Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Esta investigación fue financiada por la Fundación Nacional de Ciencias Naturales de China (31870637, 31200487) y financiada conjuntamente por el Plan de Investigación Clave de Zhejiang (2019C02024, LGN22C160004).

El estudio fue aprobado por el consejo de experimentación animal de la Universidad Agrícola y Forestal de Zhejiang. El aislado de B. xylophilus NXY61 fue extraído originalmente de un Pinus massoniana enfermo en el área de Ningbo de la provincia de Zhejiang, China11.
1. Clonación de genes
NOTA: Consulte la Tabla de materiales para obtener detalles sobre los cebadores utilizados en este pro...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

Aunque la historia de vida y el entorno parasitario de B. xylophilus son diferentes de los de otros nematodos, ha habido investigaciones limitadas sobre la patogénesis molecular de este patógeno vegetal. A pesar de los grandes avances realizados en la aplicación de la tecnología de edición del genoma CRISPR/Cas9 en C. elegans y otros nematodos, hasta la fecha sólo se ha publicado la tecnología RNAi aplicada a B. xylophilus 17. El ARNi es una de las herramientas m?...

Los nematodos parásitos de plantas (PPN) son una amenaza continua para la seguridad alimentaria y los ecosistemas forestales. Causan un estimado de 100 mil millones de dólares en pérdidas económicas cada año1, los más problemáticos de los cuales son principalmente nematodos del nudo de la raíz, nematodos del quiste y nematodos de la madera del pino. El nematodo de la madera del pino, Bursaphelenchus xylophilus, es un nematodo endoparásito migratorio, que es el patógeno causal de la enfermedad del marchitamiento del pino2. Ha causado un gran daño a los bosques de pinos en todo el mundo3. Usando la terminología de Van Megen et al.4, B. xylophilus es un miembro de Parasitaphelenchidae y pertenece al clado 10, mientras que la mayoría de los otros parásitos principales de plantas pertenecen al clado 12.
Como parásito de plantas independiente y recientemente evolucionado, B. xylophilus es un modelo atractivo para estudios comparativos. Hasta la fecha, ha habido una investigación sustancial sobre los nematodos del nudo de la raíz y los nematodos del quiste pertenecientes al clado 12, que son endoparásitos sedentarios obligados y son algunos de los nematodos más intensamente estudiados. Sin embargo, realizar más investigaciones en esta importante área conlleva un gran desafío: la función de los genes del parasitismo es un cuello de botella de la investigación. Los estudios funcionales generalmente incluyen expresión ectópica y experimentos de knockdown/out, pero se basan en protocolos efectivos de transformación genética para el nematodo. Como resultado, la genética inversa en PPNs se basa casi exclusivamente en el silenciamiento génico por RNAi.
El ARNi, un mecanismo ampliamente presente en las células eucariotas, silencia la expresión génica mediante la introducción de ARN bicatenario (dsRNA)5. Hasta la fecha, el mecanismo de silenciamiento génico posttranscripcional inducido por dsRNA se ha encontrado en todos los eucariotas estudiados, y la tecnología de ARNi, como herramienta de investigación genómica funcional y otras aplicaciones, se ha desarrollado rápidamente en muchos organismos. Desde el descubrimiento de la maquinaria de ARNi en Caenorhabditis elegans en 19986, las técnicas de ARNi se han convertido en métodos eficaces para identificar la función génica de los nematodos y se proponen como una nueva forma de controlar eficazmente los nematodos patógenos7.
El ARNi es técnicamente fácil: empapar los juveniles en dsRNA puede ser suficiente; Sin embargo, la eficacia y reproducibilidad de este enfoque varían ampliamente con las especies de nematodos y el gen diana8. El silenciamiento de 20 genes implicados en las vías de ARNi del nematodo del nudo radicular, Meloidogyne incognita, fue investigado utilizando dsRNAs largos como desencadenantes, resultando en diversas respuestas, incluyendo un aumento y ningún cambio en la expresión de algunos genes9. Estos resultados muestran que los genes diana pueden responder a la eliminación de ARNi de manera diferente, lo que requiere una evaluación exhaustiva de su idoneidad como objetivos para el control de nematodos a través de ARNi. Sin embargo, actualmente hay una escasez de investigación sobre la biología del desarrollo y la reproducción de B. xylophilus.
Como continuación del trabajo anterior10,11,12,13, describimos aquí un protocolo para aplicar RNAi para estudiar la función del gen ppm-1 de B. xylophilus, incluida la síntesis de dsRNA, el remojo de neuroestimulantes sintéticos y la detección cuantitativa de la reacción en cadena de la polimerasa (qPCR). El conocimiento obtenido de este enfoque experimental probablemente contribuirá notablemente a comprender los sistemas biológicos básicos y prevenir la enfermedad del marchitamiento del pino.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

