Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

이 연구는 중국 국립 자연 과학 재단 (31870637, 31200487)이 자금을 지원했으며 절강 핵심 연구 계획 (2019C02024, LGN22C160004)이 공동으로 자금을 지원했습니다.

이 연구는 절강 농업 및 임업 대학의 동물 실험위원회에서 승인했습니다. B. xylophilus 분리 NXY61은 원래 중국 절강 성 닝보 (Zhejiang)11의 닝보 (Ningbo) 지역의 병든 Pinus massoniana에서 추출되었습니다.
1. 유전자 클로닝
참고: 이 프로토콜에 사용된 프라이머에 대한 자세한 내용은 자료표를 참조하십시오.
...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

B. xylophilus의 삶의 역사와 기생 환경은 다른 선충류의 삶과 다르지만,이 식물 병원균의 분자 병인에 대한 연구는 제한적이었습니다. C. elegans 및 기타 선충류에 CRISPR / Cas9 게놈 편집 기술을 적용하는 데 큰 진전이 있었음에도 불구하고 B. xylophilus에 적용된 RNAi 기술 만현재까지 17 일까지 발표되었습니다. RNAi는 선충류의 유전자 기능을 연구하는 데 사용할 수있?...

식물 기생 선충류 (PPN)는 식량 안보 및 산림 생태계에 대한 지속적인 위협입니다. 그들은매년 1,000 억 달러의 경제적 손실을 초래하며, 그 중 가장 문제가되는 것은 주로 뿌리 매듭 선충류, 낭종 선충류 및 소나무 선충류입니다. 파인우드 선충류인 Bursaphelenchus xylophilus는 소나무 시들음병의 원인균인 이주, 내구생 선충류입니다2. 그것은 전 세계적으로 소나무 숲에 큰 해를 끼쳤습니다3. Van Megen et al.4의 용어를 사용하여, B. xylophilus 는 Parasitaphelenchidae의 구성원이며 clade 10에 속하는 반면, 대부분의 다른 주요 식물 기생충은 clade 12에 속합니다.
독립적이고 최근에 진화 된 식물 기생충 인 B. xylophilus 는 비교 연구를위한 매력적인 모델입니다. 현재까지 clade 12에 속하는 뿌리 매듭 선충류와 낭종 선충류에 대한 상당한 연구가 있었으며, 이는 의무적이며 앉아있는 내생 기생충이며 가장 강렬하게 연구 된 선충류 중 일부입니다. 그러나이 중요한 분야에서 추가 연구를 수행하는 것은 중요한 도전과 함께 온다 : 기생 유전자의 기능은 연구 병목 현상이다. 기능적 연구는 일반적으로 자궁외 발현 및 녹다운 / 아웃 실험을 포함하지만 선충류에 대한 효과적인 유전 적 변형 프로토콜에 의존합니다. 결과적으로, PPN의 역유전학은 거의 독점적으로 RNAi에 의한 유전자 침묵에 의존한다.
진핵 세포에 널리 존재하는 메카니즘인 RNAi는 이중 가닥 RNA(dsRNA)5를 도입하여 유전자 발현을 침묵시킨다. 현재까지 dsRNA에 의해 유도되는 전사 후 유전자-침묵 메카니즘은 모든 연구된 진핵생물에서 발견되었으며, 기능적 유전체학 연구 및 기타 응용의 도구로서 RNAi 기술은 많은 유기체에서 급속히 발전해 왔다. 1998년6년 예쁜꼬마선충에서 RNAi 기계가 발견된 이래로, RNAi 기술은 선충류의 유전자 기능을 확인하는 효과적인 방법이 되었으며, 병원성 선충류7를 효과적으로 조절하는 새로운 방법으로 제안되고 있다.
RNAi는 기술적으로 facile-dsRNA에 청소년을 담그면 충분할 수 있다; 그러나, 이러한 접근법의 효능 및 재현성은 선충류 종 및 표적 유전자8에 따라 광범위하게 다양하다. 뿌리 매듭 선충류, 멜로이도인 인코그니타의 RNAi 경로에 관여하는 20개의 유전자의 침묵은 긴 dsRNAs를 트리거로 사용하여 조사되었으며, 그 결과 일부 유전자의 발현의 증가 및 변화 없음9를 포함한 다양한 반응을 초래하였다. 이러한 결과는 표적 유전자가 RNAi 녹다운에 다르게 반응할 수 있음을 보여주며, RNAi를 통한 선충류 조절을 위한 표적으로서의 적합성에 대한 철저한 평가가 필요하다. 그러나 현재 B. xylophilus의 발달 및 생식 생물학에 대한 연구가 부족합니다.
이전 연구10,11,12,13의 연속으로, 우리는 dsRNA의 합성, 합성 신경 자극제 담금질 및 정량적 중합 효소 연쇄 반응 (qPCR) 검출을 포함하여 B. xylophilus의 ppm-1 유전자의 기능을 연구하기 위해 RNAi를 적용하기위한 프로토콜을 여기에서 설명합니다. 이 실험적 접근 방식에서 얻은 지식은 기본적인 생물학적 시스템을 이해하고 소나무 시들음 질병을 예방하는 데 크게 기여할 것입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

