Name: tension gauge tether probes for quantifying growth factor mediated integrin mechanics and adhesion
Uploaded: 2022-02-11T14:30:00
Duration: 9 min 56 s
Description: Watch this Scientific Journal Video about Tension Gauge Tether Probes for Quantifying Growth Factor Mediated Integrin Mechanics and Adhesion at JoVE.com

저자는 유익한 토론과 비판을 위해 Mattheyses 연구소의 구성원을 인정하고 싶습니다. 우리는 NSF CAREER 1832100 및 NIH R01GM131099에서 A.L.M.에 자금을 지원한다는 것을 인정합니다.

<ol>
	<li>Lim, C. -. G., Jang, J., Kim, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+machinery+for+sensing+mechanical+force.">Cellular machinery for sensing mechanical force.</a> BMB Reports. 51 (12), 623-629 (2018).</li><li>Moraes, C., Sun, Y., Simmons, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(Micro)managing+the+mechanical+microenvironment.">(Micro)managing the mechanical microenvironment.</a> Integrative Biology. 3 (10), 959-971 (2011).</li><li>Vogel, V., Sheetz, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+forces+matter+in+health+and+disease.+From+Cancer+to+Tissue+Engineering.">Mechanical forces matter in health and disease. From Cancer to Tissue Engineering.</a> Nanotechnology. , 233-303 (2010).</li><li>Wang, J. H. C., Li, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanics+rules+cell+biology.">Mechanics rules cell biology.</a> BMC Sports Science, Medicine and Rehabilitation. 2 (1), 16 (2010).</li><li>Moeendarbary, E., Harris, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+mechanics:+principles,+practices,+and+prospects.">Cell mechanics: principles, practices, and prospects.</a> Wiley Interdisciplinary Reviews: Systems Biology and Medicine. 6 (5), 371-388 (2014).</li><li>Streuli, C. H., Akhtar, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signal+co-operation+between+integrins+and+other+receptor+systems.">Signal co-operation between integrins and other receptor systems.</a> Biochemical Journal. 418 (3), 491-506 (2009).</li><li>Chiasson-MacKenzie, C., McClatchey, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EGFR-induced+cytoskeletal+changes+drive+complex+cell+behaviors:+The+tip+of+the+iceberg.">EGFR-induced cytoskeletal changes drive complex cell behaviors: The tip of the iceberg.</a> Science Signaling. 11 (515), (2018).</li><li>Kechagia, J. Z., Ivaska, J., Roca-Cusachs, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrins+as+biomechanical+sensors+of+the+microenvironment.">Integrins as biomechanical sensors of the microenvironment.</a> Nature Reviews Molecular Cell Biology. 20 (8), 457-473 (2019).</li><li>De Luca, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+EGFR+signaling+in+tumor+microenvironment.">The role of the EGFR signaling in tumor microenvironment.</a> Journal of Cellular Physiology. 214 (3), 559-567 (2008).</li><li>Javadi, S., Zhiani, M., Mousavi, M. A., Fathi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crosstalk+between+Epidermal+Growth+Factor+Receptors+(EGFR)+and+integrins+in+resistance+to+EGFR+tyrosine+kinase+inhibitors+(TKIs)+in+solid+tumors.">Crosstalk between Epidermal Growth Factor Receptors (EGFR) and integrins in resistance to EGFR tyrosine kinase inhibitors (TKIs) in solid tumors.</a> European Journal of Cell Biology. 99 (4), 151083 (2020).</li><li>Eliceiri, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrin+and+growth+factor+receptor+crosstalk.">Integrin and growth factor receptor crosstalk.</a> Circulation Research. 89 (12), 1104-1110 (2001).</li><li>Dan, L., Jian, D., Na, L., Xiaozhong, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crosstalk+between+EGFR+and+integrin+affects+invasion+and+proliferation+of+gastric+cancer+cell+line,+SGC7901.">Crosstalk between EGFR and integrin affects invasion and proliferation of gastric cancer cell line, SGC7901.</a> OncoTargets and Therapy. 5, 271-277 (2012).</li><li>Giancotti, F. G., Tarone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+control+of+cell+fate+through+joint+integrin/receptor+protein+kinase+signaling.">Positional control of cell fate through joint integrin/receptor protein kinase signaling.</a> Annual Reviews: Cell and Developmental Biology. 19, 173-206 (2003).</li><li>Ricono, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+cross-talk+between+epidermal+growth+factor+receptor+and+integrin+alphavbeta5+promotes+carcinoma+cell+invasion+and+metastasis.">Specific cross-talk between epidermal growth factor receptor and integrin alphavbeta5 promotes carcinoma cell invasion and metastasis.</a> Cancer Research. 69 (4), 1383-1391 (2009).</li><li>Polacheck, W. J., Chen, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+cell-generated+forces:+a+guide+to+the+available+tools.">Measuring cell-generated forces: a guide to the available tools.</a> Nature Methods. 13 (5), 415-423 (2016).</li><li>Hang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanosensors+for+single+cell+mechanical+interrogation.">Nanosensors for single cell mechanical interrogation.</a> Biosensors and Bioelectronics. 179, 113086 (2021).</li><li>Style, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Traction+force+microscopy+in+physics+and+biology.">Traction force microscopy in physics and biology.</a> Soft Matter. 10 (23), 4047-4055 (2014).</li><li>Schoen, I., Hu, W., Klotzsch, E., Vogel, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+cellular+traction+forces+by+micropillar+arrays:+contribution+of+substrate+warping+to+pillar+deflection.">Probing cellular traction forces by micropillar arrays: contribution of substrate warping to pillar deflection.</a> Nano Letters. 10 (5), 1823-1830 (2010).</li><li>Ma, V. P. -. Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Nanotechnology+as+an+Emerging+Tool+to+Study+Mechanotransduction+in+Living+Systems.">DNA Nanotechnology as an Emerging Tool to Study Mechanotransduction in Living Systems.</a> Small. 15 (26), 1900961 (2019).</li><li>Kim, Y., Kim, K. A., Kim, B. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+DNA+force+sensors+to+study+the+molecular+level+forces+required+to+activate+signaling+pathways.">Double-stranded DNA force sensors to study the molecular level forces required to activate signaling pathways.</a> Journal of the Korean Physical Society. 78 (5), 386-392 (2021).</li><li>Rao, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EGFR+activation+attenuates+the+mechanical+threshold+for+integrin+tension+and+focal+adhesion+formation.">EGFR activation attenuates the mechanical threshold for integrin tension and focal adhesion formation.</a> Journal of Cell Sciences. 133 (13), (2020).</li><li>Zhang, Y., Ge, C., Zhu, C., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+digital+tension+probes+reveal+integrin+forces+during+early+cell+adhesion.">DNA-based digital tension probes reveal integrin forces during early cell adhesion.</a> Nature Communications. 5, 5167 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+nanoparticle+tension+sensors+reveal+that+T-cell+receptors+transmit+defined+pN+forces+to+their+antigens+for+enhanced+fidelity.">DNA-based nanoparticle tension sensors reveal that T-cell receptors transmit defined pN forces to their antigens for enhanced fidelity.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (20), 5610-5615 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Platelet+integrins+exhibit+anisotropic+mechanosensing+and+harness+piconewton+forces+to+mediate+platelet+aggregation.">Platelet integrins exhibit anisotropic mechanosensing and harness piconewton forces to mediate platelet aggregation.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (2), 325-330 (2018).</li><li>Ma, V. P. -. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanically+induced+catalytic+amplification+reaction+for+readout+of+receptor-mediated+cellular+forces.">Mechanically induced catalytic amplification reaction for readout of receptor-mediated cellular forces.</a> Angewandte Chemie International Edition. 55 (18), 5488-5492 (2016).</li><li>Wang, X., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+single+molecular+forces+required+to+activate+integrin+and+notch+signaling.">Defining single molecular forces required to activate integrin and notch signaling.</a> Science. 340 (6135), 991-994 (2013).</li><li>Chen, Y., Lee, H., Tong, H., Schwartz, M., Zhu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Force+regulated+conformational+change+of+integrin+&#945;V&#946;3.">Force regulated conformational change of integrin &#945;V&#946;3.</a> Matrix Biology. 60-61, 70-85 (2017).</li><li>Kantlehner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+coating+with+cyclic+RGD+peptides+stimulates+osteoblast+adhesion+and+proliferation+as+well+as+bone+formation.">Surface coating with cyclic RGD peptides stimulates osteoblast adhesion and proliferation as well as bone formation.</a> ChemBioChem. 1 (2), 107-114 (2000).</li><li>Kapp, T. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+evaluation+of+the+activity+and+selectivity+profile+of+ligands+for+RGD-binding+integrins.">A comprehensive evaluation of the activity and selectivity profile of ligands for RGD-binding integrins.</a> Scientific Reports. 7, 39805 (2017).</li><li>Kok, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+functional+evaluation+of+RGD-modified+proteins+as+alpha(v)beta(3)+integrin+directed+therapeutics.">Preparation and functional evaluation of RGD-modified proteins as alpha(v)beta(3) integrin directed therapeutics.</a> Bioconjugate Chemistry. 13 (3), 128-135 (2002).</li><li>Li, I. T. S., Ha, T., Chemla, Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+cell+surface+adhesion+by+rotation+tracking+and+adhesion+footprinting.">Mapping cell surface adhesion by rotation tracking and adhesion footprinting.</a> Scientific Reports. 7 (1), 44502 (2017).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Force-activatable+biosensor+enables+single+platelet+force+mapping+directly+by+fluorescence+imaging.">Force-activatable biosensor enables single platelet force mapping directly by fluorescence imaging.</a> Biosensors and Bioelectronics. 100, 192-200 (2018).</li><li>Murad, Y., Li, I. T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+molecular+forces+with+serially+connected+force+sensors.">Quantifying molecular forces with serially connected force sensors.</a> Biophysical Journal. 116 (7), 1282-1291 (2019).</li><li>Yasunaga, A., Murad, Y., Li, I. T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+molecular+tension-classifications,+interpretations+and+limitations+of+force+sensors.">Quantifying molecular tension-classifications, interpretations and limitations of force sensors.</a> Physical Biology. 17 (1), 011001 (2019).</li><li>Luca, V. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch-Jagged+complex+structure+implicates+a+catch+bond+in+tuning+ligand+sensitivity.">Notch-Jagged complex structure implicates a catch bond in tuning ligand sensitivity.</a> Science. 355 (6331), 1320-1324 (2017).</li><li>Spillane, K. M., Tolar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cell+antigen+extraction+is+regulated+by+physical+properties+of+antigen-presenting+cells.">B cell antigen extraction is regulated by physical properties of antigen-presenting cells.</a> The Journal of Cell Biology. 216 (1), 217-230 (2017).</li><li>Brockman, J. M., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+proofreading:+a+general+mechanism+to+enhance+the+fidelity+of+information+transfer+between+cells.">Mechanical proofreading: a general mechanism to enhance the fidelity of information transfer between cells.</a> Frontiers in Physics. 7, 14 (2019).</li></ol>

