Name: isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting
Uploaded: 2021-12-08T14:00:00
Description: Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

עבודה זו נתמכה חלקית על ידי NIH R00HD082686. אנו מודים למלגת מחקר הקיץ של החברה האנדוקרינית ל- H.S.Z. אנו מודים גם לד"ר יואן קאנג על הרבייה והשמירה על מושבת העכברים.

כל הניסויים שבוצעו בבעלי חיים בוצעו בהתאם לפרוטוקולים שאושרו על ידי הוועדות המוסדיות לטיפול ושימוש בבעלי חיים (IACUC) באוניברסיטת אובורן.
הערה: הפרוטוקול הבא משתמש באשכים אחד (כ-100 מ"ג) ב-P28 מ-Gli1-CreERT2; עכברי NuTRAP (Mus musculus). ייתכן שיהיה צורך להתאים נפחים של ריאגנטים על...

<ol>
	<li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support.">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li><li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis.">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li><li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain.">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li><li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+(TRAP).">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li><li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAP-rc,+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos.">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985 (2015).</li><li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(trap)+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale.">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919 (2020).</li><li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(TRAP)+for+RNA+isolation+from+endothelial+cells+in+vivo.">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624 (2019).</li><li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo.">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li><li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hedgehog:+functions+and+mechanisms.">Hedgehog: functions and mechanisms.</a> Genes &amp; Development. 22 (18), 2454-2472 (2008).</li><li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+integrity+number+(RIN)-standardization+of+RNA+quality+control.">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , 1-8 (2004).</li><li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone.">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li><li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages.">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li><li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog.">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li><li>Benton, L., Shan, L. -. X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+adult+Leydig+cells.">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li><li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+aspects+of+11&#946;-hydroxysteroid+dehydrogenase.+Testicular+11&#946;-hydroxysteroid+dehydrogenase:+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids.">Comparative aspects of 11&#946;-hydroxysteroid dehydrogenase. Testicular 11&#946;-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li><li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline.">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li><li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice.">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481 (2009).</li><li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+for+single-cell+isolation.">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+single-cell+RNA+sequencing+methods.">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+considerations+for+single-cell+rna+sequencing+approaches.">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108 (2018).</li><li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia.">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693 (2020).</li><li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells.">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li><li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice.">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li></ol>

התועלת של ניתוח תעתיק רקמה שלמה יכולה להיות מעומעמת, במיוחד כאשר חוקרים רקמות הטרוגניות מורכבות. כיצד להשיג רנ"א ספציפי לסוג התא הופך לצורך דחוף לשחרר את טכניקת ה-RNA-seq רבת העוצמה. הבידוד של רנ"א ספציפיים לסוג התא מסתמך בדרך כלל על איסוף של סוג מסוים של תאים באמצעות מיקרומניפולציה, מיון תאים ...

