Name: isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting
Uploaded: 2021-12-08T14:00:00
Description: Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

이 작업은 NIH R00HD082686에 의해 부분적으로 지원되었습니다. 우리는 HSZ에 내분비 학회 여름 연구 펠로우십에 감사드립니다. 우리는 또한 마우스 식민지를 번식시키고 유지 한 Yuan Kang 박사에게 감사드립니다.

수행 된 모든 동물 실험은 Auburn University의 기관 동물 관리 및 사용위원회 (IACUC)에서 승인 한 프로토콜을 따랐습니다.
참고: 다음 프로토콜은 Gli1-CreERT2의 P28에서 하나의 고환(약 100mg)을 사용합니다. NuTRAP 마우스 (무스 근육). 시약의 부피는 샘플 유형과 조직 수에 따라 조정해야 할 수도 있습니다.
1. 조직 수집
<ol><li>CO2 챔...

<ol>
	<li>Yang, K. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+RNA+sequencing+reveals+dynamic+regulation+of+myocardial+noncoding+RNAs+in+failing+human+heart+and+remodeling+with+mechanical+circulatory+support.">Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.</a> Circulation. 129 (9), 1009-1021 (2014).</li><li>Soumillon, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+source+and+mechanisms+of+high+transcriptome+complexity+in+the+mammalian+testis.">Cellular source and mechanisms of high transcriptome complexity in the mammalian testis.</a> Cell Reports. 3 (6), 2179-2190 (2013).</li><li>Lake, B. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+subtypes+and+diversity+revealed+by+single-nucleus+RNA+sequencing+of+the+human+brain.">Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.</a> Science. 352 (6293), 1586-1590 (2016).</li><li>Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+mRNA+purification+by+translating+ribosome+affinity+purification+(TRAP).">Cell type-specific mRNA purification by translating ribosome affinity purification (TRAP).</a> Nature Protocols. 9 (6), 1282-1291 (2014).</li><li>Bertin, B., Renaud, Y., Aradhya, R., Jagla, K., Junion, G. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAP-rc,+translating+ribosome+affinity+purification+from+rare+cell+populations+of+Drosophila+embryos.">TRAP-rc, translating ribosome affinity purification from rare cell populations of Drosophila embryos.</a> Journal of Visualized Experiments: JoVE. (103), e52985 (2015).</li><li>Thellmann, M., Andersen, T. G., Vermeer, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(trap)+to+investigate+Arabidopsis+thaliana+root+development+at+a+cell+type-specific+scale.">Translating ribosome affinity purification (trap) to investigate Arabidopsis thaliana root development at a cell type-specific scale.</a> Journal of Visualized Experiments: JoVE. (159), e60919 (2020).</li><li>Moran, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+ribosome+affinity+purification+(TRAP)+for+RNA+isolation+from+endothelial+cells+in+vivo.">Translating ribosome affinity purification (TRAP) for RNA isolation from endothelial cells in vivo.</a> Journal of Visualized Experiments: JoVE. (147), e59624 (2019).</li><li>Roh, H. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+transcriptional+and+epigenomic+profiling+from+specific+cell+types+within+heterogeneous+tissues+in+vivo.">Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo.</a> Cell Reports. 18 (4), 1048-1061 (2017).</li><li>Varjosalo, M., Taipale, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hedgehog:+functions+and+mechanisms.">Hedgehog: functions and mechanisms.</a> Genes &amp; Development. 22 (18), 2454-2472 (2008).</li><li>Mueller, O., Lightfoot, S., Schroeder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+integrity+number+(RIN)-standardization+of+RNA+quality+control.">RNA integrity number (RIN)-standardization of RNA quality control.</a> Agilent Technologies. , 1-8 (2004).</li><li>Lyu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-seq+reveals+sub-zones+in+mouse+adrenal+zona+fasciculata+and+the+sexually+dimorphic+responses+to+thyroid+hormone.">RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the sexually dimorphic responses to thyroid hormone.</a> Endocrinology. 161 (9), (2020).</li><li>King, P., Paul, A., Laufer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shh+signaling+regulates+adrenocortical+development+and+identifies+progenitors+of+steroidogenic+lineages.">Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (50), 21185-21190 (2009).</li><li>Huang, C. C., Miyagawa, S., Matsumaru, D., Parker, K. L., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progenitor+cell+expansion+and+organ+size+of+mouse+adrenal+is+regulated+by+sonic+hedgehog.">Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog.</a> Endocrinology. 151 (3), 1119-1128 (2010).</li><li>Benton, L., Shan, L. -. X., Hardy, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+adult+Leydig+cells.">Differentiation of adult Leydig cells.</a> The Journal of Steroid Biochemistry and Molecular Biology. 53 (1-6), 61-68 (1995).</li><li>Monder, C., Hardy, M., Blanchard, R., Blanchard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+aspects+of+11&#946;-hydroxysteroid+dehydrogenase.+Testicular+11&#946;-hydroxysteroid+dehydrogenase:+development+of+a+model+for+the+mediation+of+Leydig+cell+function+by+corticosteroids.">Comparative aspects of 11&#946;-hydroxysteroid dehydrogenase. Testicular 11&#946;-hydroxysteroid dehydrogenase: development of a model for the mediation of Leydig cell function by corticosteroids.</a> Steroids. 59 (2), 69-73 (1994).</li><li>Bitgood, M. J., Shen, L., McMahon, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sertoli+cell+signaling+by+Desert+hedgehog+regulates+the+male+germline.">Sertoli cell signaling by Desert hedgehog regulates the male germline.</a> Current Biology. 6 (3), 298-304 (1996).</li><li>Beverdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox9-dependent+expression+of+Gstm6+in+Sertoli+cells+during+testis+development+in+mice.">Sox9-dependent expression of Gstm6 in Sertoli cells during testis development in mice.</a> Reproduction. 137 (3), 481 (2009).</li><li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+for+single-cell+isolation.">Technologies for single-cell isolation.</a> International Journal of Molecular Sciences. 16 (8), 16897-16919 (2015).</li><li>Ziegenhain, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+single-cell+RNA+sequencing+methods.">Comparative analysis of single-cell RNA sequencing methods.</a> Molecular Cell. 65 (4), 631-643 (2017).</li><li>Nguyen, Q. H., Pervolarakis, N., Nee, K., Kessenbrock, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+considerations+for+single-cell+rna+sequencing+approaches.">Experimental considerations for single-cell rna sequencing approaches.</a> Frontiers in Cell and Development Biology. 6, 108 (2018).</li><li>Chucair-Elliott, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+cell-specific+mouse+models+for+paired+epigenetic+and+transcriptomic+studies+of+microglia+and+astroglia.">Inducible cell-specific mouse models for paired epigenetic and transcriptomic studies of microglia and astroglia.</a> Communications Biology. 3 (1), 693 (2020).</li><li>Barsoum, I., Yao, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redundant+and+differential+roles+of+transcription+factors+Gli1+and+Gli2+in+the+development+of+mouse+fetal+Leydig+cells.">Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells.</a> Biology of Reproduction. 84 (5), 894-899 (2011).</li><li>Mori, H., Shimizu, D., Fukunishi, R., Christensen, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphometric+analysis+of+testicular+Leydig+cells+in+normal+adult+mice.">Morphometric analysis of testicular Leydig cells in normal adult mice.</a> The Anatomical Record. 204 (4), 333-339 (1982).</li></ol>