저자는 이해 상충을 선언하지 않습니다.

위에서 설명한 상세한 단계별 절차를 통해 TGT 표면을 준비하여 EGF 처리 후 세포 부착 및 확산 동안 부착 세포에 의해 생성 된 세포 형태 및 인테그린 장력을 정량화 할 수 있습니다. 간단한 실험 설정과 함께 간단한 프로브 설계 및 합성 및 표면 준비는 EGFR과 인테그린의 상호 작용을 연구 할 수있는 안정적인 플랫폼을 제공했습니다. 전반적으로, 결과는 EGFR의 리간드 의존성 활성화가 세포 확산을 향상시키고, 인테그린 수용체의 힘 보유 특성을 조정하며, 초점 부착 조직 및 성숙을 촉진한다는 것을 검증한다. TGT 프로브를 사용하여 얻은 결과는 EGFR과 같은 성장 인자가 '메카노 조직자'로 작용하여 인테그린 장력의 양과 공간 조직을 증가시키고 초점 접착의 방향과 역학을 조절한다는 중요한 가설을 뒷받침합니다.
TGT 표면 상으로의 적용시, 세포는 인테그린 (αVβ3) 수용체가 감지됨에 따라 착륙, 부착 및 확산되고 cRGDfK 리간드에 결합한다. 이렇게 함으로써 TGT 프로브는 기계적으로 파열될 수 있고, 리간드 결합 부위에서 형광을 생성할 수 있다. 판독은 표면과 상호 작용하는 세포의 누적 "힘 역사"입니다. 이러한 실험 중에 존재할 수 있는 TGT 표면에는 몇 가지 일반적인 문제가 있습니다. 높은 표면 배경 형광 (그림 6A, B), 패치 표면 외관, 장력 신호를 생성하는 세포의 실패 (그림 6C, D) 및 세포의 확산 실패 (그림 6E, F)는 TGT 프로브 또는 표면 합성의 기술적 단점 때문일 수 있습니다. 이러한 일반적인 문제에 대한 해결책은 표 1에 제시되어 있다.
TGT 프로브의 간단한 설계는 세포 생물학자에게 특정 리간드 및 자극만을 제공함으로써 다른 세포 표면 수용체로부터의 간섭 없이 격리된 특이적 성장 인자-인테그린 신호전달 결과를 연구할 수 있는 강력한 도구를 제공한다. 추가적으로, TGT 프로브는 pN 감도에서 세포 부착 동안 개별 인테그린 수용체를 밑줄로 하는 장력 역치의 조사를 허용한다. 대안적인 접근법은 고정된 샘플(31)에서 높은 공간 분해능을 갖는 개별 수용체에 의해 가해지는 힘을 보고하지 못한다. 견인력 현미경은 개별 인테그린 수용체(15)에 의해 가해지는 힘보다 더 높은 크기 순서인 nN 힘에만 민감하며, 분자 장력 프로브는 pN 힘을 측정하지만, 가역적이기 때문에, 그들은 견고하게 고정을 견디지 못한다. 이러한 이유로 TGT 프로브는 성장 인자-인테그린 상호작용의 역학을 연구하는 매력적인 도구입니다.
TGT 프로브와 관련된 몇 가지 기술적 뉘앙스가 있으며 실험을 설계하기 전에 고려해야 합니다. 장력 이미지는 시간의 스냅 샷으로, 주어진 시점에서 수용체 - 리간드 결합의 지표가 아닌 힘 역사를 나타냅니다. 신호 생성은 프로브 분리에 의존하기 때문에, TGT 형광은 수용체-리간드 결합으로부터 활성 장력 하에 있지 않은 개방 프로브로부터 초래된다. 이는 TGT 표면에서 얻어진 인테그린 장력에 대한 판독값이 역사적이며Ttol보다 큰 힘이 있었던 곳을 나타내는 자연에서 누적된다는 것을 의미합니다. Ttol 미만의 현재 수용체-리간드 힘의 위치는19,32로 보고되지 않는다. TGT 파열은 수용체-리간드 결합의 종결을 초래하기 때문에, 세포 확산은Ttol보다 낮은 힘을 경험하는 인테그린-리간드 상호작용에 기인한다. 따라서 사용자는 인테그린 기반 접착과 관련된 기계적 결과를 추정하기 위해 도금 후 시간을 정의할 때 주의해야 합니다. 마지막으로,Ttol의 의미를 고려해야 한다. 여기에 사용된 TGT 프로브는 56pN의 Ttol을 가지며, 여기서Ttol은 2초 동안 적용될 때 프로브의 50%를 파열시키는 데 필요한 일정한 힘입니다. 복잡한 생물학적 시스템을 고려할 때, TGT는 다양한 시간 의존성을 가진 이질적이고 다양한 힘 그라데이션을 경험할 가능성이 큽니다. TGT가Ttol보다 큰 힘에 의해 파열된다면, 형광은 전체 장력의 과소 평가가 될 것입니다. 대안으로, 더 긴 지속 시간 동안 적용된Ttol 이하의 힘은 더 짧은 시간 동안 적용된 높은 역치력과 유사한 수의 프로브를 파열시킬 수 있다. 이 두 시나리오 모두 동일한 형광 강도 판독을 초래할 수 있으며, TGT 프로브33,34를 사용하여 정확한 장력 크기 또는 역학을 해결하기가 어렵습니다.
전반적으로, 성장 인자 자극에 따른 인테그린 장력의 평가는 내부 대조군과의 실험을 설계하고, 다른 매트릭스 코팅 표면의 확산 프로파일을 비교하고, 성장 인자 자극의 유무에 따라 세포에서 TGT 형광을 병렬로 평가하고, 다른Ttol을 가진 TGT를 사용하여 신중하게 이루어져야합니다. . TGT는 인테그린 수용체의 역학, 초점 부착 역학 및 세포 확산을 조절하는 성장 인자 신호 전달의 역할을 정량화 할 수 있습니다. 이 프로토콜은 상이한Ttol, 상이한 리간드, 상이한 세포 유형, 또는 상이한 자극 조건을 갖는 프로브를 사용하는 많은 TGT 기반 실험을 위한 주형으로서 사용될 수 있다. 관심있는 임의의 단백질은 고정 후 표지될 수 있고, 임의의 유형의 정량적 이미지 분석이 구현될 수 있다. 따라서 우리는 수많은 TGT 실험을위한 템플릿을 제시합니다.
TGT 프로브의 사용은 인테그린을 연구하는 것에 국한되지 않고 리간드를 변형시킴으로써 상이한 세포 유형에 걸쳐 세포막 수용체의 다양한 어레이로 확장될 수 있다. TGT 프로브는 배아 발달 및 신경 발생에서 노치 수용체 역학의 기계적 역할 확인(35), B 세포 수용체에 의한 항원의 확인 및 내재화를 매개하는 힘(36), 신호 전달의 강도와 특이성을 높이기 위한 힘의 변화를 검출하는 T 세포 표면 수용체의 기계적 교정 능력 등 다양한 수용체 신호전달 캐스케이드를 조절하는 힘의 역할을 조사하는 데 사용되어 왔다(37) . 함께, 이러한 발견은 다양한 실험 환경에서 TGT 프로브의 엄청난 잠재력을 강조합니다.

