Name: isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting
Uploaded: 2021-12-08T14:00:00
Description: Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

تم دعم هذا العمل جزئيا بواسطة NIH R00HD082686. نشكر زمالة الأبحاث الصيفية لجمعية الغدد الصماء إلى H.S.Z. كما نشكر الدكتور يوان كانغ على تربية مستعمرة الفئران والحفاظ عليها.

اتبعت جميع التجارب التي أجريت على الحيوانات البروتوكولات المعتمدة من قبل اللجان المؤسسية لرعاية واستخدام الحيوانات (IACUC) في جامعة أوبورن.
ملاحظة: يستخدم البروتوكول التالي خصية واحدة (حوالي 100 ملغ) في P28 من Gli1-CreERT2 ؛ فئران NuTRAP (Mus musculus). قد تحتاج أحجام الكواشف إل?...

<ol>
	<li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support.">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li><li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis.">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li><li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain.">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li><li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+(TRAP).">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li><li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAP-rc,+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos.">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985 (2015).</li><li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(trap)+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale.">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919 (2020).</li><li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(TRAP)+for+RNA+isolation+from+endothelial+cells+in+vivo.">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624 (2019).</li><li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo.">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li><li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hedgehog:+functions+and+mechanisms.">Hedgehog: functions and mechanisms.</a> Genes &amp; Development. 22 (18), 2454-2472 (2008).</li><li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+integrity+number+(RIN)-standardization+of+RNA+quality+control.">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , 1-8 (2004).</li><li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone.">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li><li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages.">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li><li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog.">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li><li>Benton, L., Shan, L. -. X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+adult+Leydig+cells.">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li><li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+aspects+of+11&#946;-hydroxysteroid+dehydrogenase.+Testicular+11&#946;-hydroxysteroid+dehydrogenase:+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids.">Comparative aspects of 11&#946;-hydroxysteroid dehydrogenase. Testicular 11&#946;-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li><li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline.">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li><li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice.">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481 (2009).</li><li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+for+single-cell+isolation.">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+single-cell+RNA+sequencing+methods.">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+considerations+for+single-cell+rna+sequencing+approaches.">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108 (2018).</li><li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia.">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693 (2020).</li><li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells.">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li><li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice.">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li></ol>

يمكن أن تخفف فائدة تحليل نسخ الأنسجة الكاملة ، خاصة عند دراسة الأنسجة غير المتجانسة المعقدة. تصبح كيفية الحصول على الحمض النووي الريبي الخاص بنوع الخلية حاجة ملحة لإطلاق العنان لتقنية RNA-seq القوية. عادة ما يعتمد عزل الحمض النووي الريبي الخاص بنوع الخلية على جمع نوع معين من الخلايا باستخدام...