소나무 선충류 인 Bursaphelenchus xylophilus는 전 세계적으로 가장 파괴적인 침입 종 중 하나이며 소나무의 시들음과 결국 죽음을 초래합니다. 그들의 경제적 및 환경적 중요성에 대한 인식에도 불구하고, 지금까지 기존의 전방 유전학 및 트랜스제닉 방법을 사용하여 식물 기생 선충류 (PPNs)의 상세한 유전자 기능을 연구하는 것은 불가능했습니다. 그러나, 역 유전학 기술로서, RNA 간섭 (RNAi)은 B. xylophilus 를 포함한 선충류의 기능적 유전자에 대한 연구를 용이하게합니다.
이 논문은 B. xylophilus에서 ppm-1 유전자의 RNAi에 대한 새로운 프로토콜을 간략하게 설명하며, 이는 다른 병원성 선충류의 개발 및 재생에 중요한 역할을하는 것으로 보고되었습니다. RNAi의 경우, T7 프로모터를 중합효소 연쇄 반응(PCR)에 의해 표적 단편의 5'-말단에 연결시키고, 이중 가닥 RNA(dsRNA)를 시험관내 전사에 의해 합성하였다. 이어서, dsRNA 전달은 선충류를 합성 신경자극제와 혼합된 dsRNA 용액에 담그면서 달성되었다. B. xylophilus (대략 20,000 개체)의 동기화된 청소년을 세척하고 25°C에서 어둠 속에서 24 h 동안 담금질 완충액 중의 dsRNA (0.8 μg/mL)에 담갔다.
동일한 양의 선충류를 대조군으로서 dsRNA가 없는 침지 완충액에 넣었다. 한편, 또 다른 동일한 양의 선충류를 대조군으로서 녹색 형광 단백질(gfp) 유전자 dsRNA와 함께 침지 완충액에 넣었다. 침지 후, 표적 전사체의 발현 수준은 실시간 정량적 PCR을 사용하여 결정하였다. RNAi의 효과는 표현형의 현미경 관찰과 그룹 간의 성인의 신체 크기 비교를 사용하여 확인되었습니다. 현재의 프로토콜은 B. xylophilus 및 기타 기생 선충류의 유전자 기능을 유전 공학을 통해 통제 전략을 개발하기위한 연구를 발전시키는 데 도움이 될 수 있습니다.

RNAi 후 B. xylophilus 의 ppm-1 발현 분석 GFP dsRNA와 표적 유전자 dsRNA로 침지시킨 B. xylophilus의 ppm-1 유전자의 상대적 발현량은 각각 0.92 및 0.52이었다(ddH2O 처리 대조군의 ppm-1 유전자 발현량은 1로 설정하였다)(도 1). 따라서, 외인성 dsRNA는 B. 크실로필루스의 ppm-1</em...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

여기에서는 유전자 기능 연구를 용이하게하기 위해 Bursaphelenchus xylophilus 에서 RNA 간섭에 대한 상세한 담그는 방법을 소개합니다.

