Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

تم تمويل هذا البحث من قبل المؤسسة الوطنية للعلوم الطبيعية في الصين (31870637 ، 31200487) وبتمويل مشترك من خطة تشجيانغ الرئيسية للبحوث (2019C02024 ، LGN22C160004).

تمت الموافقة على الدراسة من قبل مجلس التجارب على الحيوانات بجامعة تشجيانغ الزراعية والحرجية. تم استخراج B. xylophilus المعزول NXY61 في الأصل من صنوبر ماسونيانا مريض في منطقة نينغبو بمقاطعة تشجيانغ ، الصين11.
1. استنساخ الجينات
ملاحظة: را...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

على الرغم من أن تاريخ الحياة والبيئة الطفيلية ل B. xylophilus تختلف عن تلك الموجودة في الديدان الخيطية الأخرى ، إلا أنه كان هناك بحث محدود حول التسبب الجزيئي لهذا العامل الممرض النباتي. على الرغم من التقدم الكبير المحرز في تطبيق تقنية تحرير الجينوم CRISPR / Cas9 في C. elegans والديدان الخيطية ال?...

تشكل الديدان الخيطية الطفيلية النباتية (PPNs) تهديدا مستمرا للأمن الغذائي والنظم الإيكولوجية للغابات. فهي تسبب خسائر اقتصادية تقدر بنحو 100 مليار دولار أمريكي كل عام1 ، وأكثرها إشكالية هي في المقام الأول الديدان الخيطية ذات العقدة الجذرية ، والديدان الخيطية الكيسية ، والديدان الخيطية من خشب الصنوبر. الديدان الخيطية من خشب الصنوبر ، Bursaphelenchus xylophilus ، هي نيماتودا مهاجرة ، طفيليات داخلية ، وهي الممرض السببي لمرض ذبول الصنوبر2. وقد تسبب في ضرر كبير لغابات الصنوبر في جميع أنحاء العالم3. باستخدام مصطلحات Van Megen et al.4 ، B. xylophilus هو عضو في Parasitaphelenchidae وينتمي إلى clade 10 ، في حين أن معظم الطفيليات النباتية الرئيسية الأخرى تنتمي إلى clade 12.
كطفيلي نباتي مستقل ومتطور مؤخرا ، يعد B. xylophilus نموذجا جذابا للدراسات المقارنة. وحتى الآن، أجريت بحوث كبيرة على الديدان الخيطية ذات عقدة الجذر والديدان الخيطية الكيسية التي تنتمي إلى الفصيلة 12، وهي طفيليات داخلية ملزمة ومستقرة وهي من أكثر الديدان الخيطية التي تمت دراستها بشكل مكثف. ومع ذلك ، فإن إجراء المزيد من الأبحاث في هذا المجال المهم يأتي مع تحد كبير: وظيفة جينات التطفل هي عنق الزجاجة البحثي. تشمل الدراسات الوظيفية عموما التعبير خارج الرحم وتجارب الضربة القاضية / الخروج ولكنها تعتمد على بروتوكولات التحول الجيني الفعالة للديدان الخيطية. ونتيجة لذلك ، يعتمد علم الوراثة العكسي في PPNs بشكل حصري تقريبا على إسكات الجينات بواسطة RNAi.
RNAi ، وهي آلية موجودة على نطاق واسع في الخلايا حقيقية النواة ، تسكت التعبير الجيني عن طريق إدخال الحمض النووي الريبي المزدوج (dsRNA)5. حتى الآن ، تم العثور على آلية إسكات الجينات بعد النسخ التي يسببها dsRNA في جميع حقيقيات النوى المدروسة ، وتطورت تقنية RNAi ، كأداة لأبحاث الجينوم الوظيفي والتطبيقات الأخرى ، بسرعة في العديد من الكائنات الحية. منذ اكتشاف آلية RNAi في Caenorhabditis elegans في عام 19986 ، أصبحت تقنيات RNAi طرقا فعالة لتحديد الوظيفة الجينية للديدان الخيطية ويتم اقتراحها كطريقة جديدة للسيطرة الفعالة على الديدان الخيطية المسببة للأمراض7.
RNAi هو من الناحية الفنية سهلة نقع الأحداث في dsRNA يمكن أن يكفي. ومع ذلك ، فإن فعالية هذا النهج وقابليته للتكرار تختلف اختلافا كبيرا مع أنواع الديدان الخيطية والجين المستهدف8. تم التحقيق في إسكات 20 جينا مشاركا في مسارات الحمض النووي الريبي للديدان الخيطية ذات عقدة الجذر ، Meloidogyne incognita ، باستخدام dsRNAs الطويلة كمحفزات ، مما أدى إلى استجابات متنوعة ، بما في ذلك زيادة وعدم حدوث تغيير في التعبير عن بعض الجينات9. تظهر هذه النتائج أن الجينات المستهدفة قد تستجيب لضربة RNAi القاضية بشكل مختلف ، مما يتطلب تقييما شاملا لمدى ملاءمتها كأهداف للتحكم في الديدان الخيطية عبر RNAi. ومع ذلك ، هناك حاليا ندرة في البحوث حول البيولوجيا التنموية والإنجابية ل B. xylophilus.
استمرارا للعمل السابق10،11،12،13 ، نصف هنا بروتوكولا لتطبيق RNAi لدراسة وظيفة جين ppm-1 من B. xylophilus ، بما في ذلك تخليق dsRNA ، ونقع المنشطات العصبية الاصطناعية ، والكشف الكمي عن تفاعل البوليميراز المتسلسل (qPCR). من المرجح أن تساهم المعرفة المكتسبة من هذا النهج التجريبي بشكل ملحوظ في فهم النظم البيولوجية الأساسية ومنع مرض ذبول الصنوبر.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

