Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Cette recherche a été financée par la Fondation nationale des sciences naturelles de Chine (31870637, 31200487) et cofinancée par le Zhejiang Key Research Plan (2019C02024, LGN22C160004).

L’étude a été approuvée par le conseil pour l’expérimentation animale de l’Université agricole et forestière du Zhejiang. L’isolat NXY61 de B. xylophilus a été extrait à l’origine d’un Pinus massoniana malade dans la région de Ningbo de la province du Zhejiang, en Chine11.
1. Clonage génétique
REMARQUE : Consultez le tableau des matériaux pour plus de détails sur les...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

Bien que le cycle biologique et l’environnement parasitaire de B. xylophilus soient différents de ceux d’autres nématodes, il y a eu peu de recherches sur la pathogenèse moléculaire de ce phytopathogène. Malgré de grands progrès réalisés dans l’application de la technologie d’édition du génome CRISPR/Cas9 chez C. elegans et d’autres nématodes, seule la technologie ARNi appliquée à B. xylophilus a été publiée à ce jour17. L’ARNi est l’un de...

Les nématodes phytoparasites (NPP) constituent une menace permanente pour la sécurité alimentaire et les écosystèmes forestiers. Ils causent environ 100 milliards USD de pertes économiques chaque année1, dont les plus problématiques sont principalement les nématodes à galles, les nématodes à kystes et les nématodes du pin. Le nématode du pin, Bursaphelenchus xylophilus, est un nématode endoparasite migrateur, qui est l’agent pathogène causal de la maladie du flétrissement du pin2. Il a causé de grands dommages aux forêts de pins dans le mondeentier 3. En utilisant la terminologie de Van Megen et al.4, B. xylophilus est un membre des Parasitaphelenchidae et appartient au clade 10, alors que la plupart des autres parasites végétaux majeurs appartiennent au clade 12.
En tant que parasite végétal indépendant et récemment évolué, B. xylophilus est un modèle attrayant pour les études comparatives. À ce jour, il y a eu des recherches substantielles sur les nématodes à galles et les nématodes à kystes appartenant au clade 12, qui sont des endoparasites sédentaires obligatoires et qui sont parmi les nématodes les plus étudiés. Cependant, mener d’autres recherches dans ce domaine important s’accompagne d’un défi majeur: la fonction des gènes du parasitisme est un goulot d’étranglement de la recherche. Les études fonctionnelles comprennent généralement des expériences d’expression ectopique et de knockdown/out, mais reposent sur des protocoles de transformation génétique efficaces pour le nématode. En conséquence, la génétique inverse dans les NPP repose presque exclusivement sur le silençage génique par l’ARNi.
L’ARNi, un mécanisme largement présent dans les cellules eucaryotes, réduit au silence l’expression des gènes en introduisant de l’ARN double brin (ARNds)5. À ce jour, le mécanisme de silençage génique post-transcriptionnel induit par l’ARNds a été trouvé chez tous les eucaryotes étudiés, et la technologie ARNi, en tant qu’outil de recherche en génomique fonctionnelle et d’autres applications, s’est développée rapidement dans de nombreux organismes. Depuis la découverte de la machinerie ARNi chez Caenorhabditis elegans en 19986, les techniques ARNi sont devenues des méthodes efficaces pour identifier la fonction génique des nématodes et sont proposées comme une nouvelle façon de lutter efficacement contre les nématodes pathogènes7.
L’ARNi est techniquement facile - tremper les juvéniles dans l’ARNds peut suffire; Cependant, l’efficacité et la reproductibilité de cette approche varient considérablement selon l’espèce de nématode et le gène cible8. Le silençage de 20 gènes impliqués dans les voies ARNi du nématode à galles, Meloidogyne incognita, a été étudié en utilisant de longs ARNd comme déclencheurs, entraînant diverses réponses, y compris une augmentation et aucun changement dans l’expression de certains gènes9. Ces résultats montrent que les gènes cibles peuvent réagir différemment à l’ARNi knockdown, ce qui nécessite une évaluation exhaustive de leur aptitude en tant que cibles pour la lutte contre les nématodes via l’ARNi. Cependant, il y a actuellement peu de recherches sur la biologie du développement et de la reproduction de B. xylophilus.
Dans la continuité des travaux précédents10,11,12,13, nous décrivons ici un protocole d’application de l’ARNi pour étudier la fonction du gène ppm-1 de B. xylophilus, y compris la synthèse de l’ARNds, le trempage des neurostimulants synthétiques et la détection de la réaction en chaîne de la polymérase quantitative (qPCR). Les connaissances acquises grâce à cette approche expérimentale contribueront probablement de façon marquée à la compréhension des systèmes biologiques de base et à la prévention de la maladie du flétrissement du pin.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

