Name: construction of a human aorta smooth muscle cell organ-on-a-chip model for recapitulating biomechanical strain in the aortic wall
Uploaded: 2022-07-06T14:00:00
Description: Watch this Scientific Journal Video about Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall at JoVE.com

저자는이 작업이 상하이시 과학 기술위원회 (20ZR1411700), 중국 국립 자연 과학 재단 (81771971) 및 상하이 항해 프로그램 (22YF1406600)의 보조금으로 지원되었음을 인정합니다.

인간 대동맥 검체는 중산 병원, 푸단대학교 윤리위원회(NO. B2020-158). 대동맥 표본은 푸단 대학교 중산 병원에서 상행 대동맥 수술을받은 환자로부터 수집되었습니다. 참여 전에 모든 환자로부터 서면 사전 동의를 얻었습니다.
1. 일차 인간 대동맥 평활근 세포 분리
<ol><li>상행 대동맥의 오른쪽 측면 부위를 멸균 PBS, 1x-2x로 씻으십시오.</li>
	<li>두 개의 안과 겸자로 ...

<ol>
	<li>Olsson, C., Thelin, S., St&#229;hle, E., Ekbom, A., Granath, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+aortic+aneurysm+and+dissection:+increasing+prevalence+and+improved+outcomes+reported+in+a+nationwide+population-based+study+of+more+than+14,000+cases+from+1987+to+2002.">Thoracic aortic aneurysm and dissection: increasing prevalence and improved outcomes reported in a nationwide population-based study of more than 14,000 cases from 1987 to 2002.</a> Circulation. 114 (24), 2611-2618 (2006).</li><li>van Varik, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+arterial+remodeling:+lessons+from+genetic+diseases.">Mechanisms of arterial remodeling: lessons from genetic diseases.</a> Frontiers in Genetics. 3 (290), 1-10 (2012).</li><li>Halka, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+stretch+on+vascular+smooth+muscle+cell+phenotype+in+vitro.">The effects of stretch on vascular smooth muscle cell phenotype in vitro.</a> Cardiovascular Pathology. 17 (2), 98-102 (2008).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+wall+stress+induces+phenotypic+switching+of+arterial+smooth+muscle+cells+in+vascular+remodeling+by+activating+the+YAP/TAZ+signaling+pathway.">Arterial wall stress induces phenotypic switching of arterial smooth muscle cells in vascular remodeling by activating the YAP/TAZ signaling pathway.</a> Cellular Physiology and Biochemistry. 51 (2), 842-853 (2018).</li><li>Fabre, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+to+a+manuscript+series+on+the+characterization+and+use+of+microphysiological+systems+(MPS)+in+pharmaceutical+safety+and+ADME+applications.">Introduction to a manuscript series on the characterization and use of microphysiological systems (MPS) in pharmaceutical safety and ADME applications.</a> Lab on a Chip. 20, 1049-1057 (2020).</li><li>Golding, H., Khurana, S., Zaitseva, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+the+predictive+value+of+animal+models+for+vaccine+efficacy+in+humans?+The+importance+of+bridging+studies+and+species-independent+correlates+of+protection.">What is the predictive value of animal models for vaccine efficacy in humans? The importance of bridging studies and species-independent correlates of protection.</a> Cold Spring Harbor Perspectives in Biology. 10 (4), 028902 (2018).</li><li>Ingber, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+organs-on-chips+for+disease+modelling,+drug+development+and+personalized+medicine.">Human organs-on-chips for disease modelling, drug development and personalized medicine.</a> Nature Reviews. Genetics. 25, 1-25 (2022).</li><li>Niu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip+for+odontoblasts+in+vitro.">Microfluidic chip for odontoblasts in vitro.</a> ACS Biomaterials Science &amp; Engineering. 5 (9), 4844-4851 (2019).</li><li>Huh, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reconstituting+organ-level+lung+functions+on+a+chip.">Reconstituting organ-level lung functions on a chip.</a> Science. 328 (5986), 1662-1668 (2010).</li><li>Musah, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mature+induced-pluripotent-stem-cell-derived+human+podocytes+reconstitute+kidney+glomerular-capillary-wall+function+on+a+chip.">Mature induced-pluripotent-stem-cell-derived human podocytes reconstitute kidney glomerular-capillary-wall function on a chip.</a> Nature Biomedical Engineering. 1 (69), 1-25 (2017).</li><li>Yoon No, D., Lee, K. H., Lee, J., Lee, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+liver+models+on+a+microplatform:+well-defined+culture,+engineering+of+liver+tissue+and+liver-on-a-chip.">3D liver models on a microplatform: well-defined culture, engineering of liver tissue and liver-on-a-chip.</a> Lab on a Chip. 15 (19), 3822-3837 (2015).</li><li>Bein, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ-on-a-chip+models+of+human+intestine.">Microfluidic organ-on-a-chip models of human intestine.</a> Cellular and Molecular Gastroenterology and Hepatology. 5 (4), 659-668 (2018).