الديدان الخيطية من خشب الصنوبر ، Bursaphelenchus xylophilus ، هي واحدة من أكثر الأنواع الغازية تدميرا في جميع أنحاء العالم ، مما تسبب في ذبول أشجار الصنوبر وموتها في نهاية المطاف. على الرغم من الاعتراف بأهميتها الاقتصادية والبيئية ، فقد كان من المستحيل حتى الآن دراسة الوظائف الجينية التفصيلية للديدان الخيطية الطفيلية النباتية (PPNs) باستخدام علم الوراثة التقليدي الأمامي والطرق المعدلة وراثيا. ومع ذلك ، كتقنية علم الوراثة العكسية ، يسهل تداخل الحمض النووي الريبي (RNAi) دراسة الجينات الوظيفية للديدان الخيطية ، بما في ذلك B. xylophilus. 
تحدد هذه الورقة بروتوكولا جديدا للحمض النووي الريبي للجين ppm-1 في B. xylophilus ، والذي تم الإبلاغ عنه للعب أدوار حاسمة في تطوير وتكاثر الديدان الخيطية المسببة للأمراض الأخرى. بالنسبة ل RNAi ، تم ربط مروج T7 بطرف 5 ′ للجزء المستهدف بواسطة تفاعل البوليميراز المتسلسل (PCR) ، وتم تصنيع الحمض النووي الريبي المزدوج (dsRNA) عن طريق النسخ في المختبر . في وقت لاحق ، تم إنجاز تسليم dsRNA عن طريق نقع الديدان الخيطية في محلول dsRNA مختلطة مع المنشطات العصبية الاصطناعية. تم غسل الأحداث المتزامنة من B. xylophilus (حوالي 20000 فرد) ونقعها في dsRNA (0.8 ميكروغرام / مل) في المخزن المؤقت للنقع لمدة 24 ساعة في الظلام عند 25 درجة مئوية.
تم وضع نفس الكمية من الديدان الخيطية في مخزن مؤقت للنقع بدون dsRNA كعنصر تحكم. وفي الوقت نفسه ، تم وضع كمية أخرى مماثلة من الديدان الخيطية في مخزن مؤقت للنقع مع جين بروتين الفلورسنت الأخضر (gfp) dsRNA كعنصر تحكم. بعد النقع ، تم تحديد مستوى التعبير عن النصوص المستهدفة باستخدام تفاعل البوليميراز المتسلسل الكمي في الوقت الفعلي. ثم تم تأكيد آثار الحمض النووي الريبي باستخدام الملاحظة المجهرية للأنماط الظاهرية ومقارنة حجم جسم البالغين بين المجموعات. يمكن أن يساعد البروتوكول الحالي في تطوير الأبحاث لفهم وظائف جينات B. xylophilus وغيرها من الديدان الخيطية الطفيلية بشكل أفضل نحو تطوير استراتيجيات التحكم من خلال الهندسة الوراثية.