El nematodo de la madera del pino, Bursaphelenchus xylophilus, es una de las especies invasoras más destructivas del mundo, causando el marchitamiento y eventual muerte de los pinos. A pesar del reconocimiento de su importancia económica y ambiental, hasta ahora ha sido imposible estudiar las funciones genéticas detalladas de los nematodos parásitos de plantas (PPN) utilizando la genética directa convencional y los métodos transgénicos. Sin embargo, como tecnología de genética inversa, la interferencia de ARN (ARNi) facilita el estudio de los genes funcionales de los nematodos, incluido B. xylophilus. 
Este documento describe un nuevo protocolo para el ARNi del gen ppm-1 en B. xylophilus, que se ha informado que desempeña un papel crucial en el desarrollo y la reproducción de otros nematodos patógenos. Para el ARNi, el promotor T7 se unió al terminal 5' del fragmento objetivo mediante la reacción en cadena de la polimerasa (PCR), y el ARN bicatenario (dsRNA) se sintetizó mediante transcripción in vitro . Posteriormente, la administración de dsRNA se logró empapando los nematodos en una solución de dsRNA mezclada con neuroestimulantes sintéticos. Los juveniles sincronizados de B. xylophilus (aproximadamente 20.000 individuos) se lavaron y remojaron en dsRNA (0,8 μg/mL) en el tampón de remojo durante 24 h en la oscuridad a 25 °C.
La misma cantidad de nematodos se colocó en un tampón de remojo sin dsRNA como control. Mientras tanto, otra cantidad idéntica de nematodos se colocó en un tampón de remojo con el gen dsRNA de la proteína fluorescente verde (gfp) como control. Después del remojo, el nivel de expresión de las transcripciones objetivo se determinó mediante PCR cuantitativa en tiempo real. Los efectos del ARNi se confirmaron mediante la observación microscópica de los fenotipos y una comparación del tamaño corporal de los adultos entre los grupos. El protocolo actual puede ayudar a avanzar en la investigación para comprender mejor las funciones de los genes de B. xylophilus y otros nematodos parásitos hacia el desarrollo de estrategias de control a través de la ingeniería genética.

Análisis de la expresión de ppm-1 de B. xylophilus después de RNAi El nivel de expresión relativo del gen ppm-1 de B. xylophilus empapado con GFP dsRNA y el empapado con el gen diana dsRNA fue de 0,92 y 0,52, respectivamente (el nivel de expresión génica ppm-1 del grupo control tratado conddH2O se estableció en 1) (Figura 1). Por lo tanto, ...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Aquí, presentamos un método detallado de remojo de interferencia de ARN en Bursaphelenchus xylophilus para facilitar el estudio de las funciones de los genes.

Aplicación de la interferencia de ARN en el nematodo de la madera de pino, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