세포는 기계적 힘을 감지, 생성 및 반응하는 고유 한 능력을 가지고있어 세포 표현형의 변화와 국소 미세 환경 1,2의 리모델링을 유도합니다. 힘은 유착, 이동, 증식, 분화 및 상처 치유를 포함한 세포 행동의 많은 측면을 조절하는 데 중요한 역할을합니다 3,4. 세포와 미세 환경 사이의 양방향 기계적 교환에서의 수차는 암을 포함한 병든 상태로 이어질 수 있습니다5. 수많은 막 수용체가 세포-매트릭스 항상성 유지에 관여한다; 이들 중, 인테그린 및 표피 성장 인자 수용체 (EGFR)는 강력한 시너지 효과 6,7을 갖는다. 고전적으로, 인테그린은 미세 환경과 세포 내 세포 골격 사이의 기계적 연결을 확립하는 반면, EGFR은 세포 성장, 증식 및 생존을 조절합니다 8,9. EGFR은 고도로 연구된 치료 표적으로, 세포내 신호전달을 촉진하는 외부-인 조절에 초점을 맞춘다. EGFR-인테그린 크로스토크는 암10,11을 포함한 다수의 질환의 진행을 조절하기 위해 유전적으로 및 생화학적으로 확립되었다. 연구는 EGFR-인테그린 인터플레이의 존재를 나타내지만, 그 결과는 원형질막7,12,13,14로부터 떨어진 신호전달 경로에 기인한다. EGFR 또는 다른 성장 인자가 세포 역학에 미치는 영향은 세포력과 신호 전달 결과를 측정하는 도구가 부족하기 때문에 부분적으로 탐구되지 않은 채로 남아 있습니다. 과제는 이러한 병렬 신호 패러다임 간의 통신을 연구하고 세포 역학에 대한 특정 기여도를 정량화하는 데 적절한 도구를 식별하는 데 있습니다.
세포 부착 수용체에 의해 생성된 힘을 측정하기 위해 몇 가지 접근법이 개발되었으며, 독자는 이러한 기술(15,16)에 대한 심층적인 검토로 향한다. 간략하게, 견인력 현미경 및 마이크로필라 어레이 검출은 개별 수용체 힘(17,18)보다 더 큰 크기인 나노뉴턴(nN) 힘을 추론하기 위해 하부 기질의 변형에 의존한다. AFM 및 광학 핀셋을 포함한 단일 분자 기술은 단일 단백질 피코네톤(pN) 힘에 민감하지만 한 번에 하나의 수용체만 측정하며 양호한(또는 임의) 공간 분해능을 제공하지 않습니다. DNA 기반 분자 장력 프로브 및 텐션 게이지 테더 (TGT) 프로브는 회절 제한 (또는 그 이상) 공간 분해능으로 pN 힘 분해능을 제공하여 섬유 아세포, 암 세포, 혈소판 및 면역 세포를 포함한 다양한 세포 유형에서 단일 세포 힘19,20을 연구하는 데 고유 한 역할을 제공합니다21,22,23,24 . 분자 장력 프로브는 실시간 이미징에 이상적인 확장 가능한 "스프링"요소를 가지고 있지만 TGT 프로브는 돌이킬 수 없게 파열되어 형광 "힘 역사"를 남깁니다. TGT는 하부 기판의 장력 임계치를 추가로 변조한다; 유사한 화학적 조성을 갖지만 파열력, 또는 장력 내성(Ttol)을 갖는 일련의 프로브는 초점 접착 형성 및 세포 확산에 필요한 최소 장력을 정량화하는데 사용될 수 있다. TGT 프로브는 두 개의 상보적인 DNA 가닥으로 구성되며, 하나는 표면에 고정되고 다른 하나는 세포에 리간드를 제시합니다. 수용체가 리간드에 결합하고 프로브의Ttol보다 큰 힘을 가하면 가닥이 분리됩니다. Ttol은 이상적인 조건 하에서 2s 간격으로 프로브의 50%를 파열시키는 데 필요한 일정한 힘으로 정의됩니다. "턴온" TGT 프로브에서, 상부 가닥 상의 소광기는 하부 가닥의 형광단으로부터 분리될 수 있다. TGT 프로브가Ttol보다 크거나 같은 힘에 의해 파열된 경우에만 형광 신호가 생성될 것이다. TGT 프로브도 고정할 수 있어 생물학적 시스템을 쉽게 조작하고 여러 조건을 테스트할 수 있습니다. 이러한 이유로 TGT 프로브가이 작업에 사용되었습니다.
TGT 프로브는 인테그린 의존성 세포 부착 및 기계적 힘이 활성화된 EGFR21에 의해 어떻게 조절되는지를 연구하기 위해 사용되었다. 이 연구는 EGFR을 '메카노 주최자'로 확립하여 초점 접착 조직과 긴장 생성을 조정했습니다. 추가적으로, EGF 자극이 초점 부착 및 강화된 세포 확산의 분포 및 성숙에 영향을 미친다는 것이 발견되었다. 이 접근법은 성장 인자가 종양 진행 및 역학의 기계적 힘에 어떻게 영향을 미치는지 조사하기 위해 향후 연구에 사용될 수 있습니다. 상피를 중간엽 전이로 조절하는 데 EGFR-인테그린 크로스토크의 역할이 확립되어 있지만, 이 과정에서 기계적 힘의 역할은 아직 미숙한 연구로 남아 있다10.
여기에서, 56 pN TGT 프로브의 합성 및 조립, 유리 커버슬립 상의 TGT 표면 생성, TGT 표면 상의 Cos-7 세포의 적용 및 EGF로 자극, 팔로이딘으로 세포의 고정 및 염색, 및 항-팍실린 항체, 고분해능 총 내부 반사 형광(TIRF) 및 반사 간섭 대조 현미경(RICM) 이미징을 포괄하는 이러한 실험에 대한 상세한 프로토콜이 제시되며, 및 이미지 정량화. 이 프로토콜은 Cos-7 세포의 EGF 자극을 조사하기 위해 작성되었지만 많은 TGT 기반 실험에 쉽게 적응할 수 있습니다. 상이한 리간드,Ttol, 세포 유형, 자극 파라미터, 고정에 따라 표지된 단백질 및 정량 분석이 용이하게 치환될 수 있어서, 이 프로토콜은 견고하고 널리 이용된다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>(3-Aminopropyl)triethoxysilane</td>
			<td>Millipore Sigma</td>
			<td>440140</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>3-hydroxypicolinic acid (3-HPA)</td>
			<td>Millipore Sigma</td>
			<td>56197</td>
			<td>Maldi-TOF-MS matrix</td>
		</tr>
		<tr>
			<td>Acetic Acid, Glacial</td>
			<td>Fisher Scientific</td>
			<td>A38S</td>
			<td>Diluting EGF</td>
		</tr>
		<tr>
			<td>Acetonitrile (HPLC)</td>
			<td>Fisher Scientific</td>
			<td>A998SK</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 Phalloidin</td>
			<td>Cell Signaling Technology</td>
			<td>8878S</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Ammonium Chloride</td>
			<td>Fisher Scientific</td>
			<td>A687</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Anti-Paxillin antibody [Y113]</td>
			<td>Abcam</td>
			<td>ab32084</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>BD Syringes only with Luer-Lok</td>
			<td>BD bioscience</td>
			<td>309657</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Bio-Gel P-2</td>
			<td>Bio-Rad</td>
			<td>1504118</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA) Protease-free Powder</td>
			<td>Fisher Scientific</td>
			<td>BP9703100</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Cos-7 cells</td>
			<td>ATCC</td>
			<td>CRL-1651</td>
			<td>Cell Culture, Passage numbers 11-20</td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, for 8 coverslips</td>
			<td>Fisher Scientific</td>
			<td>C14784</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>c(RGDfK(PEG-PEG)), PEG=8-amino-3,6-dioxaoctanoic acid</td>
			<td>Vivitide</td>
			<td>PCI-3696-PI</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Cy3B NHS ester</td>
			<td>GE Healthcare</td>
			<td>PA63101</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Dimethylformamide</td>
			<td>Millipore Sigma</td>
			<td>PHR1553</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>DMEM with L-Glutamine, 4.5g/L Glucose and Sodium Pyruvate</td>
			<td>Fisher Scientific</td>
			<td>MT10013C</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>Epidermal Growth Factor human EGF</td>
			<td>Millipore Sigma</td>
			<td>E9644</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>Ethanol, 200 proof (100%)</td>
			<td>Fisher Scientific</td>
			<td>22032601</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Falcon Standard Tissue Culture Dishes</td>
			<td>Fisher Scientific</td>
			<td>08-772E</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Fisher Scientific</td>
			<td>10-438-026</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>Flurobrite DMEM</td>
			<td>Fisher Scientific</td>
			<td>A1896701</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647</td>
			<td>Invitrogen</td>
			<td>A-21244</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Goat Serum</td>
			<td>Fisher Scientific</td>
			<td>16-210-064</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Hank&#8217;s balanced salts (HBSS)</td>