전체 조직 전사체 분석의 유용성은 특히 복잡한 이종 조직을 연구할 때 저해될 수 있습니다. 세포 유형 특이적 RNA를 얻는 방법은 강력한 RNA-seq 기술을 발휘하는 것이 시급한 필요성이 되고 있다. 세포 유형 특이적 RNA의 분리는 일반적으로 미세 조작, 형광 활성화 세포 분류(FACS) 또는 레이저 포획 미세 해부(LCM)18를 사용한 특정 유형의 세포 수집에 의존합니다. 다른 현대의 고처리?...

RNA 시퀀싱(RNA-seq) 및 마이크로어레이를 포함한 고처리량 접근 방식을 통해 게놈 전체 수준에서 유전자 발현 프로필을 조사할 수 있게 되었습니다. 심장, 뇌 및 고환과 같은 복잡한 조직의 경우 세포 유형 특이적 데이터는 전체 조직 1,2,3의 RNA 사용을 비교하는 더 자세한 정보를 제공합니다. 세포 이질성의 영향을 극복하기 위해, 번역 리보솜 친화성 정제(TRAP) 방법은 2010년대 초부터 개발되어 왔다4. TRAP는 조직 해리없이 특정 세포 유형에서 리보솜 결합 RNA를 분리 할 수 있습니다. 이 방법은 초파리 배아5에서 극히 드문 근육 세포 집단을 표적으로 삼고, 모델 식물 Arabidopsis thaliana6에서 다른 뿌리 세포를 연구하고, 포유류7에서 내피 세포의 전사체 분석을 수행하는 것을 포함하여 다양한 유기체에서 트랜스플라톰(번역을 위해 리보솜에 모집되는 mRNA) 분석에 사용되었습니다.
TRAP은 모델 유기체의 리보솜에 태그를 지정하기 위해 유전자 변형이 필요합니다. Evan Rosen과 동료들은 최근 Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) 마우스8이라는 마우스 모델을 개발했으며, 이는 2017 년부터 Jackson Laboratory를 통해 제공되었습니다. 연구자들은 Cre 마우스 라인과 교차함으로써 이 NuTRAP 마우스 모델을 사용하여 세포 분류 없이 Cre 발현 세포에서 리보솜 결합 RNA와 세포핵을 분리할 수 있습니다. NuTRAP 대립 유전자도 운반하는 Cre 발현 세포에서 EGFP/L10a 태그가 지정된 리보솜을 사용하면 친화성 풀다운 분석을 사용하여 번역 mRNA를 분리할 수 있습니다. 동일한 세포에서 비오틴 리가아제 인식 펩타이드(BLRP) 태그가 부착된 핵막(mCherry 양성이기도 함)은 친화성 또는 형광 기반 정제를 사용하여 핵 분리를 허용합니다. 같은 연구팀은 또한 핵막이 비오틴8없이 mCherry로만 표지 된 유사한 마우스 라인을 생성했습니다. 이 두 개의 유전자 변형 마우스 라인은 관심 있는 특정 유형의 세포의 쌍을 이루는 후성유전체 및 전사체 프로필을 특성화할 수 있는 액세스를 제공합니다.
고슴도치(Hh) 신호 전달 경로는 조직 발달에 중요한 역할을 합니다9. GLI 계열의 구성원인 GLI1은 전사 활성제 역할을 하며 Hh 신호 전달을 매개합니다. Gli1+ 세포는 부신과 고환을 포함한 많은 호르몬 분비 기관에서 찾을 수 있습니다. NuTRAP 마우스 모델을 사용하여 Gli1+ 세포로부터 세포 유형 특이적 DNA 및 RNA를 분리하기 위해, Gli1-CreERT2 마우스를 NuTRAP 마우스와 교차시켰다. Shh-CreERT2 마우스는 또한 소닉 헤지혹(Shh) 발현 세포를 단리하는 것을 목표로 하는 NuTRAP 마우스와 교차하였다. 다음 프로토콜은 Gli1-CreERT2를 사용하는 방법을 보여줍니다. NuTRAP 마우스를 사용하여 성인 마우스 고환의 Gli1+ 세포에서 리보솜 결합 RNA를 분리합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Actb</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>ATGGAGGGGAATACAGCCC / TTCTTTGCAGCTCCTTCGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100 Bioanalyzer Instrument</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete Mini EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millipore</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>cycloheximide</td>
			<td>Millipore</td>
			<td>239764-100MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyp11a1</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>CTGCCTCCAGACTTCTTTCG / TTCTTGAAGGGCAGCTTGTT (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>dNTP</td>
			<td>Thermo Fisher Scientific</td>
			<td>R0191</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT, Dithiothreitol</td>
			<td>Thermo Fisher Scientific</td>
			<td>P2325</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag-2 magnet</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tubes 15 mL</td>
			<td>VWR</td>
			<td>89039-666</td>
			<td></td>
		</tr>
		<tr>
			<td>GFP antibody</td>
			<td>Abcam</td>
			<td>ab290</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass grinder set</td>
			<td>DWK Life Sciences</td>
			<td>357542</td>
			<td></td>
		</tr>
		<tr>
			<td>heparin</td>
			<td>BEANTOWN CHEMICAL</td>
			<td>139975-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>Hsd3b</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GACAGGAGCAGGAGGGTTTGTG / CACTGGGCATCCAGAATGTCTC (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Biosciences</td>
			<td>R005</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Biosciences</td>
			<td>R004</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes 2 mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>02-707-354</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse Clariom S Assay microarrays</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Microarray service</td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Millipore</td>
			<td>492018-50 Ml</td>
			<td></td>
		</tr>
		<tr>
			<td>oligo (dT)20</td>
			<td>Invitrogen</td>
			<td>18418020</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoPure RNA Isolation Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>KIT0204</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G Dynabead</td>
			<td>Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>growcells</td>
			<td>NUPW-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>RNaseOUT Recombinant Ribonuclease Inhibitor</td>
			<td>Thermo Fisher Scientific</td>
			<td>10777019</td>
			<td></td>
		</tr>
		<tr>
			<td>Sox9</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>TGAAGAACGGACAAGCGGAG / CTGAGATTGCCCAGAGTGCT (forward primer/reverse primer</td>
		</tr>
		<tr>
			<td>Superscript IV reverse transcriptase</td>
			<td>Invitrogen</td>
			<td>18090050</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4309155</td>
			<td></td>
		</tr>
		<tr>
			<td>Sycp3</td>
			<td>eurofins</td>
			<td>qPCR primers</td>
			<td>GAATGTGTTGCAGCAGTGGGA /GAACTGCTCGTGTATCTGTTTGA (forward primer/reverse primer)</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Alfa Aesar</td>
			<td>J62848</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolate cell-type-specific rnas from snap-frozen heterogeneous tissue samples without cell sorting