</li><li>Jastrzebska, E., Tomecka, E., Jesion, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart-on-a-chip+based+on+stem+cell+biology.">Heart-on-a-chip based on stem cell biology.</a> Biosensors &amp; Bioelectronics. 75 (1), 67-81 (2016).</li><li>Rensen, S. S., Doevendans, P. A., van Eys, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+and+characteristics+of+vascular+smooth+muscle+cell+phenotypic+diversity.">Regulation and characteristics of vascular smooth muscle cell phenotypic diversity.</a> Netherlands Heart Journal. 15 (3), 100-108 (2007).</li><li>Perestrelo, A. R., &#193;guas, A. C., Rainer, A., Forte, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ/body-on-a-chip+devices+at+the+convergence+of+biology+and+microengineering.">Microfluidic organ/body-on-a-chip devices at the convergence of biology and microengineering.</a> Sensors. 15 (12), 31142-31170 (2015).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+cancer-on-a-chip+for+drug+screening.">Construction of cancer-on-a-chip for drug screening.</a> Drug Discovery Today. 26 (8), 1875-1890 (2021).</li><li>Yang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+organ-on-a-chip+to+improve+cell+capture+efficiency.">Design of organ-on-a-chip to improve cell capture efficiency.</a> International Journal of Mechanical Sciences. 209, 106705 (2021).</li><li>Yang, Q., Lian, Q., Xu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perspective:+Fabrication+of+integrated+organ-on-a-chip+via+bioprinting.">Perspective: Fabrication of integrated organ-on-a-chip via bioprinting.</a> Biomicrofluidics. 11 (3), 031301 (2017).</li><li>Mohammed, M. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+of+microfluidic+devices:+improvement+of+surface+quality+of+CO2+laser+machined+poly+(methylmethacrylate)+polymer.">Fabrication of microfluidic devices: improvement of surface quality of CO2 laser machined poly (methylmethacrylate) polymer.</a> Journal of Micromechanics and Microengineering. 27 (1), 015021 (2017).</li><li>Tsao, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymer+microfluidics:+Simple,+low-cost+fabrication+process+bridging+academic+lab+research+to+commercialized+production.">Polymer microfluidics: Simple, low-cost fabrication process bridging academic lab research to commercialized production.</a> Micromachines. 7 (12), 225-236 (2016).</li><li>Kirschbaum, S. E., Baeumner, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+electrochemiluminescence+(ECL)+in+and+for+microfluidic+analytical+devices.">A review of electrochemiluminescence (ECL) in and for microfluidic analytical devices.</a> Analytical and Bioanalytical Chemistry. 407 (14), 3911-3926 (2015).</li><li>Stefanadis, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pressure-diameter+relation+of+the+human+aorta.+A+new+method+of+determination+by+the+application+of+a+special+ultrasonic+dimension+catheter.">Pressure-diameter relation of the human aorta. A new method of determination by the application of a special ultrasonic dimension catheter.</a> Circulation. 92 (8), 2210-2219 (1995).</li><li>Williams, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+influences+on+vascular+smooth+muscle+cell+function.">Mechanical influences on vascular smooth muscle cell function.</a> Journal of Hypertension. 16 (12), 1921-1929 (1998).</li><li>Abudupataer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aorta+smooth+muscle-on-a-chip+reveals+impaired+mitochondrial+dynamics+as+a+therapeutic+target+for+aortic+aneurysm+in+bicuspid+aortic+valve+disease.">Aorta smooth muscle-on-a-chip reveals impaired mitochondrial dynamics as a therapeutic target for aortic aneurysm in bicuspid aortic valve disease.</a> eLife. 10, 69310 (2021).</li><li>Poussin, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3d+human+microvessel-on-a-chip+model+for+studying+monocyte-to-endothelium+adhesion+under+flow+-+application+in+systems+toxicology.">3d human microvessel-on-a-chip model for studying monocyte-to-endothelium adhesion under flow - application in systems toxicology.</a> Altex. 1, 47-63 (2020).</li><li>Yasotharan, S., Pinto, S., Sled, J. G., Bolz, S., Gunther, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artery-on-a-chip+platform+for+automated,+multimodal+assessment+of+cerebral+blood+vessel+structure+and+function.">Artery-on-a-chip platform for automated, multimodal assessment of cerebral blood vessel structure and function.</a> Lab on a Chip. 15, 2660-2669 (2015).</li></ol>

미세유체 기술의 급속한 발전과 함께, 시험관내에서 하나 이상의 기관의 생물학적 기능 및 구조를 복제할 수 있는 OOC 모델이 최근 몇 년 동안 생물학, 의학 및 약리학15에 응용하기 위해 등장했습니다. OOC는 질병 메커니즘을 탐구하고 전임상 약물 번역 8,16을 촉진하는 데 필수적인 인간 생리적 미세 환경의 주요 기능을 시뮬레이?...

