Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

इस शोध को चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन (31870637, 31200487) द्वारा वित्त पोषित किया गया था और झेजियांग कुंजी अनुसंधान योजना (2019सी02024, एलजीएन 22 सी 160004) द्वारा संयुक्त रूप से वित्त पोषित किया गया था।

अध्ययन को झेजियांग कृषि और वानिकी विश्वविद्यालय के पशु प्रयोग परिषद द्वारा अनुमोदित किया गया था। जाइलोफिलस आइसोलेट एनएक्सवाई 61 मूल रूप से झेजियांग प्रांत, चीन11 के निंगबो क्षेत्र में एक र?...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

यद्यपि बी ज़ाइलोफिलस का जीवन इतिहास और परजीवी वातावरण अन्य नेमाटोड से अलग है, इस पौधे रोगज़नक़ के आणविक रोगजनन पर सीमित शोध हुआ है। सी एलिगेंस और अन्य नेमाटोड में सीआरआईएसपीआर / कैस 9 जीनोम संपाद...

पादप-परजीवी सूत्रकृमि (पीपीएन) खाद्य सुरक्षा और वन पारिस्थितिकी प्रणालियों के लिए एक निरंतर खतरा है। वे हर साल आर्थिक नुकसान में अनुमानित 100 बिलियन अमरीकी डालर का कारण बनते हैं, जिनमें से सबसे अधिक समस्याग्रस्त मुख्य रूप से रूट-गाँठ नेमाटोड, पुटी नेमाटोड और पाइनवुड नेमाटोड हैं। पाइनवुड नेमाटोड, बर्साफेलेंकस जाइलोफिलस, एक प्रवासी, एंडोपैरासिटिक नेमाटोड है, जो पाइन विल्ट रोग2 का कारण रोगज़नक़ है। इसने दुनिया भर में देवदार के जंगलों को बहुत नुकसान पहुंचायाहै 3. वान मेगन एट अल 4 की शब्दावली का उपयोग करते हुए, बी ज़ाइलोफिलस पैरासिटाफेलेनचिडा का सदस्य है और क्लेड 10 से संबंधित है, जबकि अधिकांश अन्य प्रमुख पौधे परजीवी क्लेड 12 से संबंधित हैं।
एक स्वतंत्र और हाल ही में विकसित पौधे परजीवी के रूप में, बी ज़ाइलोफिलस तुलनात्मक अध्ययन के लिए एक आकर्षक मॉडल है। आज तक, क्लैड 12 से संबंधित रूट-गाँठ नेमाटोड और पुटी नेमाटोड पर पर्याप्त शोध किया गया है, जो बाध्यकारी, गतिहीन एंडोपारासाइट्स हैं और कुछ सबसे गहन अध्ययन किए गए नेमाटोड हैं। हालांकि, इस महत्वपूर्ण क्षेत्र में आगे के शोध का संचालन एक बड़ी चुनौती के साथ आता है: परजीवीजीन का कार्य एक शोध अड़चन है। कार्यात्मक अध्ययनों में आम तौर पर एक्टोपिक अभिव्यक्ति और नॉकडाउन / आउट प्रयोग शामिल होते हैं लेकिन नेमाटोड के लिए प्रभावी आनुवंशिक परिवर्तन प्रोटोकॉल पर भरोसा करते हैं। नतीजतन, पीपीएन में रिवर्स जेनेटिक्स लगभग विशेष रूप से आरएनएआई द्वारा जीन साइलेंसिंग पर निर्भर करता है।