세포 이질성은 전사체 수준에서 복잡한 조직의 기능을 이해하는 데 어려움을 겪습니다. 세포 유형 특이적 RNA를 사용하면 조직의 이질성으로 인한 잠재적인 위험을 방지하고 강력한 전사체 분석을 가능하게 합니다. 여기에 설명된 프로토콜은 번역 리보솜 친화성 정제(TRAP) 방법을 사용하여 세포 분류 없이 복잡한 조직에서 소량의 EGFP 발현 세포에서 리보솜 결합 RNA를 분리하는 방법을 보여줍니다. 이 프로토콜은 최근 이용 가능한 NuTRAP 마우스 모델을 사용하여 세포 유형 특이적 RNA를 분리하는 데 적합하며 EGFP 발현 세포에서 RNA를 분리하는 데에도 사용할 수 있습니다.

Gli1-CreERT2 마우스 (잭슨 랩 스톡 번호: 007913)를 먼저 NuTRAP 리포터 마우스 (잭슨 랩 스톡 번호: 029899)와 교차시켜 이중 돌연변이 마우스를 생성하였다. 유전자 조작 유전자 대립 유전자 (즉, Gli1-CreERT2 및 NuTRAP)를 모두 보유한 마우스에 하루에 한 번, 격일로 3 회 주사 할 때 타목시펜을 주사 하였다. 조직 샘플은 주사 후 1일째 되는 날인 7일째에 수집...

Watch this Scientific Journal Video about Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting at JoVE.com

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

이 프로토콜은 NuTRAP 마우스 모델을 사용하여 세포 유형 특이적 번역 리보솜 mRNA를 분리하는 것을 목표로 합니다.