El ARNi se ha convertido en un método eficaz para identificar la función de los genes en los nematodos y se proponen como una nueva forma de controlar eficazmente los nematodos patógenos. El ARNi está empapando nematodos en dsRNA puede ser suficiente para el procedimiento. Para comenzar, recoge los nematodos por el método del embudo de Baermann.Para esto, coloque un tubo de goma sujetado debajo de un embudo y coloque dos capas de papel de filtro en la boca del embudo. Transfiera los cultivos fúngicos de Botrytis cinerea al embudo y agregue agua para sumergir la estera fúngica. Cuando se recolecten nematodos, agregue 500 microlitros de reactivo de extracción y 100 microlitros de perlas magnéticas a un tubo de centrífuga de dos mililitros.Aspirar 20 microlitros de los nematodos y moler las muestras a 9, 000 x g durante 30 segundos. Incubar durante cinco minutos y centrifugar a 12, 000 x g durante 10 minutos a cuatro grados centígrados. Transfiera el sobrenadante a un tubo de centrífuga nuevo.Añadir 100 microlitros de cloroformo y mezclar invirtiendo el tubo varias veces. Incubar durante tres minutos y luego centrifugar a 12, 000 x g durante 10 minutos a cuatro grados centígrados. Nuevamente, transfiera el sobrenadante a un tubo de centrífuga nuevo.Agregue 250 microlitros de alcohol isopropílico y vortex vigorosamente. Centrifugar a 12, 000 x g durante 10 minutos y vórtice. Deseche el sobrenadante y agregue 500 microlitros de etanol al 75% para lavar el ARN.Vortex la muestra seguida de centrifugación a 12, 000 x g durante cinco minutos a cuatro grados centígrados. Seque al aire el pellet de ARN durante cinco minutos y vuelva a suspenderlo en 30 microlitros de agua libre de RNasa. Calcule la concentración de ARN utilizando esta fórmula y calcule la proporción A260 a A280.A continuación, use un par de cebadores para amplificar la secuencia de codificación parcial del gen BX ppm-1 del B.xylophilus. Luego clone las secuencias del gen ppm-1 en un vector pGEM-T Easy que contiene el promotor T7. Recuperar el fragmento de gen ppm-1 largo del par de bases 894 utilizando el plásmido clonado como plantilla para pcr.Luego, use un kit de transcripción in vitro para sintetizar el dsRNA. Analice la calidad del dsRNA utilizando un espectrofotómetro y visualice los productos en un gel de agarosa al 1%. Agregue cuatro microlitros de tampón de remojo 5X y enrase el volumen a 20 microlitros con agua destilada doble para obtener una concentración final de ARN de 0.8 microgramos por mililitro.Luego coloque los nematodos en el plato durante 30 minutos y espere a que los huevos se adhieran al fondo. Retire con cuidado el agua y los nematodos sin alterar los huevos hasta que solo los huevos permanezcan en el plato. Incubar los huevos recolectados en la oscuridad a 25 grados centígrados durante 24 horas para obtener larvas J2.Recoja las larvas en un tubo y lávelas tres veces con agua destilada doble. Luego, transfiera las larvas al tubo que contiene la solución de dsRNA. A esto, agregue la solución de resorcinol para obtener una solución al 1%.Coloque las larvas en una mesa de agitación para asegurar una absorción suficiente de dsRNA en las larvas. Para los controles, remoje la misma cantidad de nematodos en el tampón de remojo sin la sonda dsRNA o con una sonda GFP dsRNA. Realizar una qPCR utilizando los genes actB y tbb-2 como referencias internas para evaluar los cambios en el nivel de expresión génica.Utilice el método delta delta Ct para estimar el nivel relativo de expresión génica a partir de la curva de disolución y el valor de Ct. Después del ARNi, cultivar las larvas J2 hasta la edad adulta en céspedes de Botrytis cinerea en placas PDA. Recoja a los adultos utilizando el método del embudo de Baermann, como se muestra en la sección uno.Adquiera imágenes de los nematodos adultos bajo un microscopio y use el software ImageJ para medir la longitud corporal de 50 nematodos machos y 50 hembras. Analice los datos calculando la media y la desviación estándar para cada muestra. Aplicar la prueba t de Student para comparar las medias de las muestras de los diferentes grupos.El análisis relativo de la expresión génica después del ARNi indicó que el ppm-1 dsRNA puede inhibir eficazmente la expresión del ppm-1 un gen de B.Xylophilus. Mientras que el dsRNA exógeno de GFP no tuvo ningún efecto sobre la expresión de ppm-1. Después del ARNi, el tamaño de los adultos disminuyó notablemente a pesar de alcanzar la madurez sexual, lo que resultó en el fenotipo mutante de tamaño corporal pequeño.La longitud corporal media de las hembras y machos mutantes fue de 544 y 526 micrómetros en comparación con 971 y 912 micrómetros para el grupo de control. Este método es adecuado para la detección de genes a gran escala y se usa comúnmente en la investigación celular. El estudio de la función génica de B.Xylophilus por este método tiene un valor orientador para el control biológico de B.Xylophilus.

Research

JoVE Journal

Biology

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

En la transcripción in vitro y la nivelación de mRNA de luciferasa Gaussia Seguido por transfección de células HeLa

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Investigación

Biología

Chromatin Isolation by RNA Purification (ChIRP)

Chromatin Isolation by RNA Purification ChIRP

Aislamiento de la cromatina mediante la purificación de ARN (chirp)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

El uso de ARN de interferencia mediada estrategia de alimentación para la detección de genes implicados en la regulación del cuerpo Tamaño del nematodo<em&gt; C. elegans</em

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

La interferencia de ARN de las larvas en la Red Escarabajo de Harina,<em&gt; Tribolium castaneum</em

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

La observación y cuantificación de la conducta de apareamiento en el nematodo del pino,<em&gt; Bursaphelenchus xylophilus</em

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

Uso práctico de ARN de interferencia: administración Oral de ARN bicatenario en liposomas portadores para las cucarachas

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

TChIP-Seq: Perfiles de celular-tipo-específico epigenoma

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

Identificación de empalme alternativo y poliadenilación en datos de RNA-seq

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...