مكنت النهج عالية الإنتاجية ، بما في ذلك تسلسل الحمض النووي الريبي (RNA-seq) والمصفوفات الدقيقة ، من استجواب ملفات تعريف التعبير الجيني على مستوى الجينوم. بالنسبة للأنسجة المعقدة مثل القلب والدماغ والخصية ، ستوفر البيانات الخاصة بنوع الخلية مزيدا من التفاصيل التي تقارن استخدام الحمض النووي الريبي من الأنسجة بأكملها1،2،3. للتغلب على تأثير عدم التجانس الخلوي ، تم تطوير طريقة ترجمة تنقية تقارب الريبوسوم (TRAP) منذ أوائل عام 20104. TRAP قادر على عزل الحمض النووي الريبي المرتبط بالريبوسوم من أنواع خلايا معينة دون تفكك الأنسجة. تم استخدام هذه الطريقة لتحليل translatome (mRNAs التي يتم تجنيدها إلى الريبوسوم للترجمة) في كائنات مختلفة ، بما في ذلك استهداف مجموعة نادرة للغاية من الخلايا العضلية في أجنة ذبابة الفاكهة5 ، ودراسة الخلايا الجذرية المختلفة في نموذج النبات Arabidopsis thaliana6 ، وإجراء تحليل النسخ للخلايا البطانية في الثدييات7.
يتطلب TRAP تعديلا وراثيا لتمييز الريبوسوم لكائن نموذجي. طور إيفان روزن وزملاؤه مؤخرا نموذجا للفأر يسمى وضع العلامات النووية وترجمة الماوس8 لتنقية تقارب الريبوسوم (NuTRAP) ، والذي كان متاحا من خلال مختبر جاكسون منذ عام 2017. من خلال العبور مع خط الماوس Cre ، يمكن للباحثين استخدام نموذج الماوس NuTRAP هذا لعزل الحمض النووي الريبي المرتبط بالريبوسوم ونوى الخلايا من الخلايا المعبرة عن Cre دون فرز الخلايا. في الخلايا المعبرة عن Cre التي تحمل أيضا أليل NuTRAP ، يسمح الريبوسوم الموسوم EGFP / L10a بعزل ترجمة mRNAs باستخدام مقايسات القائمة المنسدلة للتقارب. في نفس الخلية ، يسمح الغشاء النووي الموسوم بببتيد التعرف على البيوتين (BLRP) ، والذي يكون أيضا إيجابيا ل mCherry ، بالعزل النووي باستخدام التنقية القائمة على التقارب أو التألق. قام فريق البحث نفسه أيضا بإنشاء خط فأر مشابه يتم فيه تسمية الغشاء النووي فقط ب mCherry بدون البيوتين8. يتيح هذان الخطان المعدلان وراثيا للفأر الوصول إلى توصيف الملامح الجينومية والنسخ المقترنة لأنواع معينة من الخلايا محل الاهتمام.
يلعب مسار إشارات القنفذ (Hh) دورا مهما في نمو الأنسجة9. يعمل GLI1 ، وهو عضو في عائلة GLI ، كمنشط نسخ ويتوسط إشارات Hh. يمكن العثور على خلايا Gli1 + في العديد من الأعضاء التي تفرز الهرمونات ، بما في ذلك الغدة الكظرية والخصية. لعزل الحمض النووي والحمض النووي الريبي الخاص بنوع الخلية من خلايا Gli1 + باستخدام نموذج الماوس NuTRAP ، تم تهجين الفئران Gli1-CreERT2 مع الفئران NuTRAP. كما تم تهجين فئران Shh-CreERT2 مع فئران NuTRAP بهدف عزل خلايا تعبير القنفذ الصوتي (Shh). يوضح البروتوكول التالي كيفية استخدام Gli1-CreERT2 ؛ فئران NuTRAP لعزل الحمض النووي الريبي المرتبط بالريبوسوم من خلايا Gli1 + في خصيتي الفئران البالغة.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Actb</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100 Bioanalyzer Instrument</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millipore</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>cycloheximide</td>
			<td>Millipore</td>
			<td>239764-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyp11a1</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>R0191</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT, Dithiothreitol</td>
			<td>Thermo Fisher Scientific</td>
			<td>P2325</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag-2 magnet</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tubes 15 mL</td>
			<td>VWR</td>
			<td>89039-666</td>
			<td></td>
		</tr>
		<tr>
			<td>GFP antibody</td>
			<td>Abcam</td>
			<td>ab290</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass grinder set</td>
			<td>DWK Life Sciences</td>
			<td>357542</td>
			<td></td>
		</tr>
		<tr>
			<td>heparin</td>
			<td>BEANTOWN CHEMICAL</td>
			<td>139975-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Hsd3b</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Biosciences</td>
			<td>R005</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Biosciences</td>
			<td>R004</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes 2 mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>02-707-354</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Clariom S Assay microarrays</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Microarray service</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Millipore</td>
			<td>492018-50 Ml</td>
			<td></td>
		</tr>
		<tr>
			<td>oligo (dT)20</td>
			<td>Invitrogen</td>
			<td>18418020</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoPure RNA Isolation Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>KIT0204</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G Dynabead</td>
			<td>Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>growcells</td>
			<td>NUPW-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>10777019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox9</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td>
		</tr>
		<tr>
			<td>Superscript IV reverse transcriptase</td>
			<td>Invitrogen</td>
			<td>18090050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309155</td>
			<td></td>
		</tr>
		<tr>
			<td>Sycp3</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Alfa Aesar</td>
			<td>J62848</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