			<td>Fisher Scientific</td>
			<td>14-170-161</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>Horse Serum</td>
			<td>Fisher Scientific</td>
			<td>16050130</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Hydrogen Peroxide</td>
			<td>Fisher Scientific</td>
			<td>H325-500</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Nanosep MF centrifugal devices</td>
			<td>Pall laboratory</td>
			<td>ODM02C35</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>NHS-azide</td>
			<td>Fisher Scientific</td>
			<td>88902</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Nitrogen Gas Cylinder</td>
			<td>Airgas</td>
			<td></td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>No. 2 round glass coverslips - 25 mm</td>
			<td>VWR</td>
			<td>48382-085</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Parafilm M Laboratory Film</td>
			<td>Fisher Scientific</td>
			<td>13-374-10</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Paraformaldehyde 16%</td>
			<td>Fisher Scientific</td>
			<td>50-980-487</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>PBS, 1X</td>
			<td>Fisher Scientific</td>
			<td>21-030-CV</td>
			<td>Surface Preparation/Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (5,000 U/mL)</td>
			<td>Fisher Scientific</td>
			<td>15-070-063</td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>PYREX Low Form Griffin Beakers</td>
			<td>Fisher Scientific</td>
			<td>02-540G</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Sodium Ascorbate</td>
			<td>Fisher Scientific</td>
			<td>18-606-310</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate</td>
			<td>Fisher Scientific</td>
			<td>S233</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Fisher Scientific</td>
			<td>BP358</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Fisher Scientific</td>
			<td>434301</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Sulfo-NHS-LC-Biotin</td>
			<td>Fisher Scientific</td>
			<td>21335</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Sulfuric Acid</td>
			<td>Fisher Scientific</td>
			<td>A300-500</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>TEAA</td>
			<td>Fisher Scientific</td>
			<td>NC0322726</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Triethylamine</td>
			<td>Millipore Sigma</td>
			<td>471283</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Trifluoroacetic Acid (TFA)</td>
			<td>Fisher Scientific</td>
			<td>PI28901</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>THPTA</td>
			<td>Fisher Scientific</td>
			<td>NC1296293</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Triton X 100 Detergent Surfact Ams Solution</td>
			<td>Fisher Scientific</td>
			<td>85111</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Water, DNA Grade, DNASE, Protease free</td>
			<td>Fisher Scientific</td>
			<td>BP24701</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 &#956;m</td>
			<td>Agilent</td>
			<td>653950-702</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>High-performance liquid chromatography</td>
			<td>Agilent</td>
			<td>1100</td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Low Speed Orbital Shaker</td>
			<td>Fisher Scientific</td>
			<td>10-320-813</td>
			<td>Immunocytochemistry</td>
		</tr>
		<tr>
			<td>Matrix-assisted laser desorption/ ionization time-of-flight mass spectrometer (MALDI-TOF-MS)</td>
			<td>Voyager STR</td>
			<td></td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Molecular Probes Attofluor Cell Chamber</td>
			<td>Fisher Scientific</td>
			<td>A7816</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Nanodrop 2000 UV-Vis Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>Oligonucleotide Preparation</td>
		</tr>
		<tr>
			<td>Nikon Eclipse Ti inverted microscope</td>
			<td>pe Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Nikon Perfect Focus System</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>NIS Elements software</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>ORCA-Flash4.0 V3 Digital CMOS camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Quad band TIRF 405/488/561/647 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>RICM Cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>SOLA v-nIR Light Engine</td>
			<td>Lumencor</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Thermo Forma Steri Cycle 370 CO2 Incubator</td>
			<td>Fisher Scientific</td>
			<td></td>
			<td>Cell Culture</td>
		</tr>
		<tr>
			<td>VWR 75D Ultrasonic Cleaner</td>
			<td>VWR</td>
			<td>13710</td>
			<td>Surface Preparation</td>
		</tr>
		<tr>
			<td>Data Analysis</td>
			<td></td>
			<td></td>
			<td>Use</td>
		</tr>
		<tr>
			<td>Fiji (Image J)</td>
			<td></td>
			<td>https://imagej.net/software/fiji/downloads</td>
			<td>Quantitative Analysis</td>
		</tr>
		<tr>
			<td>Graph Pad Prism</td>
			<td>Graph Pad</td>
			<td></td>
			<td>Statistical Analysis</td>
		</tr>
		<tr>
			<td>Oligo name</td>
			<td>5&#39;modification/ 3&#39; modification</td>
			<td>Sequence (5&#39; to 3&#39;)</td>
			<td>Use</td>
		</tr>
		<tr>
			<td>Alkyne-21-BHQ2</td>
			<td>5&#39; Hexynyl/ 3&#39; BHQ_2</td>
			<td>GTGAAATACCGCACAGATGCG</td>
			<td>Top strand TGT probe</td>
		</tr>
		<tr>
			<td>56 pN TGT</td>
			<td>5&#39; Biosg/TTTTTT/iUniAmM</td>
			<td>CGCATCTGTGCGGTATTTCACTTT</td>
			<td>Bottom strand TGT probe</td>
		</tr>
		<tr>
			<td>12 pN TGT</td>
			<td>5&#39; AmMC6/ 3&#39; BioTEG</td>
			<td>CGCATCTGTGCGGTATTTCACTTT</td>
			<td>Bottom strand TGT probe</td>
		</tr>
	</tbody>
</table>

