Name: isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting
Uploaded: 2021-12-08T14:00:00
Description: Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

यह काम आंशिक रूप से एनआईएच आर 00एचडी082686 द्वारा समर्थित था। हम एचएसजेड के लिए एंडोक्राइन सोसाइटी समर रिसर्च फैलोशिप का धन्यवाद करते हैं। हम माउस कॉलोनी के प्रजनन और रखरखाव के लिए डॉ युआन कांग को भी धन्यवाद देते हैं।

सभी प्रदर्शन किए गए पशु प्रयोगों ने ऑबर्न विश्वविद्यालय में संस्थागत पशु देखभाल और उपयोग समितियों (आईएसीयूसी) द्वारा अनुमोदित प्रोटोकॉल का पालन किया।
नोट: निम्नलिखित प्रोटोकॉल Gli1-CreERT2 ...

<ol>
	<li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support.">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li><li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis.">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li><li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain.">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li><li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+(TRAP).">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li><li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAP-rc,+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos.">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985 (2015).</li><li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(trap)+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale.">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919 (2020).</li><li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(TRAP)+for+RNA+isolation+from+endothelial+cells+in+vivo.">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624 (2019).</li><li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo.">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li><li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hedgehog:+functions+and+mechanisms.">Hedgehog: functions and mechanisms.</a> Genes &amp; Development. 22 (18), 2454-2472 (2008).</li><li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+integrity+number+(RIN)-standardization+of+RNA+quality+control.">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , 1-8 (2004).</li><li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone.">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li><li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages.">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li><li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog.">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li><li>Benton, L., Shan, L. -. X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+adult+Leydig+cells.">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li><li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+aspects+of+11&#946;-hydroxysteroid+dehydrogenase.+Testicular+11&#946;-hydroxysteroid+dehydrogenase:+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids.">Comparative aspects of 11&#946;-hydroxysteroid dehydrogenase. Testicular 11&#946;-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li><li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline.">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li><li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice.">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481 (2009).</li><li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+for+single-cell+isolation.">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+single-cell+RNA+sequencing+methods.">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+considerations+for+single-cell+rna+sequencing+approaches.">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108 (2018).</li><li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia.">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693 (2020).</li><li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells.">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li><li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice.">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li></ol>

पूरे ऊतक ट्रांसक्रिपटम विश्लेषण की उपयोगिता को कम किया जा सकता है, खासकर जब जटिल विषम ऊतकों का अध्ययन किया जाता है। सेल-प्रकार-विशिष्ट आरएनए कैसे प्राप्त करें, शक्तिशाली आरएनए-सेक तकनीक को उजागर करने ?...