흉부 대동맥류 및 박리(TAAD)는 높은 이환율 및사망률과 관련된 대동맥벽의 국부적인 확장 또는 박리입니다1. 인간 대동맥 평활근 세포 (HASMC)는 TAAD의 발병 기전에 중요한 역할을합니다. HASMC는 말기 분화 세포가 아니며 HASMC는 높은 가소성을 유지하여 다른 자극에 반응하여 표현형을 전환 할 수 있습니다2. HASMC는 주로 생체 내에서 리드미컬한 인장 변형을 받으며, 이는 평활근 형태학적 변화, 분화 및 생리적 기능을 조절하는 핵심 요소 중 하나입니다3,4. 따라서 HASMC 연구에서 주기적 변형의 역할은 무시할 수 없습니다. 그러나 기존의 2D 세포 배양은 생체 내에서 HASMC가 경험하는 주기적 변형의 생체 역학적 자극을 복제할 수 없습니다. 또한, 동물 TAAD 모델의 구성은 이첨판 대동맥 판막 (BAV) 관련 TAAD와 같은 일부 유형의 TAAD에는 적합하지 않습니다. 또한 임상 인간 연구와 동물 실험 사이의 종 격차는 무시할 수 없습니다. 임상 실습에서 제약 번역을 방해합니다. 따라서, 대동맥 질환의 연구에서 생체 내 생체역학적 환경을 시뮬레이션하기 위한 보다 복잡하고 생리학적 시스템에 대한 절실한 요구가 존재한다.
생물 의학 연구 및 약물 개발에 사용되는 동물 실험은 비용이 많이 들고 시간이 많이 걸리며 윤리적으로 의심 스럽습니다. 또한 동물 연구 결과는 인간 임상 시험 5,6에서 얻은 결과를 예측하지 못하는 경우가 많습니다. 인간 전임상 모델의 부족과 임상 시험의 높은 실패율로 인해 클리닉에 효과적인 약물이 거의 없어 의료 비용이 증가했습니다7. 따라서 동물 모델을 보완 할 다른 실험 모델을 찾는 것이 시급합니다. 미세 가공 및 미세 유체 기술은 최근 몇 년 동안 크게 발전하여 기존 2D 세포 배양 기술의 단점을 해결하고 생리 연구 및 약물 개발을 위한 보다 현실적이고 저렴하며 효율적인 체외 모델을 구축하는 오가노이드 온어칩 모델을 구축하기 위한 새로운 기술을 제공합니다. 미세 유체 장치를 사용하여 조직 또는 기관의 주요 기능을 복제하기 위해 다양한 자극을 가진 마이크로 미터 크기의 챔버에서 살아있는 세포를 배양하기 위해 장기 온 칩이 설정됩니다. 이 시스템은 단일 또는 다중 미세 유체 마이크로 채널로 구성되며, 관류 챔버에서 배양 된 한 종류의 세포가 한 조직 유형의 기능을 복제하거나 다공성 막에서 배양 된 다른 세포 유형을 사용하여 서로 다른 조직 간의 인터페이스를 재현합니다. 환자 유래 세포와 결합된 미세유체 기반 오가노이드는 마우스와 인간 질병 모델 간의 큰 종 차이를 해소하고 질병 메커니즘 연구 및 약물 발견을 위한 기존 2D 세포 배양의 단점을 극복하는 고유한 이점이 있습니다. 지난 몇 년 동안 미세 유체 공학의 급속한 발전으로 연구자들은 복잡한 생체 내 생물학적 매개 변수를 복제하는 시험관 내 장기 온 칩 (OOC) 모델의 유용성을 깨달았습니다8. 이러한 미세유체 오가노이드는 주기적 변형률, 전단 응력 및 액체 압력과 같은 체외 생체역학 환경을 시뮬레이션하여 3차원(3D) 세포 배양 환경을 제공합니다. 현재까지 폐9, 신장10, 간 11, 장 12 및 심장 13과 같은 기관에서 생체 역학적 자극을 시뮬레이션하기 위해 여러 OOC 모델이 확립되었지만 인간 대동맥 질환 연구에는 널리 적용되지 않았습니다.
이 연구에서는 TAAD 환자 유래 1차 HASMC에 적용되는 생체모방적 기계적 힘과 리듬을 제어할 수 있는 인간 대동맥 평활근 세포 장기 온어칩(HASMC-OOC) 모델을 제시합니다. 이 칩은 채널로 에칭 된 폴리 디메틸 실록산 (PDMS)의 3 층 두꺼운 판과 2 개의 상용화 된 매우 유연한 PDMS 멤브레인으로 구성됩니다. HASMC는 PDMS 막에서 배양됩니다. 칩의 중간에 있는 채널은 세포 배양을 위한 배양 배지로 채워진다. 칩의 상단 및 하단 채널은 PDMS 멤브레인의 기계적 인장 변형의 리듬과 주파수를 제어 할 수있는 진공 압력 공급 시스템에 연결됩니다. HASMC가 경험하는 리드미컬한 변형은 HASMC-OOC에서 시뮬레이션할 수 있으며, 기존의 2D 배양 시스템으로는 기능적으로 달성할 수 없는 조직 또는 기관의 생체역학적 미세 환경을 복제할 수 있습니다. 고해상도, 실시간 이미징 및 생체 역학적 미세 환경의 장점으로 살아있는 세포의 생화학적, 유전 및 대사 활성을 조직 발달, 장기 생리학, 질병 병인학, 분자 메커니즘 및 바이오마커 식별, 심혈관 질환 및 대동맥 질환에 대해 연구할 수 있습니다. 조직 특이적 세포 및 환자 세포와 결합된 이 시스템은 약물 스크리닝, 개인화된 의학 및 독성 테스트에 사용할 수 있습니다. 이 HASMC-OOC 모델은 대동맥 질환의 발병기전을 연구하기 위한 새로운 시험관내 플랫폼을 제공한다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>4% paraformaldehyde</td>
			<td>Beyotime</td>
			<td>P0099-100ml</td>
			<td>Used for cell immobilization</td>
		</tr>
		<tr>
			<td>Alexa Fluor 350-labeled Goat Anti-Rabbit IgG</td>
			<td>Beyotime</td>
			<td>A0408</td>
			<td>Antibodies used for immunostaining</td>
		</tr>
		<tr>
			<td>Bovine serum albumin</td>
			<td>Beyotime</td>
			<td>ST025-20g</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium AM/PI</td>
			<td>Invitrogen</td>
			<td>L3224</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture flask&#160;</td>
			<td>Corning</td>
			<td>430639</td>
			<td></td>
		</tr>
		<tr>
			<td>CNN1</td>
			<td>Abcam&#160;</td>
			<td>Ab46794</td>
			<td></td>
		</tr>
		<tr>
			<td>Commercial flexible 
			PDMS membrane</td>
			<td>Hangzhou Bald Advanced Materials</td>
			<td>KYQ-200</td>
			<td></td>
		</tr>
		<tr>
			<td>F-actin</td>
			<td>Invitrogen</td>
			<td>R415</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Sigma</td>
			<td>M8318</td>