גישות בעלות תפוקה גבוהה, כולל ריצוף RNA (RNA-seq) ומיקרו-מערך, אפשרו לחקור פרופילי ביטוי גנים ברמה הגנומית כולה. עבור רקמות מורכבות כמו הלב, המוח והאשכים, הנתונים הספציפיים לסוג התא יספקו פרטים נוספים המשווים את השימוש ב-RNA מכל הרקמה 1,2,3. כדי להתגבר על ההשפעה של הטרוגניות תאית, שיטת טיהור זיקת הריבוזום המתורגמת (TRAP) פותחה מאז תחילת שנות ה-20104. TRAP מסוגל לבודד רנ"א הקשורים לריבוזום מסוגי תאים ספציפיים ללא דיסוציאציה של רקמות. שיטה זו שימשה לניתוח טרנסלטום (mRNA המגויס לריבוזום לתרגום) באורגניזמים שונים, כולל התמקדות באוכלוסייה נדירה ביותר של תאי שריר בעוברי Drosophila5, חקר תאי שורש שונים בצמח המודל Arabidopsis thaliana6, וביצוע ניתוח תעתיק של תאי אנדותל ביונקים7.
TRAP דורש שינוי גנטי כדי לתייג את הריבוזום של אורגניזם מודל. אוון רוזן ועמיתיו פיתחו לאחרונה מודל עכבר בשם תיוג גרעיני ותרגום של עכברטיהור זיקה ריבוזום (NuTRAP) 8, הזמין דרך מעבדת ג'קסון מאז 2017. על ידי חצייה עם קו עכבר Cre, חוקרים יכולים להשתמש במודל עכבר NuTRAP זה כדי לבודד רנ"א הקשורים לריבוזום וגרעיני תאים מתאים המבטאים Cre ללא מיון תאים. בתאים המבטאים Cre הנושאים גם את אלל NuTRAP, הריבוזום המתויג EGFP/L10a מאפשר בידוד של תרגום mRNA באמצעות מבחני משיכה של זיקה. באותו תא, הממברנה הגרעינית המתויגת כפפטיד זיהוי ביוטין ליגאז (BLRP), שגם היא חיובית ל-mCherry, מאפשרת בידוד גרעיני באמצעות טיהור מבוסס זיקה או פלואורסצנציה. אותו צוות מחקר גם יצר קו עכברים דומה שבו קרום הגרעין מסומן רק עם mCherry ללא ביוטין8. שני קווי עכבר מהונדסים גנטית אלה נותנים גישה לאפיין פרופילים אפיגנומיים ותעתיקיים זוגיים של סוגים ספציפיים של תאים בעלי עניין.
מסלול האיתות של הקיפוד (Hh) ממלא תפקיד קריטי בהתפתחות רקמות9. GLI1, בן למשפחת GLI, פועל כמפעיל תעתוק ומתווך את איתות ה-HH. תאי Gli1+ יכולים להימצא באיברים רבים המפרישים הורמונים, כולל בלוטת יותרת הכליה והאשכים. כדי לבודד דנ"א ו-RNA ספציפיים לסוג התא מתאי Gli1+ באמצעות מודל העכבר NuTRAP, עכברי Gli1-CreERT2 הוצלבו עם עכברי NuTRAP. עכברי Shh-CreERT2 נחצו גם הם כאשר עכברי NuTRAP נועדו לבודד תאים המבטאים קיפוד קולי (Shh). הפרוטוקול הבא מראה כיצד להשתמש ב- Gli1-CreERT2; עכברי NuTRAP לבידוד רנ"א הקשורים לריבוזום מתאי Gli1+ באשכים של עכברים בוגרים.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Actb</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100 Bioanalyzer Instrument</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millipore</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>cycloheximide</td>
			<td>Millipore</td>
			<td>239764-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyp11a1</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>R0191</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT, Dithiothreitol</td>
			<td>Thermo Fisher Scientific</td>
			<td>P2325</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag-2 magnet</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tubes 15 mL</td>
			<td>VWR</td>
			<td>89039-666</td>
			<td></td>
		</tr>
		<tr>
			<td>GFP antibody</td>
			<td>Abcam</td>
			<td>ab290</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass grinder set</td>
			<td>DWK Life Sciences</td>
			<td>357542</td>
			<td></td>
		</tr>
		<tr>
			<td>heparin</td>
			<td>BEANTOWN CHEMICAL</td>
			<td>139975-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Hsd3b</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Biosciences</td>
			<td>R005</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Biosciences</td>
			<td>R004</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes 2 mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>02-707-354</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Clariom S Assay microarrays</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Microarray service</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Millipore</td>
			<td>492018-50 Ml</td>
			<td></td>
		</tr>
		<tr>
			<td>oligo (dT)20</td>
			<td>Invitrogen</td>
			<td>18418020</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoPure RNA Isolation Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>KIT0204</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G Dynabead</td>
			<td>Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>growcells</td>
			<td>NUPW-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>10777019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox9</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td>
		</tr>
		<tr>
			<td>Superscript IV reverse transcriptase</td>
			<td>Invitrogen</td>
			<td>18090050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309155</td>
			<td></td>
		</tr>
		<tr>
			<td>Sycp3</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Alfa Aesar</td>
			<td>J62848</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