आरएनए अनुक्रमण (आरएनए-सेक) और माइक्रोएरे सहित उच्च-थ्रूपुट दृष्टिकोण ने जीनोम-वाइड स्तर पर जीन अभिव्यक्ति प्रोफाइल से पूछताछ करना संभव बना दिया है। हृदय, मस्तिष्क और वृषण जैसे जटिल ऊतकों के लिए, सेल-प्रकार-विशिष्ट डेटा पूरे ऊतक 1,2,3 से आरएनए के उपयोग की तुलना में अधिक विवरण प्रदान करेगा। सेलुलर विषमता के प्रभाव को दूर करने के लिए, ट्रांसलेटिंग राइबोसोम एफिनिटी प्यूरीफिकेशन (ट्रैप) विधि 2010के दशक की शुरुआत से विकसित की गई है। ट्रैप ऊतक पृथक्करण के बिना विशिष्ट सेल प्रकारों से राइबोसोम-बाध्य आरएनए को अलग करने में सक्षम है। इस विधि का उपयोग विभिन्न जीवों में ट्रांसलेटोम (एमआरएनए जिन्हें अनुवाद के लिए राइबोसोम में भर्ती किया जा रहा है) विश्लेषण के लिए किया गया है, जिसमें ड्रोसोफिला भ्रूण5 में मांसपेशियों की कोशिकाओं की एक अत्यंत दुर्लभ आबादी को लक्षित करना, मॉडल प्लांट एराबिडोप्सिस थैलियाना6 में विभिन्न जड़ कोशिकाओं का अध्ययन करना और स्तनधारियों में एंडोथेलियल कोशिकाओं का ट्रांसस्क्रिप्टम विश्लेषण करनाशामिल है।
ट्रैप को एक मॉडल जीव के राइबोसोम को टैग करने के लिए आनुवंशिक संशोधन की आवश्यकता होती है। इवान रोसेन और उनके सहयोगियों ने हाल ही में न्यूक्लियर टैगिंग एंड ट्रांसलेटिंग राइबोसोम एफिनिटी प्यूरीफिकेशन (न्यूटीआरएपी) माउस8 नामक एक माउस मॉडल विकसित किया है, जो 2017 से जैक्सन प्रयोगशाला के माध्यम से उपलब्ध है। क्रे माउस लाइन के साथ पार करके, शोधकर्ता सेल सॉर्टिंग के बिना क्रे-व्यक्त कोशिकाओं से राइबोसोम-बाध्य आरएनए और सेल नाभिक को अलग करने के लिए इस न्यूट्रैप माउस मॉडल का उपयोग कर सकते हैं। क्रे-व्यक्त करने वाली कोशिकाओं में जो न्यूट्रैप एलील भी ले जाते हैं, ईजीएफपी / एल 10 ए टैग किए गए राइबोसोम आत्मीयता पुलडाउन परख का उपयोग करके एमआरएनए का अनुवाद करने के अलगाव की अनुमति देता है। उसी सेल में, बायोटिन लिगेज रिकग्निशन पेप्टाइड (बीएलआरपी) -टैग परमाणु झिल्ली, जो एमचेरी पॉजिटिव भी है, आत्मीयता- या प्रतिदीप्ति-आधारित शुद्धिकरण का उपयोग करके परमाणु अलगाव की अनुमति देता है। उसी शोध टीम ने एक समान माउस लाइन भी उत्पन्न की जिसमें परमाणु झिल्ली को बायोटिन 8 के बिना केवल एमचेरी के साथ लेबल कियागया है। ये दो आनुवंशिक रूप से संशोधित माउस लाइनें रुचि में विशिष्ट प्रकार की कोशिकाओं के युग्मित एपिजेनोमिक और ट्रांसक्रिप्टोमिक प्रोफाइल को चिह्नित करने के लिए पहुंच प्रदान करती हैं।
हेजहोग (एचएच) सिग्नलिंग मार्ग ऊतक विकास में महत्वपूर्ण भूमिकानिभाता है। GLI1, GLI परिवार का एक सदस्य, एक ट्रांसक्रिप्शनल एक्टिवेटर के रूप में कार्य करता है और एचएच सिग्नलिंग की मध्यस्थता करता है। ग्लि1+ कोशिकाएं कई हार्मोन-स्रावित अंगों में पाई जा सकती हैं, जिनमें अधिवृक्क ग्रंथि और वृषण शामिल हैं। न्यूट्रैप माउस मॉडल का उपयोग करके ग्लि1+ कोशिकाओं से सेल-प्रकार-विशिष्ट डीएनए और आरएनए को अलग करने के लिए, ग्लि1-सीआरईआरटी 2 चूहों को न्यूट्रैप चूहों के साथ पार किया गया था। एसएचएच-सीआरईआरटी 2 चूहों को भी न्यूट्रैप चूहों के साथ पार किया गया था, जिसका उद्देश्य सोनिक हेजहोग (एसएचएच) व्यक्त करने वाली कोशिकाओं को अलग करना था। निम्न प्रोटोकॉल दिखाता है कि Gli1-CreERT2 का उपयोग कैसे करें; वयस्क माउस वृषण में ग्लि1+ कोशिकाओं से राइबोसोम-बाध्य आरएनए को अलग करने के लिए न्यूट्रैप चूहे।