			<td></td>
		</tr>
		<tr>
			<td>Hoses</td>
			<td>Runze Fluid</td>
			<td>96410</td>
			<td>1 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com</td>
		</tr>
		<tr>
			<td>Human aortic smooth 
			muscle cell line CRL1999</td>
			<td>ATCC</td>
			<td>Lot Number:70019189</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>Imagej.net/fiji/downloads</td>
			<td>Free Download: https://fiji.sc</td>
			<td>Imaging platform that is used to identify fluorescence intensity</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Ensures that the temperature, 
			humidity, and light exposure is 
			exactly the same throughout 
			experiment.</td>
		</tr>
		<tr>
			<td>Luer</td>
			<td>Runze Fluid</td>
			<td>RH-M016</td>
			<td>Official website address: https://www.runzefluidsystem.com.</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>mouse collagen</td>
			<td>Sigma</td>
			<td>C7661</td>
			<td></td>
		</tr>
		<tr>
			<td>Oxygen plasma&#160;</td>
			<td>Changzhou Hongming Instrument</td>
			<td>HM-Plasma5L</td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipette</td>
			<td>Biologix</td>
			<td>30-0138A1</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Beyotime</td>
			<td>C0221A</td>
			<td></td>
		</tr>
		<tr>
			<td>Pen-Strep</td>
			<td>Sigma</td>
			<td>P4458-100ml</td>
			<td>Antibiodics used to prevent bacterial 
			contamination of cells during culture.</td>
		</tr>
		<tr>
			<td>peristaltic pump</td>
			<td>Kamoer</td>
			<td>F01A-STP-B046</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Corning</td>
			<td>430167</td>
			<td></td>
		</tr>
		<tr>
			<td>PLC controller</td>
			<td>Zhejiang Jun Teng (BenT) CNC factory</td>
			<td>BR010-11T8X2M</td>
			<td>The detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net</td>
		</tr>
		<tr>
			<td>polydimethylsiloxane (PDMS)</td>
			<td>Dow Corning</td>
			<td>Sylgard 184</td>
			<td></td>
		</tr>
		<tr>
			<td>SM22</td>
			<td>Abcam&#160;</td>
			<td>ab14106</td>
			<td></td>
		</tr>
		<tr>
			<td>SMCM</td>
			<td>ScienCell</td>
			<td>Cat 1101</td>
			<td></td>
		</tr>
		<tr>
			<td>solenoid valve</td>
			<td>SMC (China)</td>
			<td>VQZ300</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Becton,Dickinson and Company</td>
			<td>300841</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X 100</td>
			<td>Beyotime</td>
			<td>ST795</td>
			<td>To penetrate cell membranes</td>
		</tr>
		<tr>
			<td>Trizol</td>
			<td>Invitrogen</td>
			<td>10296010</td>
			<td>Used for RNA extraction</td>
		</tr>
		<tr>
			<td>trypsin</td>
			<td>Sigma</td>
			<td>15400054</td>
			<td></td>
		</tr>
		<tr>
			<td>vacuum filter</td>
			<td>SMC (China)</td>
			<td>ZFC5-6</td>
			<td>Official website address: https://www.smc.com.cn</td>
		</tr>
		<tr>
			<td>vacuum pump</td>
			<td>Kamoer</td>
			<td>KVP15-KL-S</td>
			<td></td>
		</tr>
		<tr>
			<td>vacuum regulator</td>
			<td>AirTAC</td>
			<td>GVR-200-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer Name</td>
			<td>Forward (5&#8217; to 3&#8217;)</td>
			<td>Reverse (5&#8217; to 3&#8217;)</td>
			<td></td>
		</tr>
		<tr>
			<td>SM22</td>
			<td>CCGTGGAGATCCCAACTGG</td>
			<td>CCATCTGAAGGCCAATGACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>CNN1</td>
			<td>CTCCATTGACTCGAACGACTC</td>
			<td>CAGGTCTGCGAAACTTCTTAGA</td>
			<td></td>
		</tr>
	</tbody>
</table>