आरएनएआई, यूकेरियोटिक कोशिकाओं में व्यापक रूप से मौजूद एक तंत्र, डबल-फंसे आरएनए (डीएसआरएनए) 5 को पेश करके जीन अभिव्यक्ति को चुप करता है। आज तक, डीएसआरएनए द्वारा प्रेरित पोस्टट्रांसक्रिप्शनल जीन-साइलेंसिंग तंत्र सभी अध्ययन किए गए यूकेरियोट्स में पाया गया है, और आरएनएआई प्रौद्योगिकी, कार्यात्मक जीनोमिक्स अनुसंधान और अन्य अनुप्रयोगों के एक उपकरण के रूप में, कई जीवों में तेजी से विकसित हुई है। 19986 में कैनोरहाब्डिटिस एलिगेंस में आरएनएआई मशीनरी की खोज के बाद से, आरएनएआई तकनीक नेमाटोड के जीन फ़ंक्शन की पहचान करने के लिए प्रभावी तरीके बन गए हैं और रोगजनक नेमाटोड7 को प्रभावी ढंग से नियंत्रित करने के एक नए तरीके के रूप में प्रस्तावित हैं।
आरएनएआई तकनीकी रूप से डीएसआरएनए में किशोरों को भिगोना पर्याप्त हो सकता है; हालाँकि, इस दृष्टिकोण की प्रभावकारिता और प्रजनन क्षमता नेमाटोड प्रजातियों और लक्ष्य जीन 8 के साथ व्यापक रूप से भिन्न होतीहै। रूट-गाँठ सूत्रकृमि के आरएनएआई मार्गों में शामिल 20 जीनों की चुप्पी, मेलोइडोगिन गुप्त, ट्रिगर्स के रूप में लंबे डीएसआरएनए का उपयोग करके जांच की गई थी, जिसके परिणामस्वरूप विभिन्न प्रतिक्रियाएं हुईं, जिनमें वृद्धि और कुछ जीनों की अभिव्यक्ति में कोई बदलाव नहीं हुआ9. इन परिणामों से पता चलता है कि लक्ष्य जीन आरएनएआई नॉकडाउन का अलग-अलग जवाब दे सकते हैं, जिससे आरएनएआई के माध्यम से नेमाटोड नियंत्रण के लक्ष्य के रूप में उनकी उपयुक्तता के संपूर्ण मूल्यांकन की आवश्यकता होती है। हालांकि, वर्तमान में विकासात्मक और प्रजनन जीव विज्ञान पर अनुसंधान की कमी है बी।
पिछले काम10,11,12,13 की निरंतरता के रूप में, हम यहां बीएसआरएनए, सिंथेटिक न्यूरोस्टिमुलेंट भिगोने और मात्रात्मक पोलीमरेज़ चेन रिएक्शन (क्यूपीसीआर) का पता लगाने के संश्लेषण सहित बी ज़ाइलोफिलस के पीपीएम -1 जीन के कार्य का अध्ययन करने के लिए आरएनएआई को लागू करने के लिए एक प्रोटोकॉल का वर्णन करते हैं। इस प्रयोगात्मक दृष्टिकोण से प्राप्त ज्ञान संभवतः बुनियादी जैविक प्रणालियों को समझने और पाइन विल्ट रोग को रोकने में स्पष्ट रूप से योगदान देगा।