הטרוגניות תאית מציבה אתגרים להבנת תפקודן של רקמות מורכבות ברמת שעתוק. שימוש ב-RNA ספציפי לסוג התא מונע מלכודות פוטנציאליות הנגרמות על ידי ההטרוגניות של רקמות ומשחרר את ניתוח השעתוק העוצמתי. הפרוטוקול המתואר כאן מדגים כיצד להשתמש בשיטת טיהור זיקת ריבוזום (TRAP) לבודד רנ"א הקשורים לריבוזום מכמות קטנה של תאים המבטאים EGFP ברקמה מורכבת ללא מיון תאים. פרוטוקול זה מתאים לבידוד רנ"א ספציפיים לסוג התא באמצעות מודל עכבר NuTRAP הזמין לאחרונה, וניתן להשתמש בו גם לבידוד רנ"א מכל תא המבטא EGFP.

עכבר Gli1-CreERT2 (מספר מלאי של מעבדת ג'קסון: 007913) נחצה לראשונה עם עכבר הכתב NuTRAP (מספר מלאי של מעבדת ג'קסון: 029899) כדי ליצור עכברים בעלי מוטציה כפולה. עכברים שנשאו את שני אללי הגנים המהונדסים גנטית (כלומר, Gli1-CreERT2 ו-NuTRAP) הוזרקו טמוקסיפן פעם ביום, אחת ליומיים, במשך שלוש זריקות....

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

פרוטוקול זה נועד לבודד mRNA ריבוזומלי ספציפי לסוג התא באמצעות מודל העכבר NuTRAP.