세포 분류 없이 스냅 동결 이종 조직 샘플에서 세포 유형 특이적 RNA 분리

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

이 프로토콜은 세포 분류 없이 복잡한 조직의 소수의 세포에서 고품질 세포 유형 특이적 RNA를 얻는 것을 목표로 합니다. 연구자들이 GLP 풀다운을 사용하여 리보솜 결합 RNA를 분리할 수 있도록 하는 최근 사용 가능한 마우스 모델을 사용합니다. 상기 방법은 또한 임의의 EGFP 발현 세포로부터 리보솜 결합 RNA를 단리하는데 적합하다.시작하려면 유리 티슈 그라인더 세트에 2 밀리리터의 얼음처럼 차가운 균질화 작업 버퍼를 추가하십시오. 냉동 샘플을 분쇄기에 빠르게 넣고 느슨한 유봉을 사용하여 얼음 위에서 30 스트로크로 조직을 균질화하십시오. 균질 액을 2 밀리리터의 둥근 바닥 튜브로 옮기고 섭씨 4도에서 10 분 동안 12, 000g에서 원심 분리합니다.그런 다음 펠릿을 방해하지 않고 상청액을 새로운 2 밀리리터 튜브로 옮기고 100 마이크로 리터를 입력으로 예약합니다. 항-GFP 항체와 함께 상청액을 섭씨 4도에서 밤새 회전근의 끝에서 배양합니다. 균질액과 항체 혼합물을 세척된 단백질 g 비드를 함유하는 새로운 2밀리리터 둥근 바닥 튜브로 옮기고, 2시간 동안 24RPM의 회전기에서 섭씨 4도 인큐베이션하였다.마그네틱 랙을 사용하여 상청액으로부터 마그네틱 비드를 분리한다. 상청액을 EGFP 음성 세포의 RNA와 리보솜에 결합되지 않은 EGFP 양성 세포의 RNA를 포함하는 음성 분획으로 저장합니다. 비드에 1 밀리리터의 고 염 세척 버퍼를 추가하고 튜브를 간단히 와동시켜 비드를 세척합니다.그런 다음 튜브를 마그네틱 랙에 놓습니다. 세척 완충액을 제거하고 세척 단계를 2회 더 반복하여 EGFP 양성 세포로부터 비드 리보솜 RNA 복합체를 얻었다. 비드를 RNA 분리 키트의 추출 버퍼 50마이크로리터와 함께 써모믹서에서 30분 동안 인큐베이션하여 비드에서 RNA를 방출합니다.마그네틱 랙으로 비드를 분리하고 상층액을 1.5 밀리리터 튜브로 옮깁니다. 튜브를 3000g에서 2분 동안 원심분리합니다. 그런 다음 상청액을 새로운 1.5 밀리리터 튜브에 피펫팅합니다.RNA 정제 컬럼을 사전 컨디셔닝하기 위해, 250 마이크로리터의 컨디셔닝 버퍼를 정제 컬럼 상에 피펫팅하고 실온에서 5분 동안 인큐베이션한다. 그런 다음 컬럼을 16, 000g에서 1 분 동안 원심 분리합니다. 동일한 부피의 70% 에탄올을 세포 추출물에 피펫팅하고 피펫팅하여 잘 혼합합니다.최대 200 마이크로리터의 혼합물을 사전 조절된 RNA 정제 컬럼에 피펫팅합니다. 샘플 손실을 줄이려면 용량의 80 % 이상 열을 채우지 마십시오. 모든 RNA가 각 분획의 동일한 컬럼에 수집될 때까지 이 단계를 여러 번 반복합니다.컬럼을 2분 동안 원심분리하여 컬럼 내의 멤브레인에 RNA를 결합시킨다. 그런 다음 30 초 동안 원심 분리를 계속하십시오. 유동을 버리고 100 마이크로리터의 세척 완충액을 피펫팅하여 컬럼 내로 넣는다.1 분 동안 원심 분리한 다음 흐름을 폐기하십시오. 