr>
<tr>
<td>확장</td>
			<td>72</td>
			<td>1-2분</td>
			<td></td>
		</tr>
<tr>
<td>최종 확장</td>
			<td>72</td>
			<td>4분</td>
			<td>1</td>
		</tr>
<tr>
<td>들다</td>
			<td>4</td>
			<td colspan="2">∞</td>
		</tr>
</tbody></table>표 4: PCR 조건은 컨쥬게이션의 성공을 확인합니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관</td>
			<td colspan="2">순서</td>
			<td>Tm °C</td>
			<td>쓰다</td>
			<td>근원</td>
		</tr>
<tr>
<td>트랜스포슨 별 바이오티니저 프라이머</td>
			<td colspan="2">5'-비오틴-ACAGGAACACTTAACGGCTGACATG -3'</td>
			<td>63.5</td>
			<td>6.7.1. PCR I</td>
			<td>관습</td>
		</tr>
<tr>
<td>수정된 범용 PCR 프라이머</td>
			<td colspan="2">5'-아가타그그CGACCACCACCACCACCATC 타박트CTTTCCCTACACGACGCTC TTCCGATCTGAATTCATCGAT가트 GGTTGAGATGT – 3'</td>
			<td>62</td>
			<td>6.10.1. PCR II</td>
			<td>관습</td>
		</tr>
<tr>
<td>인덱스 프라이머</td>
			<td colspan="3">제조업체 매뉴얼 참조</td>
			<td>6.7.1. PCR I 및 6.10.1. PCR II</td>
			<td>일루미나에 대한 NEBNext 멀티플렉스 올리고스 (인덱스 프라이머 세트 1)</td>
		</tr>
<tr>
<td>어댑터</td>
			<td colspan="3">제조업체 매뉴얼 참조</td>
			<td>6.5. 어댑터 리시션</td>
			<td>일루미나를 위한 NEBNext 울트라 II DNA 라이브러리 준비 키트</td>
		</tr>
</tbody></table>표 5: DNA 라이브러리 준비 중 PCR I 및 II용 프라이머 및 어댑터입니다. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>PCR 믹스</td>
			<td>(μL)</td>
		</tr>
<tr>
<td>어댑터 계각 DNA 단편</td>
			<td>15</td>
		</tr>
<tr>
<td>NEBNext 울트라 II Q5 마스터 믹스</td>
			<td>25</td>
		</tr>
<tr>
<td>인덱스 프라이머(오후 10시/μL)</td>
			<td>5</td>
		</tr>
<tr>
<td>트랜스포슨 특정 바이오티니저 프라이머 (10 pmol/μL)</td>
			<td>5</td>
		</tr>
<tr>
<td>총 볼륨</td>
			<td>50</td>
		</tr>
</tbody></table>표 6: DNA 라이브러리 준비-PCRI 마스터 믹스.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>단계</td>
			<td>온도</td>
			<td>시간</td>
			<td>사이클</td>
		</tr>
<tr>
<td>초기 성하</td>
			<td>98 °C</td>
			<td>30 s</td>
			<td>1</td>
		</tr>
<tr>
<td>변성</td>
			<td>98 °C</td>
			<td>10 s</td>
			<td rowspan="3">6 ~ 12</td>
		</tr>
<tr>
<td>어 닐 링</td>
			<td>65 °C</td>
			<td>30 s</td>
		</tr>
<tr>
<td>확장</td>
			<td>72 °C</td>
			<td>30 s</td>
		</tr>
<tr>
<td>최종 확장</td>
			<td>72 °C</td>
			<td>2분</td>
			<td>1</td>
		</tr>
<tr>
<td>들다</td>
			<td>16°C</td>
			<td colspan="2">∞</td>
		</tr>
</tbody></table>표 7: DNA 라이브러리 준비-PCR I 및 II 조건.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>PCR 믹스</td>
			<td>(μL)</td>
		</tr>
<tr>
<td>비드 선택 DNA</td>
			<td>15</td>
		</tr>
<tr>
<td>NEBNext 울트라 II Q5 마스터 믹스</td>
			<td>25</td>
		</tr>
<tr>
<td>인덱스 프라이머</td>
			<td>5</td>
		</tr>
<tr>
<td>수정된 범용 PCR 프라이머</td>
			<td>5</td>
		</tr>
<tr>
<td>총 볼륨</td>
			<td>50</td>
		</tr>
</tbody></table>표 8: DNA 라이브러리 준비-PCR II 마스터 믹스.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="2">라이브러리</td>
			<td>인비보-1</td>
			<td>인비보-2</td>
			<td>인비보-3</td>
			<td>인비스트로-1</td>
			<td>인비스트로-2</td>
			<td>인비스트로-3</td>
			<td>원본 라이브러리</td>
		</tr>
<tr>
<td colspan="2">아니요. 읽기 (PE)</td>
			<td>56,57,710</td>
			<td>39,19,051</td>
			<td>30,65,849</td>
			<td>35,73,494</td>
			<td>28,83,440</td>
			<td>36,61,956</td>
			<td>46,09,410</td>
		</tr>
<tr>
<td colspan="2">아니요. Tn을 포함하는 읽기의 – 읽기-1의 5'끝에 가장자리</td>
			<td>54,15,880</td>
			<td>37,31,169</td>
			<td>29,36,247</td>
			<td>33,00,499</td>
			<td>27,35,705</td>
			<td>33,50,402</td>
			<td>41,53,270</td>
		</tr>
<tr>
<td colspan="2">Bowtie2 전체 정렬 속도 (%) (읽기-1만)</td>
			<td>95.53%</td>
			<td>83.71%</td>
			<td>89.87%</td>
			<td>80.79%</td>
			<td>78.00%</td>
			<td>73.06%</td>
			<td>74.92%</td>
		</tr>
<tr>
<td colspan="2">고유 삽입 수</td>
			<td>8,539</td>
			<td>4,134</td>
			<td>7,183</td>
			<td>18,930</td>
			<td>18,421</td>
			<td>20,438</td>
			<td>24,224</td>
		</tr>
<tr>
<td colspan="2">명중된 유전자의 수</td>
			<td>1575</td>
			<td>993</td>
			<td>1450</td>
			<td>2793</td>
			<td>2597</td>
			<td>3037</td>
			<td>3736</td>
		</tr>
</tbody></table>표 9: 라이브러리당 시퀀싱 출력 및 트랜스포슨 삽입 주파수의 요약입니다. 약어: PE = 페어링-엔드.