construction of a human aorta smooth muscle cell organ-on-a-chip model for recapitulating biomechanical strain in the aortic wall

종래의 2차원 세포 배양 기술 및 동물 모델은 인간 흉부 대동맥류 및 박리(TAAD)의 연구에 사용되어 왔다. 그러나, 인간 TAAD는 때때로 동물 모델에 의해 특성화될 수 없다. 임상 인간 연구와 동물 실험 사이에는 치료 약물의 발견을 방해 할 수있는 명백한 종 차이가 있습니다. 대조적으로, 종래의 세포 배양 모델은 생체 내 생체 역학적 자극을 시뮬레이션할 수 없다. 이를 위해 최근 몇 년 동안 미세 가공 및 미세 유체 기술이 크게 발전하여 생체 역학적 미세 환경을 복제하는 유기체 온 칩 모델을 구축하기위한 새로운 기술을 제공합니다. 이 연구에서는 TAAD에서 중요한 역할을 하는 인간 대동맥 평활근 세포(HASMC)가 경험하는 주기적 변형의 진폭 및 빈도를 포함하여 대동맥 생체역학의 병태생리학적 매개변수를 시뮬레이션하기 위해 인간 대동맥 평활근 세포 장기 온어칩(HASMC-OOC) 모델을 개발했습니다. 이 모델에서 HASMC의 형태는 모양이 길어지고 변형 방향에 수직으로 정렬되었으며 정적 기존 조건보다 변형 조건에서 더 수축적인 표현형을 나타냅니다. 이것은 천연 인간 대동맥 벽의 세포 방향 및 표현형과 일치했습니다. 또한, 이첨판 대동맥판막 관련 TAAD(BAV-TAAD) 및 삼첨판 대동맥판막 관련 TAAD(TAV-TAAD) 환자 유래 1차 HASMC를 사용하여 TAAD에서 HASMC 특성을 복제하는 BAV-TAAD 및 TAV-TAAD 질환 모델을 구축했습니다. HASMC-OOC 모델은 TAAD의 발병기전을 추가로 탐구하고 치료 표적을 발견하기 위해 동물 모델을 보완하는 새로운 시험관 내 플랫폼을 제공합니다.

HASMC-OOC 모델은 진공 제어 시스템, 순환 시스템 및 PDMS 칩과 HASMC-OOC 모델의 회로도 설계로 구성됩니다(그림 1). 진공 제어 시스템은 진공 펌프, 솔레노이드 밸브 및 PLC 컨트롤러로 구성됩니다. 순환 시스템으로 작용하기 위해 연동 펌프를 사용하여 세포 배양 배지를 새로 고치고 약물을 추가했습니다. PDMS 칩은 2개의 진공 챔버와 세포 성장을 위한 SMCM으로 채워진 중간 챔버로 ?...

Watch this Scientific Journal Video about Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall at JoVE.com

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

여기에서는 인간 대동맥 벽에서 평활근 세포의 생체 내 생체 역학적 변형을 복제하기 위해 인간 대동맥 평활근 세포 장기 온 칩 모델을 개발했습니다.