Le nématode du pin, Bursaphelenchus xylophilus, est l’une des espèces envahissantes les plus destructrices au monde, causant le flétrissement et éventuellement la mort des pins. Malgré la reconnaissance de leur importance économique et environnementale, il a été jusqu’à présent impossible d’étudier les fonctions génétiques détaillées des nématodes parasites des plantes (NPP) à l’aide de la génétique avancée conventionnelle et des méthodes transgéniques. Cependant, en tant que technologie de génétique inverse, l’interférence ARN (ARNi) facilite l’étude des gènes fonctionnels des nématodes, y compris B. xylophilus. 
Cet article décrit un nouveau protocole pour l’ARNi du gène ppm-1 chez B. xylophilus, qui joue un rôle crucial dans le développement et la reproduction d’autres nématodes pathogènes. Pour l’ARNi, le promoteur T7 a été lié au 5'-terminal du fragment cible par réaction en chaîne de la polymérase (PCR), et l’ARN double brin (ARNds) a été synthétisé par transcription in vitro . Par la suite, l’administration d’ARNds a été accomplie en trempant les nématodes dans une solution d’ARNds mélangée à des neurostimulants synthétiques. Des juvéniles synchronisés de B. xylophilus (environ 20 000 individus) ont été lavés et trempés dans de l’ARNds (0,8 μg/mL) dans le tampon de trempage pendant 24 heures dans l’obscurité à 25 °C.
La même quantité de nématodes a été placée dans un tampon de trempage sans ARNds comme témoin. Pendant ce temps, une autre quantité identique de nématodes a été placée dans un tampon de trempage avec le gène dsRNA de la protéine fluorescente verte (gfp) comme témoin. Après trempage, le niveau d’expression des transcrits cibles a été déterminé à l’aide de la PCR quantitative en temps réel. Les effets de l’ARNi ont ensuite été confirmés à l’aide d’une observation microscopique des phénotypes et d’une comparaison de la taille corporelle des adultes parmi les groupes. Le protocole actuel peut aider à faire progresser la recherche pour mieux comprendre les fonctions des gènes de B. xylophilus et d’autres nématodes parasites vers l’élaboration de stratégies de contrôle par génie génétique.

Analyse de l’expression ppm-1 de B. xylophilus après ARNi Le niveau d’expression relative du gène ppm-1 de B. xylophilus imbibé d’ARNds GFP et celui imbibé du gène cible dsRNA était respectivement de 0,92 et 0,52 (le niveau d’expression génique ppm-1 du groupe témoin traité par ddH2O a été fixé à 1) (Figure 1). Ainsi, l’ARNds e...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Ici, nous introduisons une méthode de trempage détaillée de l’interférence ARN chez Bursaphelenchus xylophilus pour faciliter l’étude des fonctions des gènes.

Application de l’interférence ARN chez le nématode du pin, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