Watch this Scientific Journal Video about Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles at JoVE.co

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

이것은 버크 홀더리아 유익한 공생에서 후보 곤충 식민지 요인을 식별하기위한 적응 된 방법입니다. 딱정벌레 숙주는 트랜스포슨 돌연변이 발생을 통해 생성된 무작위 돌연변이 라이브러리에 감염되며, 식민지 화 후 라이브러리 복잡성은 시험관내에서자란 대조군과 비교된다.

라그리아 빌로사 딱정벌레의 부르크홀더리아 글래디올리 공생에서 세균 식민지 요인을 해명하는 도구로 트랜스포슨 삽입 시퀀싱

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

이 프로토콜은 공생 박테리아에 유전 조작을 수행하는 데 유용, 이 경우, 특히 Burkholderia에, 곤충 호스트를 식민지에 필수적인 유전자를 식별. 트랜스포슨 삽입 시퀀싱은 단일 실험에서 많은 수의 조건부 필수 유전자를 동시에 식별하기 위한 강력한 도구입니다. 멸균 후드 아래 카나마이신과 DAP로 보충된 LB 배지의 10밀리리터에서 E.coli 기증자의 신선한 기증자 문화를 접종하는 것으로 시작하십시오.KB 배지의 5밀리리터에서 C수신자 세포를 접종한 버크홀더리아 검투사. 250 RPM에서 셰이커에 하룻밤 30도에서 문화를 배양. 하룻밤 성장 후, 원심분리기 는 세포를 펠릿하고 상체를 폐기하기 위해 6 분 동안 9, 600 회 G에서 각 배양의 4 밀리리터를 제거합니다.멸균 후드 아래에서, DAP를 포함하는 KB 배지에서 펠렛 세포 배양을 세척한다. 그리고 마지막으로, KB 플러스 DAP 매체의 4 밀리리터에서 별도로 문화를 다시 중단합니다. 신선한 15 밀리리터 튜브에서 세척된 대장균 기증자 세포의 250마이크로리터를 세척된 버크홀더리아 검투사 균주 A 수취인 세포의 1밀리리터와 혼합합니다.DAP를 함유한 KB 천판에 이 컨쥬게이션 셀 혼합물의 10마이크로리터를 반점한다. 접시가 실온에서 멸균 후드에 방해받지 않고 1 시간 동안 쉬도록 하십시오. 12~18시간 동안 30도의 연상 반점으로 플레이트를 배양합니다.인큐베이션 후, 멸균 후드 아래 플레이트에 1X PBS의 2~4밀리리터를 추가하고 세포 스크레이퍼를 사용하여 한천에서 재배된 세균 성 균류 반점을 방출합니다. 그런 다음 두 밀리리터 마이크로 퍼지 튜브로 컨쥬게이트 셀 믹스를 피펫. 2 분 동안 9, 600 배 G에서 원심 분리에 의해 세포를 펠렛.상체를 버리고 1X PBS의 1 밀리리터에서 위아래로 파이프를 통해 펠릿을 두 번 씻으십시오. 1X PBS의 1, 200 마이크로리터에서 최종 펠릿을 다시 중단합니다. 잘 섞어서 카나마이신으로 보충된 대형 KB 식천 판에 셀 혼합물 100마이크로리터를 넣고 하룻밤 사이에 섭씨 30도에서 배양합니다.