تحليل تعبير ppm-1 عن B. xylophilus بعد RNAi كان مستوى التعبير النسبي لجين ppm-1 من B. xylophilus المنقوع مع GFP dsRNA والمنقوع بالجين المستهدف dsRNA 0.92 و 0.52 ، على التوالي (تم تعيين مستوى التعبير الجيني ppm-1 لمجموعة التحكم المعالجة ب ddH2O إلى 1) (<st...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

هنا ، نقدم طريقة نقع مفصلة لتداخل الحمض النووي الريبي في Bursaphelenchus xylophilus لتسهيل دراسة وظائف الجينات.

تطبيق تداخل الحمض النووي الريبي في نيماتودا خشب الصنوبر ، Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

أصبح الحمض النووي الريبي طريقة فعالة لتحديد وظيفة الجينات في الديدان الخيطية ويتم اقتراحه كطريقة جديدة للسيطرة الفعالة على الديدان الخيطية المسببة للأمراض. RNAi هو نقع الديدان الخيطية في dsRNA يمكن أن يكفي لهذا الإجراء. للبدء ، اجمع الديدان الخيطية بطريقة قمع Baermann.لهذا ، ضع أنبوبا مطاطيا مثبتا أسفل قمع وضع طبقتين من ورق الترشيح في فم القمع. انقل ثقافات Botrytis cinerea الفطرية إلى القمع وأضف الماء لغمر الحصيرة الفطرية. عندما يتم جمع الديدان الخيطية ، أضف 500 ميكرولتر من كاشف الاستخراج و 100 ميكرولتر من الخرز المغناطيسي إلى أنبوب طرد مركزي بملليلترين.استنشاق 20 ميكرولتر من الديدان الخيطية وطحن العينات في 9،000 × غرام لمدة 30 ثانية. احتضان لمدة خمس دقائق وأجهزة الطرد المركزي في 12،000 × غرام لمدة 10 دقائق في أربع درجات مئوية. انقل السوبرنات إلى أنبوب طرد مركزي جديد.أضف 100 ميكرولتر من الكلوروفورم واخلطها عن طريق عكس الأنبوب عدة مرات. احتضنها لمدة ثلاث دقائق ثم قم بجهاز طرد مركزي عند 12،000 × g لمدة 10 دقائق عند أربع درجات مئوية. مرة أخرى ، انقل السوبرنات إلى أنبوب طرد مركزي جديد.أضف 250 ميكرولتر من كحول الأيزوبروبيل والدوامة بقوة. جهاز طرد مركزي في 12،000 × غرام لمدة 10 دقائق ودوامة. تخلص من السوبر ناتانت وأضف 500 ميكرولتر من 75٪ من الإيثانول لغسل الحمض النووي الريبي.دوامة العينة متبوعة بالطرد المركزي عند 12،000 × غرام لمدة خمس دقائق عند أربع درجات مئوية. جفف حبيبة الحمض النووي الريبي في الهواء لمدة خمس دقائق وأعد تعليقها في 30 ميكرولتر من الماء الخالي من RNase. احسب تركيز الحمض النووي الريبي باستخدام هذه الصيغة واحسب نسبة A260 إلى A280.بعد ذلك ، استخدم زوجا من الاشعال لتضخيم تسلسل الترميز الجزئي لجين BX ppm-1 من B.xylophilus. ثم قم باستنساخ تسلسل جين واحد ppm-1 في ناقل pGEM-T Easy يحتوي على مروج T7. استرجع الجزء الجيني الطويل ppm-1 للزوج الأساسي 894 باستخدام البلازميد المستنسخ كقالب ل pcr.ثم استخدم مجموعة نسخ في المختبر لتوليف dsRNA. تحليل جودة dsRNA باستخدام مقياس الطيف الضوئي وتصور المنتجات على هلام الأغاروز 1٪. أضف أربعة ميكرولترات من المخزن المؤقت للنقع 5X وقم بتكوين الحجم إلى 20 ميكرولتر بالماء المقطر المزدوج للحصول على تركيز الحمض النووي الريبي النهائي البالغ 0.8 ميكروغرام لكل ملليلتر.ثم ضع الديدان الخيطية في الطبق لمدة 30 دقيقة وانتظر حتى يلتصق البيض بالقاع. قم بإزالة الماء والديدان الخيطية بعناية دون إزعاج البيض حتى يبقى البيض فقط في الطبق. فقس البيض الذي تم جمعه في الظلام عند 25 درجة مئوية لمدة 24 ساعة للحصول على يرقات J2.