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Actb</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100 Bioanalyzer Instrument</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millipore</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>cycloheximide</td>
			<td>Millipore</td>
			<td>239764-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyp11a1</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>R0191</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT, Dithiothreitol</td>
			<td>Thermo Fisher Scientific</td>
			<td>P2325</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag-2 magnet</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tubes 15 mL</td>
			<td>VWR</td>
			<td>89039-666</td>
			<td></td>
		</tr>
		<tr>
			<td>GFP antibody</td>
			<td>Abcam</td>
			<td>ab290</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass grinder set</td>
			<td>DWK Life Sciences</td>
			<td>357542</td>
			<td></td>
		</tr>
		<tr>
			<td>heparin</td>
			<td>BEANTOWN CHEMICAL</td>
			<td>139975-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Hsd3b</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Biosciences</td>
			<td>R005</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Biosciences</td>
			<td>R004</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes 2 mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>02-707-354</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Clariom S Assay microarrays</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Microarray service</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Millipore</td>
			<td>492018-50 Ml</td>
			<td></td>
		</tr>
		<tr>
			<td>oligo (dT)20</td>
			<td>Invitrogen</td>
			<td>18418020</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoPure RNA Isolation Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>KIT0204</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G Dynabead</td>
			<td>Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>growcells</td>
			<td>NUPW-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>10777019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox9</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td>
		</tr>
		<tr>
			<td>Superscript IV reverse transcriptase</td>
			<td>Invitrogen</td>
			<td>18090050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309155</td>
			<td></td>
		</tr>
		<tr>
			<td>Sycp3</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Alfa Aesar</td>
			<td>J62848</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

सेलुलर विषमता एक प्रतिलेख स्तर पर जटिल ऊतकों के कार्य को समझने के लिए चुनौतियां पैदा करती है। सेल-प्रकार-विशिष्ट आरएनए का उपयोग ऊतकों की विविधता के कारण होने वाले संभावित नुकसान से बचाता है और शक्तिशाली ट्रांसस्क्रिप्टम विश्लेषण को उजागर करता है। यहां वर्णित प्रोटोकॉल दर्शाता है कि सेल सॉर्टिंग के बिना एक जटिल ऊतक में ईजीएफपी-व्यक्त कोशिकाओं की एक छोटी मात्रा से राइबोसोम-बाध्य आरएनए को अलग करने के लिए राइबोसोम-बाध्य आरएनए को अलग करने के लिए ट्रांसलेटिंग राइबोसोम एफिनिटी प्यूरीफिकेशन (ट्रैप) विधि का उपयोग कैसे किया जाए। यह प्रोटोकॉल हाल ही में उपलब्ध न्यूट्रैप माउस मॉडल का उपयोग करके सेल-प्रकार-विशिष्ट आरएनए को अलग करने के लिए उपयुक्त है और इसका उपयोग किसी भी ईजीएफपी-व्यक्त कोशिकाओं से आरएनए को अलग करने के लिए भी किया जा सकता है।

ग्लि1-सीआरईआरटी 2 माउस (जैक्सन लैब स्टॉक नंबर: 007913) को पहले डबल-म्यूटेंट चूहों को उत्पन्न करने के लिए न्यूट्रैप रिपोर्टर माउस (जैक्सन लैब स्टॉक नंबर: 029899) के साथ पार किया गया था। आनुवंशिक रूप से इं...

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

इस प्रोटोकॉल का उद्देश्य न्यूट्रैप माउस मॉडल का उपयोग करके राइबोसोमल एमआरएनए का अनुवाद करने वाले सेल-प्रकार-विशिष्ट को अलग करना है।

सेल सॉर्टिंग के बिना स्नैप-जमे हुए विषम ऊतक नमूनों से सेल-टाइप-विशिष्ट आरएनए को अलग करें