세 개의 플레이트에 있는 트랜스콩트 식민지의 총 수를 계산하고 모든 판에서 얻은 돌연변이의 대략적인 수를 계산하기 위하여 추정합니다. 대표적인 도서관을 획득할 확률을 높이기 위해 총 식민지 수가 게놈의 총 유전자 수보다 몇 배 더 높은지 확인합니다. 컨쥬게이션의 성공을 확인하기 위해 원고에 설명된 바와 같이 10~20개의 샘플 콜로니를 사용하여 삽입 카세트를 대상으로 PCR을 수행한다.멸균 후드 아래에서 한천에 1~2밀리리터를 추가하여 접시에서 콜로니를 긁어냅니다. 접시에서 긁어낸 셀 혼합물을 50 밀리리터 튜브로 풀을 냅니다. 라이브러리를 철저히 혼합한 다음 풀링된 돌연변이 라이브러리의 밀리리터 1밀리리터를 여러 개의 저저온 튜브로 분할합니다.튜브에 70%의 글리세롤 1밀리리터를 넣고 섭씨 영하 80도에 보관하십시오. L.villosa 계란 클러치를 선택하고 클러치에 100 개 이상의 달걀이 들어있는 경우 계속 계란의 수를 계산합니다. 계란 클러치 전체를 소독하려면 70%에탄올200 마이크로리터를 넣고 달걀을 5분간 부드럽게 씻은 다음 에탄올을 제거하고 자동 물로 계란을 두 번 씻습니다.표백제 12%의 마이크로리터 200기를 넣고 달걀을 30초 동안 부드럽게 씻습니다. 표백제를 즉시 제거하고 200 마이크로리터의 오토클레이터로 다시 세 번 씻어내십시오. PBS에 있는 세척된 돌연변이 도서관의 마이크로리터 당 6개의 세포에 2회 10을 사용하여 멸균된 계란 클러치에 있는 계란을 감염시.감염된 딱정벌레 애벌레 해치 후 이틀 후, 1.5 밀리리터 미세 후지 튜브 당 100 초 인스타 애벌레를 수집하고 영하 80도에서 저장합니다. 체외제어 라이브러리를 생성하기 위해, 가나마이신을 함유한 KB 배지의 10밀리리터에서 돌연변이 라이브러리의 마이크로리터 당 6개의 세포에 2회 10의 마이크로리터를 접종한다. 생체 내 및 체외에서 성장한 돌연변이 라이브러리에서 DNA를 추출한 후 초음파 검사기와 DNA를 공유하십시오.DNA가 원하는 크기 범위로 전염되었는지 확인하기 위해 젤 로딩 염료와 혼합한 후 40분 동안 250볼트에서 250볼트로 실행되는 1.6%의 아가로즈 젤을 사용하여 미세어드 및 시어드 DNA의 5마이크로리터를 적재한다. 어댑터 결찰에 필요한 단편 단자를 준비하려면, 효소 혼합물의 3개의 마이크로리터와 7개의 반응 완충제의 마이크로리터를 시어드 DNA의 50마이크로리터에 추가하고 파이펫팅하여 잘 섞는다. 가열 된 뚜껑이 섭씨 75도 보다 크거나 같으면 서열 자전거를 설정하고 섭씨 20도에서 30 분, 섭씨 65도에서 30 분 동안 샘플을 인큐베이션한 다음 섭씨 4도에서 온도를 유지하십시오.어댑터 리딩의 경우, 결찰 마스터 믹스 30마이크로리터, 결찰 증강제 1편, 희석어 2.5마이크로리터를 최종 준비 단계의 제품에 추가합니다. 피펫팅으로 철저히 섞고 가열된 뚜껑을 끄고 온도 순환기의 섭씨 20도에서 15분 동안 샘플을 배양합니다. 15분 후 효소의 마이크로리터 3기를 추가합니다.피펫팅으로 잘 섞고 온도 47도 이상으로 가열된 뚜껑을 열주기에서 섭씨 37도에서 15분 동안 배양합니다. 