לבודד רנ"א ספציפיים לסוג תא מדגימות רקמות הטרוגניות קפואות ללא מיון תאים

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

פרוטוקול זה נועד להשיג רנ"א ספציפיים מסוגי תאים באיכות גבוהה ממספר קטן של תאים ברקמה מורכבת ללא מיון תאים. הוא משתמש במודל עכברים זמין לאחרונה המאפשר לחוקרים לבודד רנ"א הקשור לריבוזום באמצעות משיכת GLP כלפי מטה. השיטה מתאימה גם לבידוד רנ"א הקשור לריבוזום מכל תא EGFP המבטא.כדי להתחיל, הוסף שני מיליליטר של הומוגניזציה קרה כקרח חיץ עבודה לסט מטחנת רקמת זכוכית. הכנס במהירות את הדגימה הקפואה לתוך המטחנה והומוגני את הרקמה עם 30 משיכות על קרח באמצעות מזיק רופף. להעביר את homogenate לצינור תחתון עגול שני מיליליטר צנטריפוגה ב 12, 000 גרם במשך 10 דקות בארבע מעלות צלזיוס.לאחר מכן העבירו את הסופרנאטנט לצינור חדש של שני מיליליטר מבלי להפריע לכדור, תוך שמירת 100 מיקרוליטרים כקלט. לדגום את הסופרנטנט עם הנוגדן נגד GFP בארבע מעלות צלזיוס על קצה מעל הקצה מסובב לילה. מעבירים את תערובת ההומוגנט והנוגדנים לצינור תחתון עגול חדש של שני מיליליטר המכיל חרוזי חלבון שטופים ודגירה של ארבע מעלות צלזיוס על סיבוב ב-24 סל"ד למשך שעתיים.הפרידו את החרוזים המגנטיים מהסופר-נטנט באמצעות מתלה מגנטי. שמור את הסופרנטנט כשבר השלילי המכיל את הרנ"א בתאים שליליים של EGFP ואת הרנ"א בתאים חיוביים של EGFP שאינם קשורים לריבוזומים. מוסיפים מיליליטר אחד של מלח גבוה לשטוף את החרוזים ומערבבים לזמן קצר את הצינור כדי לשטוף את החרוזים.לאחר מכן הניחו את הצינור במדף מגנטי. הסר את חיץ הכביסה וחזור על שלבי הכביסה פעמיים נוספות כדי לקבל את קומפלקס RNA ריבוזום חרוזים מתאים חיוביים EGFP. דגרו את החרוזים עם 50 מיקרוליטרים של חיץ מיצוי מתוך ערכת בידוד הרנ"א ב-ThermoMixer למשך 30 דקות כדי לשחרר רנ"א מהחרוזים.מפרידים את החרוזים עם מתלה מגנטי ומעבירים את הסופרנטנט לצינור של 1.5 מיליליטר. צנטריפוגה את הצינור ב 3000 גרם במשך שתי דקות. לאחר מכן פיפטה את supernatant לצינור חדש 1.5 מיליליטר.כדי להתנות מראש את עמודת טיהור ה-RNA, פיפטה 250 מיקרוליטרים של חיץ התניה על עמודת הטיהור ודגירה במשך חמש דקות בטמפרטורת החדר. ואז צנטריפוגה את הטור ב 16, 000 גרם במשך דקה אחת. מכניסים נפח שווה של 70% אתנול לתוך תמצית התא ומערבבים היטב על ידי פיפטה.פיפטה עד 200 מיקרוליטר של התערובת לתוך עמודת טיהור RNA מותנה מראש. כדי להפחית את אובדן הדגימות לא למלא את העמודה יותר מ 80% של קיבולת שלה. חזור על שלב זה מספר פעמים עד שכל הרנ"א נאספים באותה עמודה של כל שבר.צנטריפוגה של העמודה במשך שתי דקות כדי לקשור RNA לממברנה בעמודה. לאחר מכן המשך צנטריפוגה במשך 30 שניות. השליכו את הזרימה דרך פיפטה 100 מיקרוליטר של חיץ כביסה אחד לתוך העמודה.צנטריפוגה במשך דקה אחת, ולאחר מכן להשליך את הזרימה דרך. פיפטה 75 מיקרוליטר של תמיסת DNA מתערבבים ישירות לתוך קרום עמודת הטיהור. לדגור בטמפרטורת החדר במשך 15 דקות.לאחר מכן, פיפטה 40 מיקרוליטר של לשטוף חיץ אחד לתוך העמודה צנטריפוגה במשך 30 שניות נוספות. השלך את הזרימה דרך. פיפטה 100 מיקרוליטר של חיץ לשטוף שניים לתוך העמוד צנטריפוגה ב 8, 000 גרם במשך דקה אחת.השלך את הזרימה דרך. קנה PET 100 microliters של חיץ לשטוף שני לתוך העמודה צנטריפוגה ב 16, 000 גרם במשך שתי דקות. השלך את הזרימה דרך, וצנטריפוגה מחדש את אותו עמוד ב 16, 000 גרם למשך דקה אחת כדי להסיר את כל עקבות של חיץ לשטוף.