يشكل عدم التجانس الخلوي تحديات لفهم وظيفة الأنسجة المعقدة على مستوى النسخ. يؤدي استخدام الحمض النووي الريبي الخاص بنوع الخلية إلى تجنب المزالق المحتملة الناجمة عن عدم تجانس الأنسجة ويطلق العنان لتحليل النسخ القوي. يوضح البروتوكول الموصوف هنا كيفية استخدام طريقة تنقية تقارب الريبوسوم المترجم (TRAP) لعزل الحمض النووي الريبي المرتبط بالريبوسوم من كمية صغيرة من الخلايا المعبرة عن EGFP في نسيج معقد دون فرز الخلايا. هذا البروتوكول مناسب لعزل الحمض النووي الريبي الخاص بنوع الخلية باستخدام نموذج الماوس NuTRAP المتاح مؤخرا ويمكن استخدامه أيضا لعزل الحمض النووي الريبي عن أي خلايا تعبر عن EGFP.

تم عبور الماوس Gli1-CreERT2 (رقم مخزون مختبر جاكسون: 007913) لأول مرة باستخدام فأر مراسل NuTRAP (رقم مخزون مختبر جاكسون: 029899) لتوليد فئران مزدوجة التحول. تم حقن الفئران التي تحمل أليلات الجينات المعدلة وراثيا (أي Gli1-CreERT2 و NuTRAP) بعقار تاموكسيفين مرة واحدة يوميا ، كل يومين ، لثلاث...

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

يهدف هذا البروتوكول إلى عزل mRNAs الريبوسومية المترجمة الخاصة بنوع الخلية باستخدام نموذج الماوس NuTRAP.

عزل الحمض النووي الريبي الخاص بنوع الخلية من عينات الأنسجة غير المتجانسة المجمدة بدون فرز الخلايا