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

पाइनवुड नेमाटोड, बर्साफेलेंकस जाइलोफिलस, दुनिया भर में सबसे विनाशकारी आक्रामक प्रजातियों में से एक है, जिससे देवदार के पेड़ों की मुरझाने और अंतिम मृत्यु हो जाती है। उनके आर्थिक और पर्यावरणीय महत्व की मान्यता के बावजूद, पारंपरिक फॉरवर्ड जेनेटिक्स और ट्रांसजेनिक विधियों का उपयोग करके पौधे-परजीवी नेमाटोड (पीपीएन) के विस्तृत जीन कार्यों का अध्ययन करना अब तक असंभव रहा है। हालांकि, एक रिवर्स जेनेटिक्स तकनीक के रूप में, आरएनए हस्तक्षेप (आरएनएआई) नेमाटोड के कार्यात्मक जीन के अध्ययन की सुविधा प्रदान करता है, जिसमें बी। 
यह पत्र बी ज़ाइलोफिलस में पीपीएम -1 जीन के आरएनएआई के लिए एक नए प्रोटोकॉल की रूपरेखा तैयार करता है, जिसे अन्य रोगजनक नेमाटोड के विकास और प्रजनन में महत्वपूर्ण भूमिका निभाने की सूचना दी गई है। आरएनएआई के लिए, टी 7 प्रमोटर पोलीमरेज़ चेन रिएक्शन (पीसीआर) द्वारा लक्ष्य टुकड़े के 5'-टर्मिनल से जुड़ा हुआ था, और डबल-फंसे आरएनए (डीएसआरएनए) को इन विट्रो प्रतिलेखन द्वारा संश्लेषित किया गया था। इसके बाद, डीएसआरएनए डिलीवरी सिंथेटिक न्यूरोस्टिमुलेंट के साथ मिश्रित डीएसआरएनए समाधान में नेमाटोड को भिगोकर पूरा किया गया था। जाइलोफिलस (लगभग 20,000 व्यक्तियों) के सिंक्रनाइज़ किशोरों को धोया गया और 25 डिग्री सेल्सियस पर अंधेरे में 24 घंटे के लिए भिगोने वाले बफर में डीएसआरएनए (0.8 μg /
नेमाटोड की समान मात्रा को नियंत्रण के रूप में डीएसआरएनए के बिना भिगोने वाले बफर में रखा गया था। इस बीच, नेमाटोड की एक और समान मात्रा को नियंत्रण के रूप में हरे फ्लोरोसेंट प्रोटीन (जीएफपी) जीन डीएसआरएनए के साथ भिगोने वाले बफर में रखा गया था। भिगोने के बाद, वास्तविक समय मात्रात्मक पीसीआर का उपयोग करके लक्ष्य टेपों की अभिव्यक्ति स्तर निर्धारित किया गया था। आरएनएआई के प्रभावों की पुष्टि तब फेनोटाइप के सूक्ष्म अवलोकन और समूहों के बीच वयस्कों के शरीर के आकार की तुलना का उपयोग करके की गई थी। वर्तमान प्रोटोकॉल जेनेटिक इंजीनियरिंग के माध्यम से नियंत्रण रणनीतियों को विकसित करने की दिशा में बी ज़ाइलोफिलस और अन्य परजीवी नेमाटोड के जीन के कार्यों को बेहतर ढंग से समझने के लिए अनुसंधान को आगे बढ़ाने में मदद कर सकता है।

आरएनएआई के बाद बी ज़ाइलोफिलस की पीपीएम -1 अभिव्यक्ति का विश्लेषण जीएफपी डीएसआरएनए के साथ भिगोए गए बी ज़ाइलोफिलस के पीपीएम -1 जीन का सापेक्ष अभिव्यक्ति स्?...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

यहां, हम जीन कार्यों के अध्ययन की सुविधा के लिए बर्साफेलेंकस जाइलोफिलस में आरएनए हस्तक्षेप की एक विस्तृत भिगोने की विधि पेश करते हैं।