tension gauge tether probes for quantifying growth factor mediated integrin mechanics and adhesion

다세포 유기체는 부착, 증식, 이동 및 분화를 포함한 여러 기능을 조율하기 위해 주변 세포외 기질 (ECM)에서 막 수용체와 동족 리간드 간의 상호 작용에 의존합니다. 기계적 힘은 부착 수용체 인테그린을 통해 세포로부터 ECM 내의 리간드로 전달될 수 있다. 이들 세포-생성 힘의 양 및 공간 조직은 표피 성장 인자 수용체 (EGFR)를 포함하는 성장 인자 수용체에 의해 조절될 수 있다. 세포 역학의 누화 매개 변화를 정량화하고 초점 접착, 세포 형태 및 신호 전달과 관련시키는 데 현재 사용할 수있는 도구는 제한적입니다. 텐션 게이지 테더(TGT)로 알려진 DNA 기반 분자력 센서는 이러한 변화를 정량화하기 위해 사용되었습니다. TGT 프로브는 기저 힘 역치를 조절하고 회절 제한 공간 분해능에서 전체 부착성 세포 표면에 걸쳐 피코네왈톤 스케일 수용체 힘을 보고하는 능력에서 독특합니다. 여기에 사용된 TGT 프로브는 형광 신호를 생성하는 수용체-리간드 힘에 의한 DNA 듀플렉스의 비가역적 해리에 의존한다. 이것은 세포의 누적 인테그린 장력 (힘 역사)의 정량화를 허용한다. 이 기사는 인테그린 역학 및 접착 형성에 대한 EGFR의 영향을 연구하기 위해 TGT를 사용하는 프로토콜을 설명합니다. TGT 기계식 감지 플랫폼의 조립은 체계적으로 상세하며 힘, 초점 접착 및 셀 확산을 이미지화하는 절차가 간략하게 설명되어 있습니다. 전반적으로, 프로브의 근본적인 힘 역치, 부착 리간드 및 자극에 사용되는 성장 인자의 유형 및 농도를 조절하는 능력은 인테그린 매개 힘을 조절하는 다양한 막 수용체의 상호 작용을 연구하기위한 강력한 플랫폼이됩니다.