대동맥 벽의 생체 역학적 변형을 요약하기 위한 인간 대동맥 평활근 세포 장기 온 칩 모델 구축

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection ...

이 모델은 인간 대동맥의 평활근 세포가 경험하는 생체 역학적 자극을 자극합니다. 환자 유래 세포와 결합하여이 시스템은 대동맥 질환의 약물 스크리닝 및 개인화 된 의학에 사용할 수 있습니다. 이 모델은 인간 대동맥에서 평활근 세포의 기계적 매개 변수를 모방하고 정밀하게 제어 할 수 있으며, 이는 대동맥 질환의 연구 및 병인을위한 새로운 시험관 내 플랫폼을 제공합니다.절차를 시연하는 것은 우리 실험실의 포스터 의사 인 Mieradilijiang Abudubat입니다. 상행 대동맥의 오른쪽 측면 영역을 멸균 pbs로 한두 번 씻어서 시작하십시오. 두 개의 안과 겸자로 조직의 내막과 외막층을 제거하고 배지 층을 유지하여 세포를 수확합니다.미디어 레이어를 10cm 접시에 놓고 2-3mm 조각으로 자릅니다. 그런 다음 10 % fbs 및 1 % 페니실린 스트렙토 마이신을 함유 한 SMCM 5 밀리리터를 조직 샘플에 첨가하십시오. 멸균 점 적기로 작은 조직을 배양 병에 넣고 조직을 고르게 펴십시오.배양 배지는 가능한 한 폐기하십시오. 그런 다음 병을 거꾸로 뒤집습니다. 거꾸로 된 배양 병에 2 밀리리터의 SMCM을 넣고 섭씨 37도에서 5 % 이산화탄소와 함께 인큐베이터에 1-2 시간 동안 넣습니다.그런 다음 천천히 오른쪽을 위로 돌리고 SMCM 2 밀리리터를 더 추가하십시오. 5-7 일의 배양 후 SMCM을 4 밀리리터의 신선한 SMCM으로 교환하십시오. 미디어를 변경할 때 SMCM을 천천히 버리고 추가하십시오.일반적으로 산발성 평활근 세포는 약 2 주 후에 사라집니다. 현미경 스테이션으로 이동할 때 배양 병을 부드럽게 운반하십시오. 그렇지 않으면 조직이 떠 다니고 세포가 천천히 자랍니다.세포가 자라면 4 밀리리터의 신선한 SMCM이 들어있는 두 개의 새로운 배양 병으로 나눕니다. 평활근 세포에 대한 4개의 특이적 마커의 면역형광 분석을 통해 세포를 확인합니다. PDMS를 중합하려면 경화제 또는 B 성분을 염기 또는 A 성분에 첨가하고 복합체를 5분 동안 혼합합니다.볼륨은 연구의 필요성에 따라 다릅니다. 준비된 PDMS 겔을 진공 추출 탱크에 30 내지 60 분 동안 넣고 압력을 음의 0.8 밀리 파스칼 이하로 유지한다. 컴퓨터 지원 설계 소프트웨어를 사용하여 금형을 설계하십시오.맞춤형은 고정밀 컴퓨터 수치 제어 조각 기계를 사용하여 3 층의 금형을 만듭니다. PMMA 플레이트를 사용하여 금형 프레임과 마이크로 채널을 조각 한 후 다른 플레이트에 붙입니다. 준비된 PDMS 젤을 설계된 몰드에 붓습니다.그런 다음 섭씨 70도에서 1-2 시간 동안 가교 연결합니다. 금형에서 가교 PDMS 슬래브를 떼어내고 상용화된 PDMS 멤브레인을 100mm x 40mm 섹션으로 자릅니다. 1mm 구멍 펀처를 사용하여 3개의 PDM 슬래브에 구멍을 뚫어 PDMS 칩의 공기 및 중간 마이크로 채널의 입구와 출구를 만듭니다.3개의 준비된 PDMS 슬래브 및 2개의 PDMS 멤브레인을 PDM 표면 활성화를 위해 5분 동안 산소 플라즈마로 처리한다. 실내 공기를 가스를 처리하고, 압력을 음의 100킬로파스칼로, 전류를 180-200밀리암페어 교각으로, 전압을 200볼트로, 처리 시간을 5분으로 설정합니다. 3 개의 PDMS 슬래브와 2 개의 PDMS 멤브레인을 실체 현미경으로 함께 접착하여 최상층이 공기 채널 PDMS 슬래브, PDMS 멤브레인으로 구성되도록합니다.중간 채널은 PDMS 슬래브, PDM 멤브레인으로 구성되며 하단 레이어는 공기 채널 PDMS 슬래브로 구성됩니다. 조립된 PDMS 칩을 섭씨 70도 인큐베이터에 1시간 동안 넣습니다. 여러 개의 1 밀리미터 내경과 3 센티미터 길이의 라텍스 호스를 준비하십시오.준비된 호스의 한쪽 끝에 1mm 외경과 1cm 길이의 스테인리스 스틸 바늘을 삽입합니다. 그런 다음 호스의 다른 쪽 끝에 루어를 삽입하여 PDMS 칩의 공기 및 중간 마이크로 채널에 연결된 튜브를 만듭니다. 준비된 튜브를 PDMS 칩의 공기 및 중간 마이크로 채널의 배출구와 입구에 삽입합니다.마우스 콜라겐 밀리리터당 80밀리그램의 2밀리리터를 2밀리리터 주사기를 사용하여 PDMs 칩의 배지 마이크로채널에 주입하고 실온에서 30분 동안 배양합니다. 