पाइनवुड नेमाटोड में आरएनए हस्तक्षेप का अनुप्रयोग, बर्साफेलेंकस जाइलोफिलस

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

आरएनएआई नेमाटोड में जीन के कार्य की पहचान करने के लिए एक प्रभावी तरीका बन गया है और रोगजनक नेमाटोड को प्रभावी ढंग से नियंत्रित करने के लिए एक नए तरीके के रूप में प्रस्तावित किया गया है। आरएनएआई डीएसआरएनए में नेमाटोड भिगो रहा है प्रक्रिया के लिए पर्याप्त हो सकता है। शुरू करने के लिए, बेर्मन फ़नल विधि द्वारा नेमाटोड एकत्र करें।इसके लिए एक फनल के नीचे क्लैंप्ड रबर ट्यूब रखें और फिल्टर पेपर की दो लेयर्स को फनल के मुंह में रखें। बोट्रिटिस सिनेरिया फंगल संस्कृतियों को फ़नल में स्थानांतरित करें और फंगल चटाई को विसर्जित करने के लिए पानी जोड़ें। जब नेमाटोड एकत्र किए जाते हैं, तो निष्कर्षण अभिकर्मक के 500 माइक्रोलीटर और चुंबकीय मोतियों के 100 माइक्रोलीटर को दो मिलीलीटर अपकेंद्रित्र ट्यूब में जोड़ें।नेमाटोड के 20 माइक्रोलीटर की आकांक्षा करें और नमूनों को 30 सेकंड के लिए 9, 000 एक्स जी पर पीस लें। पांच मिनट के लिए सेते हैं और चार डिग्री सेल्सियस पर 10 मिनट के लिए 12, 000 x g पर अपकेंद्रित्र। सतह पर तैरनेवाला को एक ताजा अपकेंद्रित्र ट्यूब में स्थानांतरित करें।क्लोरोफॉर्म के 100 माइक्रोलीटर जोड़ें और ट्यूब को कई बार उल्टा करके मिलाएं। तीन मिनट के लिए सेते हैं और फिर चार डिग्री सेल्सियस पर 10 मिनट के लिए 12, 000 x g पर अपकेंद्रित्र। फिर से, सतह पर तैरनेवाला को एक ताजा अपकेंद्रित्र ट्यूब में स्थानांतरित करें।आइसोप्रोपिल अल्कोहल और भंवर के 250 माइक्रोलीटर सख्ती से जोड़ें। 10 मिनट और भंवर के लिए 12, 000 एक्स जी पर अपकेंद्रित्र। सतह पर तैरनेवाला त्यागें और आरएनए धोने के लिए 75% इथेनॉल के 500 माइक्रोलीटर जोड़ें।भंवर नमूना चार डिग्री सेल्सियस पर पांच मिनट के लिए 12, 000 एक्स जी पर सेंट्रीफ्यूजेशन के बाद। आरएनए गोली को पांच मिनट के लिए हवा में सुखाएं और इसे आरएनएएसई मुक्त पानी के 30 माइक्रोलीटर में फिर से निलंबित करें। इस सूत्र का उपयोग करके आरएनए एकाग्रता की गणना करें और ए 260 से ए 280 अनुपात की गणना करें।अगला, बी.ज़ाइलोफिलस से बीएक्स पीपीएम -1 जीन के आंशिक कोडिंग अनुक्रम को बढ़ाने के लिए प्राइमरों की एक जोड़ी का उपयोग करें। फिर पीपीएम -1 एक जीन अनुक्रमों को टी 7 प्रमोटर युक्त पीजीईएम-टी आसान वेक्टर में क्लोन करें। पीसीआर के लिए टेम्पलेट के रूप में क्लोन प्लास्मिड का उपयोग करके 894 बेस जोड़ी लंबे पीपीएम -1 जीन टुकड़े को पुनर्प्राप्त करें।फिर, डीएसआरएनए को संश्लेषित करने के लिए इन विट्रो ट्रांसक्रिप्शन किट का उपयोग करें। स्पेक्ट्रोफोटोमीटर का उपयोग करके डीएसआरएनए की गुणवत्ता का विश्लेषण करें और 1% एगरोज़ जेल पर उत्पादों की कल्पना करें। 5 एक्स भिगोने वाले बफर के चार माइक्रोलीटर जोड़ें और 0.8 माइक्रोग्राम प्रति मिलीलीटर की अंतिम आरएनए एकाग्रता प्राप्त करने के लिए डबल आसुत जल के साथ 20 माइक्रोलीटर तक वॉल्यूम बनाएं।फिर नेमाटोड को 30 मिनट के लिए डिश में रखें और अंडे के नीचे का पालन करने की प्रतीक्षा करें। ध्यान से अंडे को परेशान किए बिना पानी और नेमाटोड को हटा दें जब तक कि केवल अंडे पकवान में न रहें। जे 2 लार्वा प्राप्त करने के लिए 24 घंटे के लिए 25 डिग्री सेल्सियस पर अंधेरे में एकत्र किए गए अंडे को हैच करें।लार्वा को एक ट्यूब में इकट्ठा करें और उन्हें डबल आसुत जल से तीन बार धो लें। फिर, लार्वा को डीएसआरएनए समाधान युक्त ट्यूब में स्थानांतरित करें। इसमें, 1% समाधान प्राप्त करने के लिए रेसोरसिनॉल समाधान जोड़ें।