Name: determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry
Uploaded: 2022-08-23T13:45:00
Description: Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

تم دعم هذا البحث من قبل تمويل البحث والتطوير من Aptagen LLC.

ملاحظة: يوضح الشكل 2 الخطوات الرئيسية لتجربة مركز التجارة الدولية لتحديد الارتباط الديناميكي الحراري والحركي لأبتمير الحمض النووي والتتراسيكلين.
1. إعداد العينات
ملاحظة: يجب إعداد عينات لمركز التجارة الدولية في نفس المخزن المؤقت لكل...

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

تم تعديل الطريقة المعروضة هنا وفقا لتعليمات من TA Instruments وهي كافية لتحديد تقارب الارتباط والديناميكا الحرارية للعديد من aptamers والأهداف المختارة في مركزنا. تتضمن الخطوات الحاسمة من هذا الإجراء تبادل المخزن المؤقت للحصول على هدف يطابق الرباط ، وتشغيل العينات بمعلمات مناسبة ، وإيجاد نموذج من...

Aptamers هي شظايا ssDNA أو RNA يتم اختيارها من خلال عملية تطور ذات تقارب وخصوصية عالية الارتباط بالأهداف المرجوة1,2 ، والتي يمكن أن تعمل كعناصر التعرف المتقدمة أو الأجسام المضادة الكيميائية 3,4,5. وبالتالي ، فإن التقارب والخصوصية الملزمين ل aptamers لأهدافهم يلعبان دورا حاسما في اختيار وتطبيق aptamer ، وقد تم استخدام كالوريمتر المعايرة بالتحليل الحجمي متساوي الحرارة (ITC) على نطاق واسع لأغراض التوصيف هذه. تم استخدام العديد من الأساليب لتحديد تقارب aptamers ، بما في ذلك ITC ، ورنين البلازمون السطحي (SPR) ، والمعايرة بالتحليل الحجمي اللوني ، والرحلان الحراري المجهري (MST) ، وقياس تداخل الطبقة الحيوية (BLI). من بينها ، ITC هي واحدة من أحدث التقنيات لتحديد الارتباط الديناميكي الحراري والحركي لجزيئين في مرحلة الحل. يقوم هذا النهج بإجراء معايرة مستمرة باستخدام جزيئات خالية من الملصقات ويسجل الحرارة المنبعثة بمرور الوقت على أحداث الربط الناتجة عن كل معايرة 6,7. وخلافا للطرق الأخرى، يمكن لمركز التجارة الدولية أن يوفر تقاربا ملزما، والعديد من مواقع الربط، والارتباط الديناميكي الحراري والحركي (الشكل 1 ألف). من هذه المعلمات الأولية ، يتم تحديد تغيرات الطاقة الحرة Gibbs وتغيرات الإنتروبيا باستخدام العلاقة التالية:
ΔG = ΔH-TΔS
وهذا يعني أن مركز التجارة الدولية يقدم لمحة ديناميكية حرارية كاملة للتفاعل الجزيئي لتوضيح آليات الربط (الشكل 1B). من الصعب تحديد تقارب الارتباط للجزيئات الصغيرة ذات الأبتامر بسبب الأحجام المختلفة بشكل كبير بين أبتامر والهدف. وفي الوقت نفسه ، يمكن أن يوفر مركز التجارة الدولية قياسا حساسا دون وضع علامات على الجزيئات وشل حركتها ، مما يوفر وسيلة للحفاظ على البنية الطبيعية للأبتيمر والهدف أثناء القياس. مع السمات المذكورة ، يمكن استخدام ITC كطريقة قياسية لتوصيف الارتباط بين aptamer والأهداف الصغيرة.
بعد الاختيار من قبل مجموعة Gu ، تم دمج هذا aptamer مع منصات مختلفة ، بما في ذلك أجهزة الاستشعار الحيوية الكهروكيميائية القائمة على aptamer ، وفحص aptamer المرتبط بالإنزيم التنافسي ، ولوحة microtiter ، والتي يمكن أن تحقق كشفا عالي الإنتاجية للتتراسيكلين 8,9,10. ومع ذلك ، لم يتم توضيح خصائصه الملزمة بشكل جيد بما يكفي لاختيار النظام الأساسيالمناسب 8 ؛ يجدر توصيف ربط الأبتامر بالتتراسيكلين باستخدام ITC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG 
			C TTGGGTTGGTCCCACTGCGCG 
			TGGATCCGAGCTCCAC GTG-3&#39;</td>
			<td>Integrated DNA Technologies, Inc</td>
			<td></td>
			<td>The sequence is adopted from Gu&#39;s research, which has not identified Kd using ITC (refer references 8 and 9)</td>
		</tr>
		<tr>
			<td>Affinity ITC Auto Low Volume (190 &#181;L) System Complete&#8211;Gold Cells</td>
			<td>TA Instruments</td>
			<td>61000.901</td>
			<td>Isothermal titration calorimetry system</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Avantor (VWR)</td>
			<td>E506-100ML</td>
			<td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417R</td>
			<td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td>
		</tr>
		<tr>
			<td>Complete Degassing Station (110/230V)</td>
			<td>TA Instruments</td>
			<td>6326</td>
			<td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>TekNova</td>
			<td>E0375</td>
			<td>EDTA 500 mM, pH 7.5</td>
		</tr>
		<tr>
			<td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>UV-Vis Spectrophotometer</td>
		</tr>
		<tr>
			<td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td>
			<td>Pall Laboratory</td>
			<td>OD030C34</td>
			<td>3 kDa molecular weight cutoff concentrator</td>
		</tr>
		<tr>
			<td>PBS pH 7.4</td>
			<td>IBI Scientific</td>
			<td>IB70165</td>
			<td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &#181;m filter. Autoclaved at 121 &#176;C for greater than 20 min.</td>
		</tr>
		<tr>
			<td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td>
			<td>labForce (a Thomas Scientific Brand)</td>
			<td>1149K01</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline, Hydrochoride</td>
			<td>EMD Millipore Corperation</td>
			<td>CAS64-75-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