피펫 75 마이크로리터의 DNA 용액을 정제 컬럼 멤브레인에 직접 혼합합니다. 실온에서 15 분 동안 배양하십시오.이어서, 40 마이크로리터의 세척 완충액 하나를 컬럼 내로 피펫팅하고 또 다른 30초 동안 원심분리한다. 통과 흐름을 폐기합니다. 피펫 100 마이크로리터의 세척 완충액 2개를 컬럼에 넣고 8, 000 g에서 1분 동안 원심분리한다.통과 흐름을 폐기합니다. PET 100 마이크로 리터의 세척 완충액 2 개를 컬럼에 넣고 16, 000 g에서 2 분 동안 원심 분리한다. 유동을 버리고, 동일한 컬럼을 16, 000 g에서 1분 동안 다시 원심분리하여 세척 완충액의 모든 미량을 제거한다.컬럼을 새로운 1.5 밀리리터 마이크로 원심 분리기 튜브로 옮깁니다. 피펫 팁이 멤브레인에 닿지 않도록 정제 컬럼의 멤브레인에 직접 12 마이크로 리터의 RNase 자유수를 피펫합니다. 실온에서 1 분 동안 배양하고 1000g에서 1 분 동안 원심 분리합니다.그 후 16, 000 G에서 1분 동안 RNA를 용출시켰다. 추출된 RNA의 품질과 양을 평가하기 위해 바이오분석기를 사용하십시오. RNA를 80도 냉동고에 보관하거나 추가 분석을 위해 보내십시오.유전자 조작 유전자 대립 유전자 인 Gli1-CreERT2와 NuTRAP을 모두 보유한 마우스는 하루에 한 번, 격일로 3 회 주사 할 때 타목시펜을 주사합니다. 수집 된 조직의 면역 형광 분석은 EGFP가 고환의 간질 세포에서 발현되었음을 보여줍니다. EGFP는 또한 NuTRAP 마우스인 Gli1-CreERT2의 부신 캡슐 세포에서 발견되었습니다.소닉 헤지혹-CreERT2에서 NuTRAP 마우스 EGFP 양성 세포 집단은 캡슐 아래 부신의 외부 피질에 상주하여 EGFP 사전 발현 세포의 발현을 확인합니다. 세포 유형 특이적 RNA를 추출한 후, 추출된 RNA를 마이크로어레이 분석을 위해 보냈다. 결과는 음성 분획의 유전자에 비해 약 3000 개의 유전자가 양성 분획에서 풍부 한 반면, 약 4, 000 개의 유전자가 음성 분획에서 풍부하다는 것을 보여 주었다.차등적으로 발현된 유전자 중에서, 라이디히 세포 관련 유전자 Hsd11b1 및 Hsd3b6은 양성 분획에서 풍부하였다. 음성 분획에서, Sertoli 세포 관련 유전자 사막 고슴도치 및 Gstm6이 풍부 해졌다. 음성 분획을 입력과 비교할 때 몇 가지 차등적으로 발현된 유전자만이 확인되었습니다.실시간 정량 RT-PCR을 이용하여 양성 및 음성 분획에서 핵심 유전자의 발현을 확인하였다. 마이크로어레이 분석에서 발견된 것과 유사하게, 스테로이드 생성 효소 3-베타 하이드록시스테로이드 탈수소효소 및 콜레스테롤 측쇄 절단 효소가 양성 분획에서 풍부하게 나타났다. 한편, Sertoli 세포 마커 SRY 박스 전사 인자 9 및 생식 세포 마커 시냅톤 복합체 단백질 3은 음성 분획에서 풍부하게 나타났다.이 프로토콜을 시도할 때 사용하기 전에 DTT, 사이클로헥시미드 재조합 리보뉴클레아제 및 프로테이나제 억제제 칵테일을 균질화 스톡 용액에 추가하는 신선한 균질화 작업 완충액을 준비하는 것이 중요합니다. 사용하기 전에 신선한 저염과 고염 세척 완충액을 준비하는 것도 중요합니다.