배양 후 2 밀리리터 주사기로 채널에서 콜라겐을 제거하십시오. 콜라겐 코딩 PDMS 칩을 섭씨 60도 인큐베이터에 밤새 넣습니다.PDMS 칩을 UV 멸균기에 1시간 이상 두십시오. 세포 실험을 준비하기 위해 멸균된 PDMS 칩을 매우 깨끗한 벤치에 놓습니다. 2% FBS와 1% 페니실린 스트렙토마이신을 함유하는 SMCM을 사용하는 환자로부터 5개의 1차 인간 대동맥 평활근 세포를 섭씨 37도로 설정된 4회 배양합니다.평활근 세포 밀도가 80 %에 도달하면 SMCM을 버리고 2 밀리리터의 PPS로 세포를 씻으십시오. 1 밀리리터의 0.25 % 트립 신을 사용하여 세포를 2 분 동안 분해하고 100 RCF에서 5 분 동안 원심 분리합니다. 상청액을 제거하고 세포 펠릿을 1 밀리리터의 신선한 SMCM에 재현 탁시킵니다.8 밀리리터의 SMCM을 사용하여 10cm 배양 접시에서 세포를 배양하십시오. 세포분석기를 이용하여 세포수를 계산하고 밀리리터당 5개의 세포에 10배한 2배의 최종 농도로 진행한다. 콜라겐 코딩 및 멸균된 PDMS 칩 배지 마이크로채널에 2밀리리터의 PBS를 천천히 붓고 나중에 2밀리리터 주사기를 사용하여 버립니다.평활근 세포 현탁액 밀리리터당 5개의 세포 현탁액을 PDMS 칩의 배지 마이크로채널 내로 2회 10의 2 밀리리터를 천천히 붓는다. 그런 다음 PDMS 칩의 입구와 출구에서 루어를 닫습니다. PDMS 칩을 하루 동안 5 % 이산화탄소로 섭씨 37도로 설정된 인큐베이터에 넣습니다.배양 후 세포가 PDMS 칩의 PDMS 멤브레인에 부착되면 PDMS 칩의 공기 마이크로 채널 출구를 진공 컨트롤러 시스템에 연결합니다. 세포가 부착 될 때 길쭉한 정상 세포 형태가 현미경으로 보입니다. 매달린 둥근 세포와 대조됩니다.솔레노이드 밸브와 진공 펌프를 켭니다. 진공 조절기를 열고 변형률에 따라 압력 수준을 조정하십시오. 그런 다음 PDMS 칩과 5% 이산화탄소가 있는 섭씨 37도로 설정된 인큐베이터를 24시간 동안 놓습니다.여러 솔레노이드 밸브, 진공 필터, 진공 조절기, 진공 펌프, 연동 펌프 및 솔레노이드 밸브를 제어하는 PLC를 준비하십시오. PLC 컨트롤러를 프로그래밍하고 켜짐 꺼짐 시간 간격을 1헤르츠로 설정합니다. 솔레노이드 밸브를 프로그래밍된 컨트롤러에 연결합니다.진공 펌프의 입구를 진공 필터에 연결 한 다음 진공 필터의 출구를 진공 조절기에 연결합니다. 진공 조절기의 출구를 솔레노이드 밸브에 연결하십시오. 마지막으로 솔레노이드 밸브의 출구를 PDMS 칩의 공기 미세 채널 출구에 연결하십시오.배양 배지 교체 및 약물 취급을 위해 연동 펌프의 출구를 PDMS 칩의 배지 마이크로 채널 입구에 연결하고 연동 펌프의 입구를 배지 마이크로 채널 PDMS 칩의 출구에 연결합니다. 레귤레이터에 의한 변형률의 진폭과 마이크로 컨트롤러에 의한 변형률 주파수를 조정합니다. PDMS 칩에서 인간 대동맥 평활근 세포주인 CRL 1990의 생존율은 세포 배양의 3일 및 5일째에 살아있는 및 죽은 분석을 사용하여 추정하였다.세포 생존율은 3일째와 5일째에 90%보다 높게 나타났다. 세포골격 F-액틴 염색 결과, PDMS 칩에서 CRL 1990은 24시간 동안 연신한 후 균주에 수직으로 정렬된 세포와 정상 세포 형태를 보였다. 수축성 마커 SM22 및 CNN1의 면역형광은, 정적 조건에 비해 변형 조건 하에서 더 높았다.또한, SM22 및 CNN1 유전자는 평활근 세포의 변형 조건에서 상향 조절되었다. 환자 유래 1차 인간 대동맥 평활근 세포의 BAV 및 TAV, 흉부 대동맥류 및 해부의 F-actin 염색은 정상적인 세포 형태와 24시간 연신 후 균주 방향에 수직으로 정렬된 세포를 보였다. BAVTAAD 및 TAV 흉부 대동맥류 및 박리에서 SM22 및 CNN1 형광은 정적 조건에서보다 변형 조건에서 더 높았습니다.SM22 및 CNN1의 유전자 발현 수준과 유사하며, 이는 또한 정적 조건에 비해 균주 조건에서 상향 조절되었습니다. 1 차 HASMC를 분리 할 때 무균 원칙에주의를 기울여야합니다. PDMS 실험실과 멤브레인을 플라즈마로 처리 한 후에는 표면이 더러워지지 않아야합니다.이 프로토콜을 기반으로 내피 세포를 평활근 세포와 공동 배양 할 수 있으며 주기적 변형으로 세포에 순전한 스트레스를 주어 더 많은 기계적 힘을 추가로 시뮬레이션 할 수 있습니다.