إن تحديد التقارب والسلوك الملزم بين aptamer وهدفه هو الخطوة الأكثر أهمية في اختيار واستخدام aptamer للتطبيق. نظرا للاختلافات الجذرية بين الأبتامر والجزيئات الصغيرة ، يحتاج العلماء إلى بذل الكثير من الجهد في توصيف خصائصها الملزمة. يعد كالوريمتر المعايرة بالتحليل الحجمي متساوي الحرارة (ITC) نهجا قويا لهذا الغرض. يتجاوز ITC تحديد ثوابت الانفصال (Kd) ويمكن أن يوفر تغيرات المحتوى الحراري وقياس stoichiometry المرتبط للتفاعل بين جزيئين في مرحلة الحل. يجري هذا النهج معايرة مستمرة باستخدام جزيئات خالية من الملصقات ويسجل الحرارة المنبعثة بمرور الوقت على أحداث الربط التي تنتجها كل معايرة بالتحليل الحجمي ، بحيث يمكن للعملية قياس الارتباط بين الجزيئات الكبيرة وأهدافها الصغيرة بحساسية. هنا ، تقدم المقالة إجراء خطوة بخطوة لقياس ITC ل aptamer مختار مع هدف صغير ، التتراسيكلين. يثبت هذا المثال براعة التقنية وإمكاناتها للتطبيقات الأخرى.

يوفر ITC ثابت فك ارتباط دقيق (Kd) ، وقياس stoichiometry ملزم ، والمعلمات الديناميكية الحرارية للتفاعلات ثنائية الجزيء6. في هذا المثال، يرتبط الأبتامر الذي اختاره كيم وآخرون.9,11 بالتتراسيكلين مع تقاربات ملزمة من K d 1 = 13 μM، K d 2 = 53 nM<sub...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

يصف هذا البروتوكول استخدام كالوريمتر المعايرة بالتحليل الحجمي متساوي الحرارة (ITC) لتحليل حركية الارتباط والتفكك للربط بين أبتامر الحمض النووي والتتراسيكلين، بما في ذلك إعداد العينات، وتشغيل المعايير والعينات، وتفسير البيانات الناتجة.