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

इस प्रोटोकॉल का उद्देश्य सेल सॉर्टिंग के बिना एक जटिल ऊतक में कोशिकाओं की एक छोटी संख्या से उच्च गुणवत्ता वाले सेल प्रकार विशिष्ट आरएनए प्राप्त करना है। यह हाल ही में उपलब्ध माउस मॉडल को नियोजित करता है जो शोधकर्ताओं को जीएलपी पुल डाउन का उपयोग करके राइबोसोम बाध्य आरएनए को अलग करने की अनुमति देता है। विधि राइबोसोम बाध्य आरएनए को किसी भी ईजीएफपी व्यक्त करने वाली कोशिकाओं से अलग करने के लिए भी उपयुक्त है।शुरू करने के लिए, ग्लास टिशू ग्राइंडर सेट में दो मिलीलीटर बर्फ ठंडा होमोजेनाइजेशन वर्किंग बफर जोड़ें। जमे हुए नमूने को जल्दी से ग्राइंडर में रखें और ढीले मूसल का उपयोग करके बर्फ पर 30 स्ट्रोक के साथ ऊतक को समरूप करें। होमोजेनेट को दो मिलीलीटर गोल निचले ट्यूब में स्थानांतरित करें और सेंट्रीफ्यूज को 12,000 ग्राम पर चार डिग्री सेल्सियस पर 10 मिनट के लिए स्थानांतरित करें।फिर गोली को परेशान किए बिना सुपरनैटेंट को एक नई दो मिलीलीटर ट्यूब में स्थानांतरित करें, इनपुट के रूप में 100 माइक्रोलीटर आरक्षित करें। सुपरनैटेंट को एंटी-जीएफपी एंटीबॉडी के साथ चार डिग्री सेल्सियस पर रात भर घुमाने वाले अंत में इनक्यूबेट करें। होमोजेनेट और एंटीबॉडी मिश्रण को एक नए दो मिलीलीटर गोल निचले ट्यूब में स्थानांतरित करें जिसमें धोए गए प्रोटीन जी मोती होते हैं और दो घंटे के लिए 24 आरपीएम पर चार डिग्री सेल्सियस को घुमाते हुए इनक्यूबेट किया जाता है।चुंबकीय रैक का उपयोग करके चुंबकीय मोतियों को सतह पर तैरने वाले से अलग करें। सतह पर तैरने वाले को नकारात्मक अंश के रूप में सहेजें जिसमें ईजीएफपी नकारात्मक कोशिकाओं में आरएनए और ईजीएफपी सकारात्मक कोशिकाओं में आरएनए होते हैं जो राइबोसोम से बंधे नहीं होते हैं। मोतियों में एक मिलीलीटर उच्च नमक धोने का बफर जोड़ें और मोतियों को धोने के लिए ट्यूब को संक्षेप में भंवर करें।फिर ट्यूब को चुंबकीय रैक में रखें। ईजीएफपी पॉजिटिव कोशिकाओं से मोतियों राइबोसोम आरएनए कॉम्प्लेक्स प्राप्त करने के लिए वॉश बफर को हटा दें और धोने के चरणों को दो बार दोहराएं। मोतियों से आरएनए को छोड़ने के लिए थर्मोमिक्सर में आरएनए आइसोलेशन किट से निष्कर्षण बफर के 50 माइक्रोलीटर के साथ मोतियों को 30 मिनट के लिए इनक्यूबेट करें।मोतियों को चुंबकीय रैक के साथ अलग करें और सतह पर तैरने वाले को 1.5 मिलीलीटर ट्यूब में स्थानांतरित करें। ट्यूब को दो मिनट के लिए 3000 ग्राम पर सेंट्रीफ्यूज करें। फिर सतह पर तैरने वाले को एक नई 1.5 मिलीलीटर ट्यूब में बदल दें।आरएनए शुद्धि करण स्तंभ को पूर्व-शर्त करने के लिए, शुद्धि करण स्तंभ पर कंडीशनिंग बफर के 250 माइक्रोलीटर पिपेट करें और कमरे के तापमान पर पांच मिनट के लिए इनक्यूबेट करें। फिर एक मिनट के लिए 16,000 ग्राम पर कॉलम को सेंट्रीफ्यूज करें। पिपेट सेल अर्क में 70% इथेनॉल की समान मात्रा प्राप्त करें और पाइपिंग द्वारा अच्छी तरह से मिलाएं।पूर्व शर्त आरएनए शुद्धि स्तंभ में मिश्रण के 200 माइक्रोलीटर तक पिपेट करें। नमूने के नुकसान को कम करने के लिए कॉलम को इसकी क्षमता के 80% से अधिक न भरें। इस चरण को कई बार दोहराएं जब तक कि सभी आरएनए प्रत्येक अंश के एक ही कॉलम में एकत्र न हो जाएं।कॉलम में झिल्ली में आरएनए को बांधने के लिए कॉलम को दो मिनट के लिए सेंट्रीफ्यूज करें। फिर 30 सेकंड के लिए सेंट्रीफ्यूजेशन जारी रखें। प्रवाह को छोड़ दें और स्तंभ में 100 माइक्रोलीटर वॉश बफर को हटा दें।