Research

JoVE Journal

Bioengineering

Creating Two-Dimensional Patterned Substrates for Protein and Cell Confinement

단백질과 세포 교도소에 대한 2 차원 문양의 기판 만들기

Microcontact printing provides a rapid, highly reproducible method for the creation of well-defined patterned substrates.1  While microcontact printing ...

연구

생체공학

Directed Cellular Self-Assembly to Fabricate Cell-Derived Tissue Rings for Biomechanical Analysis and Tissue Engineering

자기 조립 셀룰러이 Biomechanical 분석 및 조직 공학을위한 셀 유래 조직 반지를 조작하는 감독

Each year, hundreds of thousands of patients undergo coronary artery bypass surgery in the United States.1 Approximately one third of these patients do ...

Rotating Cell Culture Systems for Human Cell Culture: Human Trophoblast Cells as a Model

인간 세포 배양을위한 회전 세포 배양 시스템 : 모델로 인간 Trophoblast 셀

The field of human trophoblast research aids in  understanding the complex environment established during placentation. Due to the  nature of these ...

Monitoring the Wall Mechanics During Stent Deployment in a Vessel

선박의 스텐 트를 배포하는 동안 벽 역학 모니터링

Clinical trials have reported different restenosis rates for various stent designs1. It is speculated that stent-induced strain concentrations on the ...

Improved Method for the Preparation of a Human Cell-based, Contact Model of the Blood-Brain Barrier

방법 혈액 - 뇌 장벽의 인간 세포 기반의 연락 모델의 준비를 위해 개선

The blood-brain barrier (BBB) comprises impermeable but adaptable brain capillaries which tightly control the brain environment. Failure of the BBB has ...

Tissue Engineering: Construction of a Multicellular 3D Scaffold for the Delivery of Layered Cell Sheets

조직 공학 : 계층화 된 세포 시트의 전달을위한 다세포 3D 비계 건설

Many tissues, such as the adult human hearts, are unable to adequately regenerate after damage.2,3 Strategies in tissue engineering propose innovations to ...

The Encapsulation of Cell-free Transcription and Translation Machinery in Vesicles for the Construction of Cellular Mimics

휴대 모방 자의 건설을위한 소포는의 셀이없는 전사 및 번역 기계의 캡슐화

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

전기 방사를 적응하는 것은 트라이 계층에 대한 세 가지 독특한 환경을 제공하기 위해<em&gt; 체외</em&gt;기도 벽의 모델

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Construction of Defined Human Engineered Cardiac Tissues to Study Mechanisms of Cardiac Cell Therapy

정의 인간 공학 심장 조직의 건설 심장 세포 치료의 메커니즘을 연구하는

Human cardiac tissue engineering can fundamentally impact therapeutic discovery through the development of new species-specific screening systems that ...

Lucifer Yellow - A Robust Paracellular Permeability Marker in a Cell Model of the Human Blood-brain Barrier

루시퍼 옐로우 - 인간 혈액-뇌 장벽의 세포 모델에서 강력한 파라셀룰러 투과성 마커

The blood-brain barrier BBB consists of endothelial cells that form a barrier between the systemic circulation and the brain to prevent the exchange of ...