250개의 베이스 쌍의 어댑터 리그 DNA 표적화 단편의 크기를 선택하려면 마그네틱 비드 용액을 소용돌이로 시작하여 사용하기 30분 전에 실온에 놓습니다. 구슬의 0.3 배를 합착 된 DNA 혼합물의 96.5 마이크로 리터에 넣고 완전히 파이펫팅하여 혼합하십시오.비드 혼합물을 5분간 배양합니다. 튜브를 자기 스탠드에 놓고 구슬을 내리고 원치 않는 크기의 DNA 조각을 제거합니다. 구슬을 5분 동안 정착한 다음 명확한 상체를 새로운 미세분리기 튜브로 옮기게 합니다.상체에 신선한 구슬의 0.15 배를 추가하고 잘 파이펫으로 혼합. 비드 혼합물을 5분 동안 배양한 다음 자기 스탠드에 튜브를 배치하여 대상 DNA에 묶인 구슬을 끌어당깁니다. 5분 간 기다린 다음, 상수구를 버리고 구슬을 보관합니다.마그네틱 스탠드에 구슬을 장착하면 갓 준비된 80%에탄올 200마이크로리터를 넣고 30초 동안 기다렸다가 비슬을 방해하지 않고 에탄올을 폐기합니다. 스탠드에서 튜브를 제거하고 0.1X TE 또는 Low TE의 17 마이크로 리터를 추가 한 다음 10 번 파이프팅하여 혼합하고 실온에서 2 분 동안 혼합물을 배양합니다. 자기 스탠드에 튜브를 놓고 PCR-1에 대한 크기 선택 된 DNA의 15 마이크로 리터를 가져 가라.소용돌이 연쇄상 구슬을 실온에 30 분 이상 배치하십시오. 구슬 32 마이크로리터를 1X 결합 및 세척 버퍼 500 마이크로리터로 세척하십시오. 2X 바인딩 및 세척 버퍼의 32 마이크로 리터를 추가하고 구슬을 다시 중단합니다.이를 위해, 청소 PCR-1 제품의 32 마이크로 리터를 추가합니다. 철저히 섞어서 실온에서 30분간 배양하세요. 비드 DNA 혼합물을 자기 스탠드에 2분간 놓습니다.삽입 가장자리를 포함하는 비오틴 태그 DNA로 피펫은 구슬에 스트렙타비딘에 결합합니다. 1X 결합 및 세척 버퍼의 500 마이크로 리터로 구슬을 씻은 다음 낮은 TE의 200 마이크로 리터로 구슬을 씻으신다. 낮은 TE의 17 마이크로 리터에서 DNA 바인딩 구슬을 다시 중단. 생체 내 및 체외 에서 재배된 돌연변이 라이브러리의 DNA는 초음파에서 추출및 단편화되어 100에서 400개의 기본 쌍 사이의 조각의 대부분을 보여주었습니다. 버크홀더리아 검투사 균주의 4개의 레플리턴을 가로지르는 트랜스포슨 매개 삽입의 위치는 포드에서 관찰될 수 있다.시퀀싱 출력및 생체 내 라이브러리에서 복제된 세 개의 복제에서 명중된 독특한 삽입 및 유전자의 수에 대한 요약은 테이블에서 관찰될 수 있다. 기억해야 할 중요한 것은 감염 시 라이브러리를 적절하게 표현하기 위해 호스트 식민지 화 시 인구 병목 현상 크기를 계산하는 것입니다. 또한, 시험관 내 및 숙주에서 호환되는 수의 세균 성 세대에 맞게 조정하십시오.트랜스포슨 돌연변이 라이브러리를 생성한 후, 선택적 매체에서 선별된 미디어를 스크리닝하여 현상차이에 기초하여 돌연변이를 복구할 수 있다. 조건에 중요한 특정 유전자는 이렇게 확인될 수 있습니다.