एक मिनट के लिए सेंट्रीफ्यूज, फिर प्रवाह को छोड़ दें। डीएनए समाधान के पिपेट 75 माइक्रोलीटर सीधे शुद्धि स्तंभ झिल्ली में मिश्रित होते हैं। 15 मिनट के लिए कमरे के तापमान पर इनक्यूबेट करें।फिर, 40 माइक्रोलीटर वॉश बफर को कॉलम में और सेंट्रीफ्यूज को 30 सेकंड के लिए इंजेक्ट करें। प्रवाह को छोड़ दें। पिपेट 100 माइक्रोलीटर वॉश बफर को कॉलम में डालते हैं और एक मिनट के लिए 8,000 ग्राम पर सेंट्रीफ्यूज करते हैं।प्रवाह को छोड़ दें। कॉलम में वॉश बफर दो के पीईटी 100 माइक्रोलीटर खरीदें और दो मिनट के लिए 16,000 ग्राम पर सेंट्रीफ्यूज करें। प्रवाह को छोड़ दें, और वॉश बफर के सभी निशान ों को हटाने के लिए एक मिनट के लिए 16,000 ग्राम पर उसी कॉलम को फिर से सेंट्रीफ्यूज करें।कॉलम को एक नए 1.5 मिलीलीटर माइक्रोसेंट्रीफ्यूज ट्यूब में स्थानांतरित करें। पिपेट 12 माइक्रोलीटर आरनेस मुक्त पानी सीधे शुद्धि स्तंभ की झिल्ली पर यह सुनिश्चित करता है कि पिपेट टिप झिल्ली को नहीं छूता है। एक मिनट के लिए कमरे के तापमान पर इनक्यूबेट करें और एक मिनट के लिए 1000 ग्राम पर सेंट्रीफ्यूज करें।फिर 16,000 जी पर एक मिनट के लिए आरएनए को हटा दें। निकाले गए आरएनए की गुणवत्ता और मात्रा का आकलन करने के लिए बायोएनालाइज़र का उपयोग करें। आरएनए को 80 डिग्री फ्रीजर में स्टोर करें या आगे के विश्लेषण के लिए भेजें।आनुवंशिक रूप से इंजीनियर जीन एलील, ग्लि1-सीआरईआरटी 2 और न्यूट्रैप दोनों को ले जाने वाले चूहों को दिन में एक बार, हर दूसरे दिन तीन इंजेक्शन के लिए टैमोक्सीफेन के साथ इंजेक्ट किया जाता है। एकत्रित ऊतकों के इम्यूनोफ्लोरेसेंस विश्लेषण से पता चलता है कि ईजीएफपी वृषण में अंतरालीय कोशिकाओं में व्यक्त किया गया था। ईजीएफपी ग्लि1-सीआरईआरटी 2, न्यूट्रैप चूहों में अधिवृक्क कैप्सुलर कोशिकाओं में भी पाया गया था।सोनिक हेजहोग-सीआरईआरटी 2 में, न्यूट्रैप चूहों ईजीएफपी पॉजिटिव सेल आबादी कैप्सूल के नीचे अधिवृक्क ग्रंथि के बाहरी कॉर्टेक्स में रहती है, जो ईजीएफपी पूर्व-व्यक्त कोशिकाओं की अभिव्यक्ति की पुष्टि करती है। सेल प्रकार विशिष्ट आरएनए के निष्कर्षण के बाद, निकाले गए आरएनए को माइक्रोएरे विश्लेषण के लिए भेजा गया था। परिणामों से पता चला कि नकारात्मक अंश में जीन की तुलना में सकारात्मक अंश में लगभग 3000 जीन समृद्ध थे, जबकि नकारात्मक अंश में लगभग 4,000 जीन समृद्ध थे।विभेदक व्यक्त जीनों में, लेडिग सेल से जुड़े जीन Hsd11b1 और Hsd3b6 सकारात्मक अंश में समृद्ध थे। नकारात्मक अंश में, सर्टोली सेल से जुड़े जीन डेजर्ट हेजहोग और जीएसटीएम 6 समृद्ध थे। इनपुट के साथ नकारात्मक अंश की तुलना करने में केवल कुछ अलग-अलग व्यक्त जीनों की पहचान की गई थी।रीयलटाइम मात्रात्मक आरटी-पीसीआर का उपयोग सकारात्मक और नकारात्मक अंशों में प्रमुख जीनों की अभिव्यक्ति की पुष्टि करने के लिए किया गया था। माइक्रोएरे परख में जो पाया गया था, उसके समान, स्टेरॉयडोजेनिक एंजाइम 3-बीटा हाइड्रॉक्सी स्टेरॉयड डिहाइड्रोजनेज और कोलेस्ट्रॉल साइड चेन क्लीवेज एंजाइम सकारात्मक अंश में समृद्ध थे। इस बीच, सर्टोली सेल मार्कर एसआरवाई बॉक्स ट्रांसक्रिप्शन फैक्टर नौ और जर्म सेल मार्कर सिनैप्टोनेमल कॉम्प्लेक्स प्रोटीन तीन को नकारात्मक अंश में समृद्ध किया गया था।इस प्रोटोकॉल का प्रयास करते समय, उपयोग से पहले केवल होमोजेनाइजेशन स्टॉक समाधान में ताजा होमोजेनाइजेशन वर्किंग बफर एड डीटीटी, साइक्लोहेक्सिमाइड रिकॉम्बिनेंट राइबोन्यूक्लिज़ और प्रोटीनेज इनहिबिटर कॉकटेल तैयार करना महत्वपूर्ण है। उपयोग करने से पहले ताजा कम नमक और उच्च नमक धोने के बफर तैयार करना भी महत्वपूर्ण है।