L’ARNi est devenu une méthode efficace pour identifier la fonction des gènes chez les nématodes et est proposé comme une nouvelle façon de lutter efficacement contre les nématodes pathogènes. L’ARNi trempe les nématodes dans l’ARNds peut suffire pour la procédure. Pour commencer, collectez les nématodes par la méthode de l’entonnoir de Baermann.Pour cela, placez un tube en caoutchouc serré sous un entonnoir et placez deux couches de papier filtre dans l’embouchure de l’entonnoir. Transférer les cultures fongiques de Botrytis cinerea dans l’entonnoir et ajouter de l’eau pour immerger le tapis fongique. Lorsque les nématodes sont collectés, ajoutez 500 microlitres de réactif d’extraction et 100 microlitres de billes magnétiques à un tube centrifuge de deux millilitres.Aspirer 20 microlitres de nématodes et broyer les échantillons à 9 000 x g pendant 30 secondes. Incuber pendant cinq minutes et centrifuger à 12 000 x g pendant 10 minutes à quatre degrés Celsius. Transférer le surnageant dans un nouveau tube à centrifuger.Ajouter 100 microlitres de chloroforme et mélanger en retournant le tube plusieurs fois. Incuber pendant trois minutes, puis centrifuger à 12 000 x g pendant 10 minutes à quatre degrés Celsius. Encore une fois, transférez le surnageant dans un nouveau tube à centrifuger.Ajouter 250 microlitres d’alcool isopropylique et vortex vigoureusement. Centrifuger à 12 000 x g pendant 10 minutes et vortex. Jetez le surnageant et ajoutez 500 microlitres d’éthanol à 75% pour laver l’ARN.Vortex l’échantillon suivi d’une centrifugation à 12 000 x g pendant cinq minutes à quatre degrés Celsius. Sécher à l’air la pastille d’ARN pendant cinq minutes et la remettre en suspension dans 30 microlitres d’eau sans RNase. Calculez la concentration d’ARN à l’aide de cette formule et calculez le rapport A260 à A280.Ensuite, utilisez une paire d’amorces pour amplifier la séquence codante partielle du gène BX ppm-1 du B. xylophilus. Clonez ensuite les séquences du gène ppm-1 en un vecteur pGEM-T Easy contenant le promoteur T7. Récupérez le fragment de gène ppm-1 long de la paire de 894 bases en utilisant le plasmide cloné comme modèle pour pcr.Ensuite, utilisez un kit de transcription in vitro pour synthétiser l’ARNds. Analyser la qualité de l’ARNds à l’aide d’un spectrophotomètre et visualiser les produits sur un gel d’agarose à 1%. Ajouter quatre microlitres de tampon de trempage 5X et compléter le volume à 20 microlitres avec de l’eau distillée double pour obtenir une concentration finale d’ARN de 0,8 microgramme par millilitre.Ensuite, placez les nématodes dans le plat pendant 30 minutes et attendez que les œufs adhèrent au fond. Retirez soigneusement l’eau et les nématodes sans déranger les œufs jusqu’à ce qu’il ne reste que les œufs dans le plat. Faire éclore les œufs collectés dans l’obscurité à 25 degrés Celsius pendant 24 heures pour obtenir des larves J2.Rassemblez les larves dans un tube et lavez-les trois fois avec de l’eau distillée double. Ensuite, transférez les larves dans le tube contenant la solution d’ARNds. À cela, ajoutez une solution de résorcinol pour obtenir une solution à 1%.Placez les larves sur une table à secouer pour assurer une absorption suffisante de l’ARNds dans les larves. Pour les témoins, tremper la même quantité de nématodes dans le tampon de trempage sans la sonde dsRNA ou avec une sonde d’ARNds GFP. Effectuer une qPCR en utilisant les gènes actB et tbb-2 comme références internes pour évaluer les changements dans le niveau d’expression génique.Utilisez la méthode delta delta Ct pour estimer le niveau relatif d’expression génique à partir de la courbe de dissolution et de la valeur Ct. Après ARNi, cultiver les larves J2 jusqu’à l’âge adulte sur des pelouses de Botrytis cinerea sur des plaques PDA. Recueillir les adultes en utilisant la méthode de l’entonnoir de Baermann, comme indiqué dans la première section.Obtenez des images des nématodes adultes au microscope et utilisez le logiciel ImageJ pour mesurer la longueur du corps de 50 nématodes mâles et de 50 nématodes femelles. Analysez les données en calculant la moyenne et l’écart-type pour chaque échantillon. Appliquer le test de Student t pour comparer les moyennes des échantillons des différents groupes.L’analyse de l’expression relative des gènes après ARNi a indiqué que l’ARNds ppm-1 peut inhiber efficacement l’expression du gène ppm-1 one de B.Xylophilus. Alors que l’ARNds exogène GFP n’a eu aucun effet sur l’expression de ppm-1. Après l’ARNi, la taille des adultes a nettement diminué malgré l’atteinte de la maturité sexuelle, ce qui a entraîné le phénotype mutant de petite taille corporelle.La longueur corporelle moyenne des femelles et des mâles mutants était de 544 et 526 micromètres contre 971 et 912 micromètres pour le groupe témoin Le plus important est de transférer les nématodes dans la solution d’ARN double brin et d’ajouter un autre réactif pour stimuler les nématodes à se nourrir. Cette méthode convient au criblage génétique à grande échelle et est couramment utilisée dans la recherche cellulaire. L’étude de la fonction génique de B.Xylophilus par cette méthode a une valeur directrice pour la lutte biologique contre B.Xylophilus.

Research

JoVE Journal

Biology

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

Transcription in vitro et plafonnement de l&#39;ARNm de luciférase Gaussia Suivie par la transfection de cellules HeLa

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Recherche

Biologie

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

Isolement de la chromatine par purification d&#39;ARN (CHIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

En utilisant l&#39;ARN médiée par la stratégie d&#39;alimentation interférences à l&#39;écran pour des gènes impliqués dans le règlement de la taille du corps du nématode<em&gt; C. elegans</em

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larvaire interférence de l&#39;ARN dans le rouge de la farine Beetle,<em&gt; Tribolium castaneum</em

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation et Quantification de Mating Comportement dans le nématode,<em&gt; Bursaphelenchus xylophilus</em

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

Utilisation pratique de l’interférence d’ARN : l’administration orale d’ARN Double brin dans Liposome transporteurs pour les blattes

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq : Type-spécifiques des cellules épigénome profilage

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

Identification d’un épissage alternatif et d’une polyadénylation dans les données de séquençage de l’ARN

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...