턴-온 TGT 프로브는 Cos-7 세포21에서 인테그린 매개 세포 역학 및 부착 형성에 대한 리간드 활성화 표피 성장 인자 수용체 (EGFR)의 효과를 조사하기 위해 사용되었다. 프로브는 리간드 사이클릭 Arg-Gly-Asp-Phe-Lys (cRGDfK)21,23,25,26을 제시하며, 이는 α5β1 인테그린 27,28,29,30에 대해 단지 작은 친화도를 갖는 인테그린 헤테로다이머 αVβ3에 대해 선택적이다. TGT 프로브는 비오틴-스트렙타비딘 결합을 사용하여 바닥 가닥을 통해 유리 커버슬립 표면 상에 기능화된 이중 DNA를 포함한다. 상부 가닥은 인테그린 리간드를 표시하고, 세포막 상의 동족 인테그린 수용체에 결합할 수 있다(도 5A). 하단 가닥은 형광단으로 표지되고 상단 가닥은 담금질로 표지되어 이중 TGT가 손상되지 않은 경우 최소한의 배경 형광을 유도합니다. 인테그린이 리간드에 결합하고 프로브의Ttol보다 큰 크기를 갖는 힘을 가하면, DNA 듀플렉스는 분리되어 형광을 유도한다(도 5A). 기계적 힘에 의해 파열되지 않은 TGT 프로브는 형광이 아닌 상태로 유지됩니다. 이러한 힘 선택적 턴온 형광은 회절-제한된 분해능에서 pN 스케일 인테그린-생성 힘의 체계적이고 정량적 매핑을 허용한다. TGT 프로브는 기판의 장력 임계값을 추가로 변조합니다.
여기에 나타낸 것은 56 pN의Ttol을 갖는 TGT 표면의 대표적인 예이다. Cos-7 세포를 EGF 자극 유무에 관계없이 이 TGT 표면에 플레이팅하여 리간드 자극을 통한 EGFR 활성화가 세포 부착 및 인테그린 역학에 미치는 영향을 연구하였다(도 5A, B). 세포를 60분 동안 TGT 표면 상에서 EGF와 함께 또는 없이 인큐베이션하고, 고정시키고, 면역-부착 분포(팍실린) 및 세포골격(F-actin)의 조직을 표시하기 위해 면역염색하였다(도 5B). 이어서, 세포를 RICM 및 TIRF 현미경을 사용하여 영상화하였다. RICM 이미지에서 명확하게 보이는 바와 같이, 56 pN TGT 표면 상의 Cos-7 세포 확산은 자극 없이 비하여 EGF 자극으로 유의하게 향상되었다. 이를 RICM 이미지로부터 세포-기판 접촉 영역의 크기를 측정함으로써 각 조건에서 50개의 세포에 대해 정량화하였다(도 5C). EGF를 이용한 자극은 Cos-7 세포가 그들의 자연적인 생리학적 환경에서 확산 및 성장한다는 것을 대표하는보다 원형 형태를 가져왔다 (도 5D). 개방 프로브로부터의 형광은 또한 장력 형광 이미지에서 관찰된 바와 같이 EGF 자극과 함께 더 높다. 개방 프로브의 수에 비례하는 개방 프로브의 통합 강도는 EGF 자극이 없는 것에 비해 훨씬 높았다(도 5B,E). 이것은 인테그린이Ttol (56pN)보다 큰 힘을 가한 모든 수용체-리간드 결합의 표현이다.
팍실린으로 염색한 결과, 초점 유착의 분포, 수, 성숙(크기) 및 조직이 또한 EGF 자극에 의해 영향을 받았다는 것을 보여주었다. EGF 자극된 세포에서의 초점 부착은 EGF 대조군이 없는 것에 비해 더 성숙하고 방사상 지향적인 것으로 나타났다. F-액틴 시토골격 조직은 또한 팔로이드인 염색에 의해 평가된 바와 같이 EGF 자극으로 강화되었다(도 5B). 이러한 정성적 평가는 두 치료 그룹의 이미지를 시각적으로 비교함으로써 이루어졌습니다. 초점 접착력의 정량적 분석은 수행 할 수 있지만이 프로토콜의 범위를 벗어납니다. 이 실험에서, TGT 표면은 세포 확산, 인테그린 역학 및 초점 부착 형성에 대한 EGFR 활성화의 효과를 체계적으로 상세히 기술하는 플랫폼을 제공하였다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63529/63529fig01.jpg"> 그림 1: TGT 표면 준비의 1일째에 대한 개략도 . (A) 커버슬립을 청소하십시오. (B) 커버슬립 표면을 에칭한다. (C) 피라냐 용액을 중화시킨다. (d) 반응성 아민기를 만들기 위해 표면을 실란화한다. (E) 커버슬립을 유기상으로 평형화시킨다. (F) 커버슬립을 불활성 가스로 건조시킵니다. (g) 표면 아민기의 비오티닐레이트. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63529/63529fig02.jpg"> 도 2: TGT 표면 제제의 제2일에 대한 개략도. (A) 커버슬립을 세척하고 건조시켜 전날로부터 잔류 비오틴을 제거한다. (b) 후속 단계에서 시약의 비특이적 결합을 방지하기 위해 BSA를 사용한 패시베이트. (C) 스트렙타비딘으로 커버슬립을 기능화한다. (d) 프로브를 써모 사이클러에서 혼성화한다. (e) 합성된 프로브를 커버슬립(F)에 적용하고 커버슬립을 세포 이미징 챔버에 조립한다. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63529/63529fig03.jpg"> 그림 3: 전체 실험 설정에 걸친 광범위한 단계를 강조하는 일반적인 워크플로우 . (A) EGF 자극 유무에 관계없이 기초 배지(DMEM)에서 TGT 표면에 세포 분리 및 도금을 위한 프로세스. (b) TGT 표면 상의 부착 및 확산 후 고정 및 면역염색에 관여하는 단계의 흐름도. (c) 염색 후, 세포는 RICM 및 TIRF 현미경으로 거꾸로 된 형광 현미경 상에서 이미지화된다. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63529/63529fig04.jpg"> 그림 4: 데이터 처리 및 정량 분석의 예. (A) RICM 및 장력 이미지 정량화를 위해 피지(ImageJ)에 사용된 분석 파이프라인의 단계별 분석. (b) 상기 파이프라인을 이용하여 분석된 세포 형태학적 결과에 대한 대표적인 예. (c) 상기 언급된 파이프라인을 사용하여 분석된 세포 기계적 결과에 대한 대표적인 예. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/63529/63529fig05.jpg"> 도 5: TGT 실험으로부터의 예시 데이터. (A) 세포막-TGT 표면 계면에서의 접촉 영역을 강조하는 도면. 인셋 프로젝트는 EGF 자극 없이 (오른쪽) 또는 (왼쪽) 동족 리간드 cRGDfK와 상호작용하는 것을 통합한다. (b) 56 pN TGT 표면 상에 확산된 Cos-7 세포의 RICM 및 TIRF 이미지. 이미지는 EGF 자극 유무에 관계없이 60분 후 도금 후 얻어진다. 개별 RICM(획득된 대로), 인테그린 장력(그레이스케일), 팍실린(오렌지색 핫) 및 F-액틴(청록색) 이미지가 두 자극 조건 모두에 대한 오버레이로 표시됩니다. 스케일 바: 10 μm. 인셋은 팍실린으로 표시된 부착 형성 부위에서 생성된 인테그린 장력의 공동 국소화와 액틴으로 표시된 기본 세포골격 조직의 공동 국소화를 자세히 설명하는 확대된 ROI(관심 영역)를 강조합니다. 스케일 바: 5 μm. (C-E) EGF 자극이 있거나 없는 Cos-7 세포에 대한 확산 영역(RICM 세포 발자국)(C), 원형도(D), 및 통합 장력(E)에 대한 산점도. 막대는 평균 ± s.d.를 나타냅니다. 그룹 간의 차이는 스튜던트 t-검정으로 통계적으로 평가되었다. P < 0.0001. n = 세 개의 독립적인 실험에 걸쳐 50개의 세포. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig05large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/63529/63529fig06.jpg"> 그림 6: 서로 다른 가능한 문제가 있는 TGT 표면 예제. (A) 세포 부착 전에 담금질된 조립된 프로브와 함께 이상적인 TGT 표면의 장력 및 RICM 이미지. (b) TGT 프로브가 상부 가닥(quencher)이 결여된 TGT 표면의 장력 및 RICM 이미지. 장력 이미지는 바닥 가닥에서 열린 형광단으로부터의 균일한 형광을 보여준다. (c) 이상적인 TGT 표면 상에 확산된 세포에 대한 장력 및 RICM 이미지. (d) 제한된 패시베이션 또는 분해된 프로브를 갖는 저조하게 만들어진 TGT 표면 상에 확산된 세포에 대한 장력 및 RICM 이미지. (e) cRGDfK-인테그린 상호작용을 나타내는 cRGDfK 리간드로 이상적인 표면에 플레이팅된 세포에 대한 장력, RICM 및 브라이트필드 이미지는 세포 부착 및 장력 생성에 필수적이다. (f) TGT 상에 cRGDfK 리간드가 없는 표면 상에 플레이팅된 세포에 대한 장력, RICM, 및 브라이트필드 이미지. 세포가 밝은 필드 이미지에서 보이는 동안, 세포 부착 또는 생성 된 인테그린 장력은 관찰되지 않습니다. 스케일 바: 10 μm. <a href="https://www.jove.com/files/ftp_upload/63529/63529fig06large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Tension Gauge Tether Probes for Quantifying Growth Factor Mediated Integrin Mechanics and Adhesion at JoVE.com