Research

JoVE Journal

Biology

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

एफ actin के लिए बाइंडिंग प्रोटीन का विश्लेषण के लिए, actin सह अवसादन परख

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

प्रतिदीप्ति सक्रिय संयंत्र Protoplasts के सेल छंटनी

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

ऊतक और अंग विशेष Phytochrome प्रतिक्रियाएँ में FACS की सहायता सेल प्रकार विशिष्ट अभिव्यक्ति रूपरेखा का उपयोग की जांच Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

टाइप विशेष सेल स्थानीयकरण के विश्लेषण के लिए Heterokaryon तकनीक

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

पिछले डीएनए शोधन के बिना संयंत्र और पशु नमूने की जीनोटाइपिंग

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

सेल डिवीजन ट्रैकिंग सेल रंजक का उपयोग करने की निगरानी के लिए अनुकूलित धुंधला और प्रसार मॉडलिंग तरीकों

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Small Noncoding RNAs from Human Serum

मानव सीरम से लघु noncoding RNAs के अलगाव

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

सेल लाइनों और ऊतकों के नमूनों में Deubiquitinating एंजाइमों की गतिविधि को मापने के लिए विधि

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model

चुंबकीय-सक्रिय सेल छंटाई रणनीतियों को अलग करने और शुद्ध श्लेष द्रव-व्युत्पंन Mesenchymal एक खरगोश मॉडल से स्टेम कोशिकाओं

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: कक्ष-प्रकार-विशिष्ट Epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...