Research

JoVE Journal

Biology

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

굴지 공동 침강 분석, F - 굴지에 바인딩 단백질의 분석

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

연구

생물학

Fluorescence Activated Cell Sorting of Plant Protoplasts

식물 Protoplasts의 형광 활성 세포 정렬

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

에서 외과를 이용한 셀 타입 특정 표현식 프로파일을 사용하여 조직 및 장기 특정 Phytochrome 응답 조사 Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

셀 유형 - 구체적인 현지화의 분석을 위해 Heterokaryon 기법

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Genotyping of Plant and Animal Samples without Prior DNA Purification

이전 DNA의 정제없이 식물과 동물 샘플의 Genotyping

The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

셀 추적 염료를 사용하여 전지 부문 모니터링에 최적화 된 착색 및 확산 모델링 방법

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Small Noncoding RNAs from Human Serum

인간 혈청에서 작은 비 암호화 RNA를의 분리

The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are ...

Method for Measuring the Activity of Deubiquitinating Enzymes in Cell Lines and Tissue Samples

세포주 및 조직 샘플에서 Deubiquitinating 효소의 활성을 측정 방법

The ubiquitin-proteasome system has recently been implicated in various pathologies including neurodegenerative diseases and cancer. In light of this, ...

Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model

마그네틱 활성화 전략을 분리 하 고 정화 활 액 액체 파생 된 중간 엽 줄기 세포는 토끼 모델에서 정렬 셀

Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: 셀 형식 관련 Epigenome 프로 파일링

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...