파인우드 선충류에서의 RNA 간섭의 적용, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

RNAi는 선충류에서 유전자의 기능을 확인하는 효과적인 방법이되었으며 병원성 선충류를 효과적으로 제어하는 새로운 방법으로 제안되었습니다. RNAi는 선충류를 dsRNA에 담그고 시술에 충분할 수 있다. 시작하려면 Baermann 깔때기 방법으로 선충류를 수집하십시오.이를 위해 깔때기 아래에 고정 된 고무 튜브를 놓고 깔때기 입구에 두 겹의 여과지를 놓습니다. Botrytis cinerea 곰팡이 배양 물을 깔때기로 옮기고 물을 추가하여 곰팡이 매트를 담그십시오. 선충류가 수집되면 500 마이크로 리터의 추출 시약과 100 마이크로 리터의 자성 비드를 2 밀리리터 원심 분리 튜브에 첨가합니다.20 마이크로 리터의 선충류를 흡인하고 샘플을 9, 000 x g에서 30 초 동안 분쇄합니다. 5 분 동안 배양하고 섭씨 4도에서 10 분 동안 12, 000 x g에서 원심 분리합니다. 상청액을 새로운 원심 분리기 튜브로 옮깁니다.100 마이크로 리터의 클로로포름을 넣고 튜브를 여러 번 뒤집어 혼합하십시오. 3 분 동안 배양 한 다음 섭씨 4도에서 10 분 동안 12, 000 x g에서 원심 분리합니다. 다시, 상청액을 새로운 원심 분리 튜브로 옮깁니다.250 마이크로 리터의 이소 프로필 알코올을 첨가하고 격렬하게 소용돌이칩니다. 12, 000 x g에서 10 분 동안 원심 분리하고 와류. 상청액을 버리고 500 마이크로 리터의 75 % 에탄올을 첨가하여 RNA를 세척합니다.샘플을 와동시킨 후 섭씨 4도에서 5 분 동안 12, 000 x g에서 원심 분리합니다. RNA 펠릿을 5분 동안 자연 건조시키고 30마이크로리터의 RNase 자유수에 재현탁시킵니다. 이 공식을 사용하여 RNA 농도를 계산하고 A260 대 A280 비율을 계산합니다.다음으로, 프라이머 쌍을 사용하여 B.xylophilus로부터 BX ppm-1 유전자의 부분 코딩 서열을 증폭한다. 그 다음 ppm-1 유전자 서열을 T7 프로모터를 포함하는 pGEM-T Easy 벡터로 클로닝한다. 클로닝된 플라스미드를 PCR을 위한 주형으로 사용하여 894 염기쌍의 긴 ppm-1 유전자 단편을 회수한다.그 후, 시험관내 전사 키트를 사용하여 dsRNA를 합성한다. 분광 광도계를 사용하여 dsRNA의 품질을 분석하고 1%아가로스 겔에서 제품을 시각화합니다. 4 마이크로 리터의 5X 담금 버퍼를 추가하고 이중 증류수로 부피를 20 마이크로 리터로 구성하여 밀리리터 당 0.8 마이크로 그램의 최종 RNA 농도를 얻습니다.그런 다음 선충류를 접시에 30 분 동안 넣고 계란이 바닥에 달라 붙을 때까지 기다리십시오. 계란만 접시에 남을 때까지 계란을 방해하지 않고 물과 선충류를 조심스럽게 제거하십시오. 수집 된 알을 섭씨 25도의 어둠 속에서 24시간 동안 부화시켜 J2 유충을 얻습니다.유충을 튜브에 모으고 이중 증류수로 3 번 씻으십시오. 그런 다음 유충을 dsRNA 용액이 들어있는 튜브로 옮깁니다. 여기에 레조르시놀 용액을 추가하여 1% 용액을 얻습니다.유충에 dsRNA가 충분히 흡수되도록 유충을 흔들어 놓습니다. 대조군의 경우, 동일한 양의 선충류를 dsRNA 프로브 없이 또는 GFP dsRNA 프로브를 사용하여 담근 완충액에 담근다. 유전자 발현 수준의 변화를 평가하기 위해 actB 및 tbb-2 유전자를 내부 참조로 사용하여 qPCR을 수행한다.델타 델타 Ct 방법을 사용하여 용해 곡선 및 Ct 값으로부터 상대적인 유전자 발현 수준을 추정합니다. RNAi 후, J2 유충을 PDA 플레이트의 보트리티스 시네레아 잔디밭에서 성체가 될 때까지 배양한다. 섹션 1에 표시된 대로 Baermann 깔때기 방법을 사용하여 성체를 수집합니다.현미경으로 성충류의 이미지를 획득하고 ImageJ 소프트웨어를 사용하여 50마리의 수컷 선충과 50마리의 암컷 선충의 몸 길이를 측정합니다. 각 표본에 대한 평균 및 표준 편차를 계산하여 데이터를 분석합니다. 스튜던트 t 검정을 적용하여 여러 그룹의 표본 평균을 비교합니다.RNAi 후 상대적인 유전자 발현 분석은 ppm-1 dsRNA가 B.Xylophilus 유전자의 ppm-1 유전자의 발현을 효과적으로 억제할 수 있음을 나타내었다. 반면 외인성 GFP dsRNA는 ppm-1 발현에 영향을 미치지 않았다. RNAi 후, 성인의 크기는 성적 성숙에 도달했음에도 불구하고 현저하게 감소하여 작은 신체 크기의 돌연변이 표현형을 초래했습니다.돌연변이 암컷과 수컷의 평균 몸 길이는 대조군의 971 및 912 마이크로 미터에 비해 544 및 526 마이크로 미터였습니다 가장 중요한 것은 선충류를 이중 가닥 RNA 용액으로 옮기고 다른 시약을 추가하여 선충류를 자극하여 먹이는 것입니다. 이 방법은 대규모 유전자 스크리닝에 적합하며 일반적으로 세포 연구에 사용됩니다. 이 방법으로 B.Xylophilus의 유전자 기능을 연구하는 것은 B.Xylophilus의 생물학적 제어에 대한 지침 가치가 있습니다.

Research

JoVE Journal

Biology

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

HELA 세포 Transfection 얹는 Gaussia의 루시페라제의 mRNA의 시험 관내 스크립트 작성 및 상한에

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

연구

생물학

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

RNA 정제에 의한 염색질 절연 (처프)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

선충류의 바디 크기 규정에 참여 유전자에 대한 화면으로 RNA로 인한 간섭 수유 전략을 사용하여<em&gt; C. elegans</em

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

레드 밀가루 딱정벌레의 애벌레 RNA 간섭,<em&gt; Tribolium castaneum</em

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

파인 우드 선충의 관측 및 짝짓기 행동의 정량화,<em&gt; 소나무 재선충</em

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA 방해의 실용적인 사용: Liposome 캐리어 바퀴벌레에 대 한 이중 가닥 RNA의 구두 납품

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: 셀 형식 관련 Epigenome 프로 파일링

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

RNA-seq 데이터에서 대체 스플라이싱 및 폴리아데닐화 식별

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...