تحديد الارتباط الديناميكي الحراري والحركي لأبتامر الحمض النووي والتتراسيكلين باستخدام كالوريمتر المعايرة بالتحليل الحجمي متساوي الحرارة

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

يسمح هذا البروتوكول للباحثين بتحديد الصلات الملزمة للأبتامير ضد الأهداف الحرة في الحل ، مع توفير نظرة ثاقبة لآلية الربط. نظرا لأن مركز التجارة الدولية يقيس التغيرات في الحرارة بسبب الارتباط ، فلا يلزم وضع علامة على الأبتامير أو الرباط أو تشغيلهما ، كما هو الحال بالنسبة لتقنيات مثل SPR. يجب على المستخدمين الجدد إيلاء اهتمام وثيق لمطابقة المخازن المؤقتة عبر جميع مكونات الربط.بالإضافة إلى ذلك ، كن على دراية بأن هذه التقنية لها متطلبات عينة عالية قد يكون من الصعب تلبيتها للروابط الأكبر مثل البروتينات. للبدء ، قم بتنشيط غشاء عمود غسيل الكلى ، واملأه بمخزن مؤقت PBS ، وازن لمدة 10 دقائق في درجة حرارة الغرفة ، وأجهزة الطرد المركزي عند 5،000 مرة G لمدة 15 دقيقة. قم بإزالة المخزن المؤقت وقم بتحميل 500 ميكرولتر من عينات aptamer في العمود.جهاز طرد مركزي عند 5،000 مرة G وكرره أربع مرات لتبادل المخزن المؤقت الأصلي ل PBS. اجمع أبتامير الحمض النووي المخلل باستخدام ماصة وانقله إلى الأنبوب الجديد سعة 1.5 ملليلتر. اجمع آخر مخزن مؤقت للتدفق لإذابة التتراسيكلين.تأكد من أن المخزن المؤقت للتجربة في المحقنة يطابق المخزن المؤقت في الخلية المرجعية. حدد تركيز الأبتامير مرة أخرى باستخدام مطياف الأشعة فوق البنفسجية المرئي. استخدم آخر مخزن مؤقت للتبادل لضبط التركيز على التتراسيكلين 40 ميكرومولار وأبتامير ثنائي الميكرومول.قم بطي أبتامر الحمض النووي عن طريق التسخين عند 90 درجة سلزية لمدة 10 دقائق ، ثم التبريد عند أربع درجات سلزية لمدة 10 دقائق ، ثم العودة إلى درجة حرارة الغرفة لمدة 20 دقيقة. قم بإزالة غاز الأبتامير المطوي والتتراسيكلين المخاطب باستخدام محطة تفريغ أو مضخة تفريغ لمدة 25 دقيقة للتخلص من الغازات المذابة. بعد تنظيف الجهاز والتأكد من نظافته ، اختبر دقة الجهاز باستخدام مجموعة قياسية تتضمن EDTA وكلوريد الكالسيوم باستخدام البرنامج الافتراضي واتباع التعليمات من الشركة المصنعة.قم بإعداد المعلمات قيد التشغيل. تحقق من وحدات التخزين المطلوبة باستخدام آلة حاسبة للبرنامج قيد التشغيل. باستخدام معلمة التشغيل هذه ، قم بإجراء قياس ITC باستخدام 230 ميكرولتر من التتراسيكلين 40 ميكرومولار في حقنة ITC و 485 ميكرولتر من الأبتامير ثنائي الميكرومولار في خلية عينة ITC باستخدام ITC.قم بتحميل ألواح حقنة التتراسيكلين المخزية والأبتامير المطوي في خلية العينة ، وتجنب الفقاعات ، باستخدام ماصة. ابدأ تشغيل أداة ITC بالنقر فوق الزر "ابدأ" في البرنامج. افتح برنامج تحليل البيانات بالنقر المزدوج لبدء تحليل البيانات.افتح مسار البيانات الأولية المحفوظة لمعرفة ميل الربط. افتح علامة التبويب النمذجة واستخدم نماذج ربط مختلفة للعثور على أفضل ملاءمة لمنحنى البيانات. بعد ذلك ، يقوم البرنامج تلقائيا بحساب الرسم البياني الحراري ل ITC والمعلمات الديناميكية الحرارية المختلفة ، بما في ذلك المحتوى الحراري ، والانتروبيا ، والطاقة الحرة ، وثابت ربط التوازن ، والقياس المتكافئ.اجمع المعلمات الديناميكية الحرارية المحددة من البيانات ومعلومات نموذج التركيب. قم بإنشاء تقرير يتضمن صورا للمخطط الحراري لمركز التجارة الدولية ومعلمات ديناميكية حرارية مختلفة. يرتبط الأبتامير الذي اختاره كيم وآخرون بالتتراسيكلين مع تقارب الارتباط لثابت الانفصال واحد يساوي 13 ميكرومولار وثابت الانفصال اثنان يساوي 53 نانومولار.يعكس نموذج التركيب والقياس الكيميائي من ITC أن الأبتامير يرتبط بالتتراسيكلين من خلال نسبة ربط 2: 1 مع نموذج الربط المتسلسل. أشارت المعلمات الديناميكية الحرارية التي حددها قياس ITC للموقع الثاني إلى أن المحتوى الحراري الذي يتغلب على فقدان إنتروبي كبير نسبيا يقود الارتباط القوي. يرتبط الارتباط المدفوع بالمحتوى الحراري مع فقدان الإنتروبيا بالتغيرات التوافقية للحمض النووي ، والتي تم الإبلاغ عنها كسلوكيات ربط بين الحمض النووي الريبي وجزيء صغير.يجب أن يكون الأبتامير والليجند في نفس المخزن المؤقت. يجب إعادة طي الأبتامير إذا تم تطويره مع إعادة الطي ، ويجب تفريغ العينات. ستضمن معالجة هذه الاعتبارات أن تفاعلات aptamer-ligand فقط هي التي تساهم في الإشارة المقاسة.نظرا لحجم هدف aptamer ، يمكن أن تكون طريقة المتابعة المناسبة هي الرحلان الحراري المجهري لتأكيد تقارب الربط المقاس الخالي من المحلول.