लार्वा में डीएसआरएनए के पर्याप्त अवशोषण को सुनिश्चित करने के लिए लार्वा को एक मिलाते हुए टेबल पर रखें। नियंत्रण के लिए, डीएसआरएनए जांच के बिना या जीएफपी डीएसआरएनए जांच के साथ भिगोने वाले बफर में नेमाटोड की समान मात्रा को भिगोएं। जीन अभिव्यक्ति स्तर में परिवर्तन का मूल्यांकन करने के लिए आंतरिक संदर्भ के रूप में एक्टबी और टीबीबी -2 जीन का उपयोग करके एक क्यूपीसीआर करें।विघटन वक्र और सीटी मान से सापेक्ष जीन अभिव्यक्ति स्तर का अनुमान लगाने के लिए डेल्टा डेल्टा सीटी विधि का उपयोग करें। आरएनएआई के बाद, पीडीए प्लेटों पर बोट्रिटिस सिनेरिया लॉन पर वयस्कता तक जे 2 लार्वा की संस्कृति। जैसा कि अनुभाग एक में दिखाया गया है बेर्मन फ़नल विधि का उपयोग करके वयस्कों को इकट्ठा करें।माइक्रोस्कोप के तहत वयस्क नेमाटोड की छवियों को प्राप्त करें और 50 पुरुष और 50 महिला नेमाटोड के शरीर की लंबाई को मापने के लिए इमेजजे सॉफ्टवेयर का उपयोग करें। प्रत्येक नमूने के लिए माध्य और मानक विचलन की गणना करके डेटा का विश्लेषण करें। विभिन्न समूहों से नमूनों के साधनों की तुलना करने के लिए छात्र के टी परीक्षण को लागू करें।आरएनएआई के बाद सापेक्ष जीन अभिव्यक्ति विश्लेषण ने संकेत दिया कि पीपीएम -1 डीएसआरएनए प्रभावी रूप से पीपीएम -1 की अभिव्यक्ति को बाधित कर सकता है बी.जाइलोफिलस का एक जीन। जबकि बहिर्जात जीएफपी डीएसआरएनए का पीपीएम -1 अभिव्यक्ति पर कोई प्रभाव नहीं पड़ा। आरएनएआई के बाद, यौन परिपक्वता प्राप्त करने के बावजूद वयस्कों का आकार स्पष्ट रूप से कम हो गया जिसके परिणामस्वरूप छोटे शरीर का आकार उत्परिवर्ती फेनोटाइप हुआ।उत्परिवर्ती महिलाओं और पुरुषों की औसत शरीर की लंबाई नियंत्रण समूह के लिए 971 और 912 माइक्रोमीटर की तुलना में 544 और 526 माइक्रोमीटर थी सबसे महत्वपूर्ण बात यह है कि नेमाटोड को डबल स्ट्रैंड आरएनए समाधान में स्थानांतरित करना और फ़ीड करने के लिए नेमाटोड को उत्तेजित करने के लिए एक और अभिकर्मक जोड़ना है। यह विधि बड़े पैमाने पर जीन स्क्रीन के लिए उपयुक्त है और आमतौर पर सेल अनुसंधान में उपयोग की जाती है। इस पद्धति द्वारा बी.जाइलोफिलस के जीन फ़ंक्शन का अध्ययन करने से बी.ज़ाइलोफिलस के जैविक नियंत्रण के लिए मार्गदर्शक मूल्य है।

Research

JoVE Journal

Biology

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

इन विट्रो प्रतिलेखन और Gaussia luciferase mRNA की कैपिंग HeLa सेल प्रोटोकॉल के द्वारा पीछा किया

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

शाही सेना शोधन द्वारा chromatin अलगाव (कूजन)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

निमेटोड में शारीरिक आकार विनियमन में शामिल जीनों के लिए स्क्रीन के लिए आरएनए की मध्यस्थता हस्तक्षेप दूध पिलाने की रणनीति का प्रयोग कर<em&gt; सी. एलिगेंस</em

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

लाल आटा बीटल में लार्वा आरएनए हस्तक्षेप,<em&gt; Tribolium castaneum</em

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

अवलोकन और पाइनवुड निमेटोड में संभोग व्यवहार की मात्रा का ठहराव,<em&gt; Bursaphelenchus xylophilus</em

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

आरएनए हस्तक्षेप के व्यावहारिक उपयोग: तिलचट्टे के लिए Liposome वाहक में डबल कतरा आरएनए के मौखिक वितरण

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: कक्ष-प्रकार-विशिष्ट Epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

आरएनए-सेक डेटा में वैकल्पिक स्प्लिसिंग और पॉलीएडेनाइलेशन की पहचान

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...