Tension Gauge Tether Probes for Quantifying Growth Factor Mediated Integrin Mechanics and Adhesion

TGT 표면은 성장 인자 - 인테그린 누화를 연구하는 혁신적인 플랫폼입니다. 유연한 프로브 설계, 부착 리간드의 특이성, 자극 조건의 정밀한 조절은 EGFR-인테그린 인터플레이의 강력한 정량적 평가를 가능하게 한다. 결과는 EGFR을 '메카노-조직자' 튜닝 인테그린 역학으로 강조하여 초점 접착 어셈블리 및 세포 확산에 영향을 미칩니다.

성장 인자 매개 인테그린 역학 및 접착력을 정량화하기 위한 장력 게이지 테더 프로브

Multicellular organisms rely on interactions between membrane receptors and cognate ligands in the surrounding extracellular matrix (ECM) to orchestrate ...

이 프로토콜은 EGFR-인테그린 누화를 연구하는 데 사용되는 TGT 센서 플랫폼의 단순성과 세포 기계적 힘에 미치는 영향 때문에 중요합니다. 라오는 세포 역학의 EGF 의존성 조절을 조사하기 위해 개략적으로 설명했다. 상기 프로토콜은 상이한 리간드, 세포 유형, 자극 패러다임에 대해 적응가능하고, 다양한 장력 역치의 TGTs와 결합될 수 있다.표면 합성은 처음에는 위협적으로 보일 수 있습니다. 핵심은 시약 준비 및 계산을위한 체크리스트를 사용하여 복잡한 단계를 정확하게 수행 할 수 있도록 준비하고 조직하는 것입니다. 첫날에는 최대 여덟 개의 25mm 유리 커버 슬립을 폴리테트라플루오로에틸렌 랙에 넣습니다.랙을 40밀리리터의 200 방지 에탄올이 들어있는 50밀리리터 붕규산 비커에 넣으십시오. 실온에서 10 ~ 15 분 동안 35 킬로헤르츠의 작동 주파수에서 초음파 처리. 파이렉스 비이커에서 황산과 과산화수소를 3:1 비율로 혼합하고 유리 피펫으로 교반하여 갓 제조한 피라냐 용액 40밀리리터를 50밀리리터 비이커에 채운다.커버 슬립 랙을 비이커로 옮기고 흄 후드에서 실온에서 30분 동안 인큐베이션하여 커버 슬립 표면을 에칭한다. 에칭 후 커버 슬립 랙을 핀셋이 있는 초순수로 비이커로 옮깁니다. 커버 슬립을 육안으로 검사하여 유리 표면에 패턴이나 먼지 입자가 없어 표면이 깨끗하게 보이는지 확인합니다.커버 슬립 랙을 200 프루프 에탄올로 비이커로 옮기고 15 초 동안 두 번 세척하여 표면을 유기 용매로 평형화시킵니다. 커버 슬립 랙을 실온에서 한 시간 동안 3%APTES가 있는 200 방지 에탄올 용액으로 옮겨 커버 슬립을 실란화합니다. 랙을 200 방지 에탄올 용액으로 깨끗한 비이커에 담그십시오.낮은 출구 압력의 질소 가스를 사용하여 커버 슬립을 건조시킵니다. 커버 슬립을 10 센티미터 폴리스티렌 접시에 넣고 그 안에 파라핀 필름 조각을 평평하게 놓습니다. DMSO에 밀리리터 NHS-비오틴 용액 당 두 밀리그램의 100 마이크로 리터를 파라핀 필름에 놓인 네 개의 커버 슬립에 첨가하십시오.다른 네 개의 커버 슬립이 위에 있는 샌드위치를 놓고, 두 개의 커버 슬립이 서로 향하도록 하고 그 사이에 기능화 솔루션을 장착합니다. 둘째 날에는 섭씨 네 도에서 접시를 꺼내고 샌드위치 커버 슬립을 분리하십시오. 샌드위치를 분리하는 동안 기능화 된 표면을 긁거나 손상시키지 마십시오.그런 다음 덮개 슬립을 코팅된 표면이 서로 향하도록 랙에 맞춥니다. 질소 가스로 건조하십시오. 커버 슬립을 그 안에 파라핀 필름이있는 새 접시에 넣으십시오.800 마이크로리터의 0.1%소 혈청 알부민을 1X PBS에 첨가하여 각 커버슬립에 첨가한다. 커버 슬립을 실온에서 30분 동안 인큐베이션하여 표면을 패시베이션하고 후속 기능화 시약의 비특이적 결합을 차단한다. 커버 슬립을 기능화하려면 실온에서 45 ~ 60 분 동안 1X PBS에 스트렙타비딘 밀리리터 당 1 마이크로 그램의 800 마이크로 리터를 첨가하십시오.TGT 프로브를 열순환기를 사용하여 PCR 튜브에 조립한다. 인큐베이션 후, 커버 슬립을 1X PBS로 세 번 세척한다. 사전 조립된 TGT 프로브 100마이크로리터를 네 개의 커버 슬립에 추가하고 기능화된 면이 프로브를 향하도록 나머지 네 개의 커버 슬립을 사용하여 샌드위치를 만듭니다.알루미늄 호일로 덮으십시오. 인큐베이션 후, 샌드위치를 분리하고 커버 슬립을 1X PBS로 세 번 세척한다. 커버 슬립을 미리 청소한 이미징 챔버에 조심스럽게 조립하십시오.표피 성장 인자 자극이 Cos-7 역학, 부착 및 세포 확산에 미치는 영향을 조사하기 위해 Cos-7 세포를 0.05% 트립신-EDTA로 2분 동안 트립신화합니다. HBSS로 세척하고 800 G에서 5분 동안 원심분리하여 트립신을 중화시킨다. 플레이트 세포는 EGF 없이 밀리리터 EGF 또는 DMEM 당 50 나노그램으로 보충된 DMEM에서 조립된 TGT 표면 상의 40, 000 세포의 밀도로 세포이다.인큐베이션 후, 세포를 1X PBS로 세 번 세척하였다. 실온에서 12 분 동안 4 % 파라 포름 알데히드 2 밀리리터로 고정하십시오. 커버 슬립을 실온에서 5분 간격으로 1X PBS로 다섯 번 세척한다.임의로, 커버슬립을 섭씨 37도에서 30분 동안 1X PBS 중의 50-밀리몰 염화암모늄으로 인큐베이션한다. 버퍼 A를 추가하고 커버 슬립이 있는 이미징 챔버를 습도 용기에 넣습니다. 섭씨 37도에서 30분 동안 배양하여 세포를 차단하고 투과시킨다.1차 항-팍실린 항체를 블로킹 완충액에서 1:250 희석액으로 희석한다. 커버 슬립 당 200 마이크로리터의 일차 항체 용액과 함께 섭씨 37도에서 두 시간 동안 인큐베이션한다. 세포를 1:800 희석액에서 이접합된 염소/항토끼 이차 항체의 혼합물과 커버 슬립당 블로킹 버퍼 200마이크로리터의 1:400 희석액에서 디컨쥬게이션된 팔로이드인의 혼합물과 동시에 라벨링한다.표면을 5분 간격으로 1X PBS로 다섯 번 세척한다. 시작하려면 목표에 오일을 넣고 샘플 챔버의 커버 슬립 바닥을 청소하고 샘플을 무대에 놓습니다. 세포에 집중하고 완벽한 초점을 맞춥니다.에피 조명 조리개 다이어프램을 닫고 가운데에 배치하여 RICM을 정렬합니다. 488나노미터 레이저를 실내의 천장에 있는 작은 지점에 초점을 맞추고 임계 각도를 지나갈 때까지 입사각을 높이면서 라이브 모드에서 카메라의 형광을 모니터링합니다. 임계 각도를 초과할 때 배경 형광의 급격한 감소와 단일 초점 평면을 관찰하십시오.RICM을 사용하여 카메라의 라이브 모드를 사용하여 이미징할 셀을 식별합니다. 488나노미터 여기, 561나노미터 여기에서의 인테그린 장력, 647나노미터 여기에서 팍실린의 RICM 및 TIRF 이미지를 획득한다. 200밀리초의 노출 시간을 사용하여 순차적으로 이미지를 가져옵니다.커버 슬립을 변경하고 초점을 맞추고 반복하십시오. Cos-7 세포를 인테그린 역학에 대한 리간드 자극과 함께 EGFR 활성화가 미치는 영향을 연구하기 위해 EGF 자극 유무에 관계없이 이러한 TGT 표면 상에 플레이팅하였다. 인테그린이 리간드에 결합하고 프로브의 장력 역치 총합보다 큰 힘을 가하면 DNA 듀플렉스가 분리되어 형광을 유발합니다.기계적 힘이 파열되지 않은 TGT 프로브는 형광이 아닌 상태로 유지됩니다. 세포를 TGT 표면 상에서 EGF와 함께 또는 없이 60분 동안 인큐베이션하고, 고정시키고, 면역염색하여 세포골격의 초점 부착 분포 및 조직을 표시하였다. RICM 이미지에서, 56-피코네웬톤 TGT 표면 상의 Cos-7 세포 확산은 자극 없이 비하여 EGF 자극으로 유의하게 향상되었다.EGF에 의한 자극은 Cos-7 세포 확산 및 성장을 나타내는 보다 원형 형태를 가져왔다. 개방 프로브로부터의 형광은 또한 장력 형광 이미지에서 관찰된 바와 같이 EGF 자극과 함께 더 높다. 개방 프로브의 수에 비례하는 개방 프로브의 통합 강도는 자극이 없는 경우보다 EGF 자극으로 훨씬 더 높았다.커버 슬립의 방향을 항상 기억하고 기능화 된 표면을 위쪽으로 향하게하십시오. 샌드위치를 분리 할 때 표면이 긁히거나 손상되지 않도록 부드럽게하십시오. 표면 합성 후, 세포 부착 또는 기계적 형질도입을 조절하는 세포질 단백질을 프로브할 수 있다.이를 통해 원형질막에서 세포 역학을 조율하는 데 관여하는 하류 신호 전달 분자를 확인할 수 있습니다.