העבר את העמודה לצינור מיקרוצנטריפוגה חדש של 1.5 מיליליטר. פיפטה 12 מיקרוליטר של מים ללא RNase ישירות על הממברנה של עמודת הטיהור המבטיחה כי קצה הפיפטה אינו נוגע בממברנה. דגירה בטמפרטורת החדר במשך דקה אחת וצנטריפוגה ב 1000 גרם במשך דקה אחת.ואז ב 16, 000 G במשך דקה אחת כדי לרומם את ה- RNA. השתמש בביואנליזה כדי להעריך את האיכות והכמות של הרנ"א המופק. אחסנו את הרנ"א במקפיא של 80 מעלות או שלחו לניתוח נוסף.עכברים הנושאים את שני אללי הגנים המהונדסים גנטית, Gli1-CreERT2 ו-NuTRAP מוזרק לנו טמוקסיפן פעם ביום, אחת ליומיים לשלוש זריקות. ניתוח אימונופלואורסצנטי של רקמות שנאספו מראה כי ה- EGFP התבטא בתאים אינטרסטיציאליים באשכים. EGFP נמצא גם בתאים קפסולריים של יותרת הכליה בעכברי Gli1-CreERT2, NuTRAP.ב- Sonic Hedgehog-CreERT2, עכברי NuTRAP אוכלוסיית התאים החיוביים של EGFP שוכנת בקליפת המוח החיצונית של בלוטת יותרת הכליה מתחת לקפסולה, המאשרת את הביטוי של תאי EGFP המבטאים מראש. לאחר מיצוי הרנ"א הספציפי לסוג התא, נשלח הרנ"א שחולץ לניתוח מיקרו-מערך. התוצאות הראו כי כ -3000 גנים היו מועשרים בחלק החיובי, לעומת גנים בחלק השלילי, ואילו כ -4, 000 גנים היו מועשרים בחלק השלילי.מבין הגנים המתבטאים באופן דיפרנציאלי, הגנים הקשורים לתאי Leydig Hsd11b1 ו-Hsd3b6 הועשרו בחלק החיובי. בחלק השלילי הועשרו הגנים הקשורים לתאי סרטולי קיפוד המדבר ו-Gstm6. רק גנים מעטים שהתבטאו באופן דיפרנציאלי זוהו בהשוואת החלק השלילי עם הקלט.RT-PCR כמותי בזמן אמת שימש כדי לאשר את הביטוי של גנים מרכזיים בשברים חיוביים ושליליים. בדומה למה שנמצא בבדיקת המיקרו-אריי, הועשרו במקטע החיובי אנזימים סטרואידים 3-beta הידרוקסי דהידרוגנאז ואנזים ביקוע שרשרת הצד של הכולסטרול. בינתיים, סמן התא סרטולי SRY תיבת שעתוק פקטור תשע ואת סמן תא הנבט סינפטונמלי קומפלקס חלבון שלוש הועשרו בחלק השלילי.כאשר מנסים פרוטוקול זה, חשוב להכין חיץ עבודה של הומוגניזציה טרייה הוסף DTT, ציקלוהקסמיד ריבונוקלאז רקומביננטי, וקוקטייל מעכב פרוטאינאז לתמיסת מלאי ההומוגניזציה רק לפני השימוש. חשוב גם להכין מלח דל מלח טרי ואת מאגרי שטיפת המלח הגבוהים לפני השימוש.

Research

JoVE Journal

Biology

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

אקטין Co-Assay שקיעה, כי ניתוח של חלבון מחייב את ה-F-אקטין

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

חקירת רקמות ו איברים ספציפיים התגובות Phytochrome באמצעות FACS בסיוע נייד מסוג פרופיל ביטוי ספציפי ארבידופסיס thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

Heterokaryon טכניקה לניתוח של לוקליזציה Cell סוג ספציפי

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

Genotyping של דוגמאות צמחים ובעלי חיים, ללא טיהור DNA לפני

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

אופטימיזציה שיטות דוגמנות מכתימה והפצת נשק לניטור חלוקת תא באמצעות צבעי מעקב סלולרי

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Small Noncoding RNAs from Human Serum

בידוד של קטן noncoding RNAs מסרום האדם

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

שיטה למדידת הפעילות של אנזימי Deubiquitinating בשורות תאים ודגימות רקמה

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model

מגנטי תא לפעיל על-מיון אסטרטגיות כדי לבודד ולטהר Synovial נגזר הנוזלים בתאי גזע Mesenchymal ממודל ארנב

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: יצירת פרופילים ייחודיים לסוג התא Epigenome

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...