Research

JoVE Journal

Biology

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Use of Rotorod as a Method for the Qualitative Analysis of Walking in Rat

쥐에서 도보의 질적 분석 방법으로 Rotorod의 사용

High speed videoanalysis of the details of movement can provide a source of information about qualitative aspects of walking movements. When walking on a ...

연구

생물학

A Microfluidic Device for Quantifying Bacterial Chemotaxis in Stable Concentration Gradients

안정적인 농도 기울기에 박테리아 Chemotaxis을 Quantifying위한 Microfluidic 장치

Chemotaxis allows bacteria to approach sources of attractant chemicals or to avoid sources of repellent chemicals. Bacteria constantly monitor the ...

Correlative Light and Electron Microscopy (CLEM) as a Tool to Visualize Microinjected Molecules and their Eukaryotic Sub-cellular Targets

Correlative Light and Electron Microscopy CLEM as a Tool to Visualize Microinjected Molecules and their Eukaryotic Sub-cellular Targets

도구로 상호 빛과 전자 현미경 (클레멘 타인)는 Microinjected 분자와 진핵 세포 하위 세포 목표를 시각화하는 방법


The eukaryotic cell relies on complex, highly regulated, and functionally distinct membrane bound compartments that preserve a biochemical polarity ...

Electroantennographic Bioassay as a Screening Tool for Host Plant Volatiles

호스트 식물 휘발성 물질에 대한 선별 도구로 Electroantennographic Bioassay

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Ribosome 바운드 Polypeptides을 파악하는 도구로 SecM 체포 시퀀스를 사용하여

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism

Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism

사용<em&gt; 예쁜 꼬마 선충</em&gt; 다세포 생물의 단백질 항상성을 연구하는 모델 시스템으로

The folding and assembly of proteins is essential for protein function, the long-term health of the cell, and longevity of the organism. Historically, the ...

BEST: Barcode Enabled Sequencing of Tetrads

BEST : Tetrads의 바코드 사용 시퀀싱

Tetrad analysis is a valuable tool for yeast genetics, but the laborious manual nature of the process has hindered its application on large scales. ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

은 C-FOS 단백질 면역 조직 검색 : 특정 생리적 반응에 관여 중앙 진학의 마커로서 유용한 도구<em&gt; 생체</em&gt; 및<em&gt; 전의 VIVO</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

A Simple Bioassay for the Evaluation of Vascular Endothelial Growth Factors

혈관 내피 성장 인자의 평가에 대한 간단한 생물 검정

The analysis of receptor tyrosine kinases and their interacting ligands involved in vascular biology is often challenging due to the constitutive ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

개별 세포 유형의 전사 프로파일 링을위한 도구로 레이저를 이용한 이외에 Microdissection (LAM)

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...