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

يهدف هذا البروتوكول إلى الحصول على أنواع خلايا عالية الجودة من الحمض النووي الريبي المحدد من عدد صغير من الخلايا في نسيج معقد دون فرز الخلايا. يستخدم نموذج فأر متاح مؤخرا يسمح للباحثين بعزل الحمض النووي الريبي المرتبط بالريبوسوم باستخدام سحب GLP لأسفل. هذه الطريقة مناسبة أيضا لعزل الحمض النووي الريبي المرتبط بالريبوسوم من أي خلايا تعبر عن EGFP.للبدء ، أضف مليلتر من محلول عمل التجانس البارد إلى مجموعة مطحنة الأنسجة الزجاجية. ضع العينة المجمدة بسرعة في المطحنة وقم بتجانس الأنسجة ب 30 ضربة على الجليد باستخدام مدقة فضفاضة. نقل التجانس إلى أنبوب القاع المستدير 2 ملليلتر وأجهزة الطرد المركزي في 12،000 غرام لمدة 10 دقائق عند أربع درجات مئوية.ثم انقل المادة الطافية إلى أنبوب جديد بسعة ملليلتر دون إزعاج الحبيبات ، مع الاحتفاظ ب 100 ميكرولتر كمدخل. احتضان المادة الطافية بالجسم المضاد ل GFP عند أربع درجات مئوية على دوار من طرف إلى طرف طوال الليل. انقل خليط التجانس والأجسام المضادة إلى أنبوب سفلي دائري جديد بسعة 2 ملليلتر يحتوي على حبات البروتين G المغسولة وحضن أربع درجات مئوية على الدوار عند 24 دورة في الدقيقة لمدة ساعتين.افصل الخرزات المغناطيسية عن الطافية باستخدام رف مغناطيسي. احفظ المادة الطافية في صورة الكسر السالب الذي يحتوي على الحمض النووي الريبي في الخلايا السالبة EGFP والحمض النووي الريبي في الخلايا الموجبة EGFP غير المرتبطة بالريبوسومات. أضف ملليلتر واحد من محلول غسيل الملح العالي إلى الخرز ودوامة الأنبوب لفترة وجيزة لغسل الخرز.ثم ضع الأنبوب في رف مغناطيسي. قم بإزالة المخزن المؤقت للغسيل وكرر خطوات الغسيل مرتين أخريين للحصول على مركب الحمض النووي الريبي الريبوسوم من الخلايا الإيجابية EGFP. احتضان الخرز ب 50 ميكرولتر من محلول الاستخراج من مجموعة عزل الحمض النووي الريبي في ThermoMixer لمدة 30 دقيقة لتحرير الحمض النووي الريبي من الخرز.افصل الخرز برف مغناطيسي وانقل المادة الطافية إلى أنبوب سعة 1.5 ملليلتر. الطرد المركزي الأنبوب في 3000 غرام لمدة دقيقتين. ثم ماصة الطافية إلى أنبوب جديد 1.5 ملليلتر.لتكييف عمود تنقية الحمض النووي الريبي مسبقا ، ماصة 250 ميكرولتر من التكييف عازلة على عمود التنقية واحتضانها لمدة خمس دقائق في درجة حرارة الغرفة. ثم الطرد المركزي العمود في 16،000 غرام لمدة دقيقة واحدة. ماصة حجم متساو من الإيثانول 70 ٪ في استخراج الخلية وتخلط جيدا عن طريق ماصة .ماصة تصل إلى 200 ميكرولتر من الخليط في عمود تنقية الحمض النووي الريبي المشروط مسبقا. للحد من فقدان العينات لا تملأ العمود أكثر من 80٪ من سعته. كرر هذه الخطوة عدة مرات حتى يتم جمع جميع الحمض النووي الريبي في نفس العمود من كل كسر.جهاز طرد مركزي للعمود لمدة دقيقتين لربط الحمض النووي الريبي بالغشاء الموجود في العمود. ثم استمر في الطرد المركزي لمدة 30 ثانية. تجاهل التدفق من خلال وماصة 100 ميكرولتر من غسل عازلة واحد في العمود.جهاز طرد مركزي لمدة دقيقة واحدة ، ثم تخلص من التدفق من خلاله. ماصة 75 ميكرولتر من محلول الحمض النووي تخلط مباشرة في غشاء عمود التنقية. احتضان في درجة حرارة الغرفة لمدة 15 دقيقة.ثم ، ماصة 40 ميكرولتر من غسل عازلة واحدة في العمود وأجهزة الطرد المركزي لمدة 30 ثانية أخرى. تجاهل التدفق من خلال. ماصة 100 ميكرولتر من العازلة غسل اثنين في العمود وأجهزة الطرد المركزي في 8،000 غرام لمدة دقيقة واحدة.تجاهل التدفق من خلال. شراء PET 100 ميكرولتر من العازلة غسل اثنين في العمود وأجهزة الطرد المركزي في 16،000 غرام لمدة دقيقتين. تخلص من التدفق ، وأعد الطرد المركزي لنفس العمود عند 16،000 جم لمدة دقيقة واحدة لإزالة جميع آثار المخزن المؤقت للغسيل.انقل العمود إلى أنبوب طرد مركزي دقيق جديد سعة 1.5 ملليلتر. ماصة 12 ميكرولتر من الماء الخالي من RNase مباشرة على غشاء عمود التنقية لضمان عدم لمس طرف الماصة للغشاء. احتضان في درجة حرارة الغرفة لمدة دقيقة واحدة وأجهزة الطرد المركزي في 1000 غرام لمدة دقيقة واحدة.ثم في 16،000 غرام لمدة دقيقة واحدة لتقشير الحمض النووي الريبي. استخدم محلل حيوي لتقييم جودة وكمية الحمض النووي الريبي المستخرج. قم بتخزين الحمض النووي الريبي في فريزر 80 درجة أو أرسله لمزيد من التحليل.الفئران التي تحمل كلا من الأليلات الجينية المعدلة وراثيا ، Gli1-CreERT2 و NuTRAP يتم حقننا بعقار تاموكسيفين مرة واحدة يوميا ، كل يومين لثلاث حقن. يظهر تحليل التألق المناعي للأنسجة المجمعة أنه تم التعبير عن EGFP في الخلايا الخلالية في الخصيتين. تم العثور على EGFP أيضا في خلايا المحفظة الكظرية في Gli1-CreERT2 ، الفئران NuTRAP.في Sonic Hedgehog-CreERT2 ، فئران NuTRAP يتواجد عدد الخلايا الإيجابية EGFP في القشرة الخارجية للغدة الكظرية أسفل الكبسولة ، مما يؤكد التعبير عن خلايا التعبير المسبق EGFP. بعد استخراج الحمض النووي الريبي المحدد لنوع الخلية ، تم إرسال الحمض النووي الريبي المستخرج لتحليل microarray . أظهرت النتائج أنه تم إثراء حوالي 3000 جين في الجزء الموجب ، مقارنة بالجينات في الجزء السالب ، بينما تم إثراء حوالي 4000 جين في الجزء السالب.من بين الجينات المعبر عنها التفاضلية ، تم إثراء الجينات المرتبطة بخلية Leydig Hsd11b1 و Hsd3b6 في الكسر الموجب. في الجزء السالب ، تم إثراء الجينات المرتبطة بخلية سيرتولي Desert Hedgehog و Gstm6. تم تحديد عدد قليل فقط من الجينات المعبر عنها بشكل تفاضلي في مقارنة الكسر السالب مع المدخلات.تم استخدام RT-PCR الكمي في الوقت الفعلي لتأكيد التعبير عن الجينات الرئيسية في الكسور الموجبة والسالبة. على غرار ما تم العثور عليه في مقايسة microarray ، تم إثراء إنزيمات الستيرويد 3-beta hydroxy الستيرويد ديهيدروجينيز وإنزيم انشقاق السلسلة الجانبية للكوليسترول في الكسر الموجب. وفي الوقت نفسه ، تم إثراء عامل نسخ مربع SRY لعلامة خلية سيرتولي والبروتين المعقد المتشابك الثالث لعلامة الخلية الجرثومية في الكسر السالب.عند محاولة هذا البروتوكول ، من المهم تحضير محلول عمل تجانس جديد أضف DTT وريبونوكلياز سيكلوهيكسيميد المؤتلف وكوكتيل مثبط البروتيناز إلى محلول مخزون التجانس فقط قبل الاستخدام. من المهم أيضا تحضير محلول ملح طازج منخفض ومخازن غسيل عالية الملح قبل الاستخدام.