جمع اليرقات في أنبوب وغسلها ثلاث مرات بالماء المقطر المزدوج. ثم ، انقل اليرقات إلى الأنبوب الذي يحتوي على محلول dsRNA. لهذا ، أضف محلول ريسورسينول للحصول على محلول 1٪.ضع اليرقات على طاولة اهتزاز لضمان امتصاص كاف ل dsRNA في اليرقات. للحصول على عناصر التحكم ، انقع نفس الكمية من الديدان الخيطية في المخزن المؤقت للنقع بدون مسبار dsRNA أو باستخدام مسبار GFP dsRNA. قم بإجراء qPCR باستخدام جينات actB و tbb-2 كمراجع داخلية لتقييم التغيرات في مستوى التعبير الجيني.استخدم طريقة دلتا دلتا سي تي لتقدير مستوى التعبير الجيني النسبي من منحنى الذوبان وقيمة Ct. بعد RNAi ، قم بزراعة يرقات J2 حتى سن البلوغ على مروج Botrytis cinerea على ألواح PDA. اجمع البالغين باستخدام طريقة قمع Baermann كما هو موضح في القسم الأول.احصل على صور للديدان الخيطية البالغة تحت المجهر واستخدم برنامج ImageJ لقياس طول الجسم ل 50 من الذكور و 50 من الإناث من الديدان الخيطية. تحليل البيانات عن طريق حساب المتوسط والانحراف المعياري لكل عينة. تطبيق اختبار t للطالب لمقارنة وسائل العينات من المجموعات المختلفة.أشار تحليل التعبير الجيني النسبي بعد RNAi إلى أن ppm-1 dsRNA يمكن أن يمنع بشكل فعال التعبير عن جين واحد من B.Xylophilus. في حين أن GFP dsRNA الخارجي لم يكن له أي تأثير على تعبير ppm-1. بعد الحمض النووي الريبي ، انخفض حجم البالغين بشكل ملحوظ على الرغم من بلوغهم النضج الجنسي مما أدى إلى النمط الظاهري المتحور الصغير حجم الجسم.كان متوسط طول جسم الإناث والذكور المتحورين 544 و 526 ميكرومتر مقارنة ب 971 و 912 ميكرومتر للمجموعة الضابطة أهم شيء هو نقل الديدان الخيطية إلى محلول الحمض النووي الريبي المزدوج الخيط وإضافة كاشف آخر لتحفيز الديدان الخيطية على التغذية. هذه الطريقة مناسبة لفحص الجينات على نطاق واسع وتستخدم عادة في أبحاث الخلايا. دراسة الوظيفة الجينية ل B.Xylophilus بهذه الطريقة لها قيمة توجيهية للمكافحة البيولوجية ل B.Xylophilus.

Research

JoVE Journal

Biology

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

في المختبر، والسد النسخ من مرنا luciferase المراسل Gaussia تلاه ترنسفكأيشن الخلية هيلا

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

لونين عزل من قبل تنقية الحمض النووي الريبي (السقسقة)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

باستخدام الحمض النووي الريبي التي تتوسط استراتيجية التغذية التدخل للكشف عن الجينات المسؤولة عن تنظيم حجم الجسم في نيماتودا<em&gt; C. ايليجانس</em

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

التدخل RNA اليرقات في الأحمر خنفساء الدقيق،<em&gt; كونفيوسم كاستانيم</em

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

المراقبة والقياس الكمي للسلوك التزاوج في غابة الصنوبر نيماتودا،<em&gt; Bursaphelenchus xylophilus</em

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

الاستخدام العملي لتدخل الجيش الملكي النيبالي: التسليم الشفوي من الحمض النووي الريبي مزدوج-الذين تقطعت بهم السبل في ناقلات الحويصلية للصراصير

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

تشيب-Seq: التنميط Epigenome الخلية-نوع معين

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

تحديد الربط البديل والبولي أدينيل في بيانات RNA-seq

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...