Research

JoVE Journal

Biochemistry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

رسم خريطة الموقع ملزم لأبتمر على ATP عن طريق الميكروسكيل Thermophoresis

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential Scanning Calorimetry ÃƒÆ’Ã‚Â¢ÃƒÂ¢Ã¢â‚¬Å¡Ã‚Â¬ÃƒÂ¢Ã¢â€šÂ¬Ã‚Â A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

الكالوري الضوئي التفاضلية - منهج في تقييم الثبات الحراري والتشكل من البروتين مستضد

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Detection and Visualization of DNA Damage-induced Protein Complexes in Suspension Cell Cultures Using the Proximity Ligation Assay

الكشف والتصور من المجمعات البروتين الناجم عن الأضرار الحمض النووي في الثقافات خلية تعليق باستخدام التقريب ربط القرب

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

متعدد التضخيم متحاور على أساس منهاج التشخيصية للكشف عن زكى وداء شيكونغونيا وحمى الضنك 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes

تحديد إذا كان الحمض النووي ملطخة "سينين صبغ يمكن هضمها" مع إنزيمات التقييد

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

معايرة أليسا كأسلوب لتحديد ثابت تفكك مستقبلات يجند التفاعل

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Proofreading and DNA Repair Assay Using Single Nucleotide Extension and MALDI-TOF Mass Spectrometry Analysis

تصحيح التجارب المطبعية ومقايسة إصلاح الحمض النووي باستخدام ملحق النوكليوتيدات واحدة واستخدام TOF تحليل الطيف الكتلي

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have ...

Anaerobic Protein Purification and Kinetic Analysis via Oxygen Electrode for Studying DesB Dioxygenase Activity and Inhibition

تنقية البروتين اللاهوائية وتحليل الحركية عبر مسرى الأوكسجين لدراسة النشاط ديوكسيجيناسي دسب وتثبيط

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

قياس حساسية عالية من الانتماءات الملزمة الحمض النووي عامل النسخ بالتنافسية معايرة باستخدام مجهر الأسفار

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...