Research

JoVE Journal

Biology

Assay for Adhesion and Agar Invasion in S. cerevisiae

S. cerevisiae의의 접착 및 아가르 침략을위한 분석

Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, ...

연구

생물학

Growth Factor-Coated Bead Placement on Dorsal Forebrain Explants

도설 Forebrain의 Explants에 대한 성장 인자 - 코팅 비드 배정

Placing Growth Factor-Coated Beads on Early Stage Chicken Embryos

초기 치킨 태아의 성장 팩터 - 코팅 비즈 배치

The neural tube expresses many proteins in specific spatiotemporal patterns during development.   These proteins have been shown to be critical for cell ...

Preparing T Cell Growth Factor from Rat Splenocytes

랫 Splenocytes에서 T 세포 성장 인자 준비

Maintenance of antigen-specific T cell lines or clones in culture requires rounds of antigen-induced activation separated by phases of cell expansion 1,2. ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

Drosophila에서 Visual과 강한 중재 플라이트 컨트롤을 맡은 이후로 자기 테더 시스템

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

성장 팩터 Progranulin와 상호 작용하는 단백질을 식별하기 위해 수정된 효모 - 2 하이브리드 시스템

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

Robust 3D DNA FISH Using Directly Labeled Probes

직접 레이블이 프로브를 사용하여 강력한 3D DNA 물고기

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

Kinematic Analysis of Cell Division and Expansion: Quantifying the Cellular Basis of Growth and Sampling Developmental Zones in Zea mays Leaves

Kinematic Analysis of Cell Division and Expansion: Quantifying the Cellular Basis of Growth and Sampling Developmental Zones in Zea mays Leaves

세포 분열 및 확장의 운동 학적 분석 : 성장과 샘플링 발달 영역의 세포 기초의 정량화<em&gt; ZEA 메이스</em&gt; 잎

Growth analyses are often used in plant science to investigate contrasting genotypes and the effect of environmental conditions. The cellular aspect of ...

Analyzing Cell Surface Adhesion Remodeling in Response to Mechanical Tension Using Magnetic Beads

자석 구슬을 사용하여 기계 인장에 대한 응답으로 세포 표면 접착 리모델링 분석

Mechanosensitive cell surface adhesion complexes allow cells to sense the mechanical properties of their surroundings. Recent studies have identified both ...

Molecular Analysis of Endothelial-mesenchymal Transition Induced by Transforming Growth Factor-&#946; Signaling

Molecular Analysis of Endothelial-mesenchymal Transition Induced by Transforming Growth Factor-ÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â² Signaling

내 피 엽 전환 성장 인자-β 신호 변환에 의해 유도 된의 분자 분석

Phenotypic plasticity of endothelial cells underlies cardiovascular system development, cardiovascular diseases, and various conditions associated with ...