Research

JoVE Journal

Biology

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

أكتين المشارك الترسيب الفحص ، وبالنسبة للتحليل البروتين ملزمة لF - أكتين

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

مضان الفرز الخلية النباتية المنشط من Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

التحقيق في الأنسجة والجهاز محددة الردود فيتوكروم باستخدام نظام مراقبة الأصول الميدانية بمساعدة خلية من نوع التنميط معينة في التعبير thaliana Arabidopsis</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

متغايرة النوى وتقنيات لتحليل نوع من الترجمة الخاصة الخليوي

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

التنميط الجيني للعينات النباتية والحيوانية دون تنقية DNA قبل

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

الأمثل أساليب النمذجة وتلوين لرصد انتشار استخدام الأصباغ انقسام الخلية خلية تتبع

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Small Noncoding RNAs from Human Serum

عزل الرنا غير المكودة الصغيرة من مصل الإنسان

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

طريقة لقياس آخر من Deubiquitinating الانزيمات في خطوط الخلايا وعينات الأنسجة

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model

مغناطيسية تنشيط الخلية فرز الاستراتيجيات الرامية إلى عزل وتنقية الزليلي المستمدة من سائل الخلايا الجذعية الوسيطة من طراز الأرنب

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

تشيب-Seq: التنميط Epigenome الخلية-نوع معين

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...