Name: determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry
Uploaded: 2022-08-23T13:45:00
Description: Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

מחקר זה נתמך על ידי מימון המחקר והפיתוח של Aptagen LLC.

הערה: איור 2 מציג את השלבים העיקריים של ניסוי ITC לקביעת הקשר התרמודינמי והקינטי של אפטמר DNA וטטרציקלין.
1. הכנת דוגמאות
הערה: יש להכין דגימות עבור ITC באותו חיץ הן עבור האפטמר והן עבור הליגנד כדי למנוע שחרור חום הנגרם על ידי ערבוב מאגרים שו...

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

השיטה המוצגת כאן שונתה בהתאם להוראת ת"א מכשירים והיא מספיקה כדי לקבוע את זיקת הקשירה והתרמודינמיקה של אפטאמרים ומטרות נבחרות רבות במרכזנו. שלבים מכריעים מהליך זה כוללים החלפת המאגר כך שיהיה לו יעד התואם את הליגנד, הרצת דגימות עם פרמטרים מתאימים ומציאת מודל התאמת המחייב המתאים לניתוח הנתו...

Aptamers הם מקטעי ssDNA או RNA שנבחרו בתהליך אבולוציה עם זיקה וספציפיות גבוהה ליעדים הרצויים 1,2, שיכולים לעבוד כיסודות זיהוי מתקדמים או נוגדנים כימיים 3,4,5. לפיכך, זיקתם וספציפיותם של האפטמרים למטרותיהם ממלאות תפקיד מכריע בבחירה וביישום של אפטאמר, וקלורימטריה איזותרמית של טיטרציה (ITC) נמצאת בשימוש נרחב למטרות אפיון אלה. גישות רבות שימשו לקביעת הזיקה של אפטמרים, כולל ITC, תהודת פלסמון פני השטח (SPR), טיטרציה צבעונית, תרמופורזה בקנה מידה זעיר (MST) ואינטרפרומטריה ביו-שכבתית (BLI). ביניהם, ITC היא אחת הטכניקות האחרונות כדי לקבוע את הקשר התרמודינמי והקינטי של שתי מולקולות בשלב התמיסה. גישה זו מבצעת טיטרציה רציפה באמצעות מולקולות נטולות תוויות ומתעדת חום המשתחרר לאורך זמן על אירועי הקשירה המיוצרים על ידי כל טיטרציה 6,7. בניגוד לשיטות אחרות, ITC יכול להציע זיקה מחייבת, מספר אתרי קשירה וקשר תרמודינמי וקינטי (איור 1A). מפרמטרים ראשוניים אלה, השינויים באנרגיה החופשית של גיבס ושינויי האנטרופיה נקבעים באמצעות הקשר הבא:
ΔG = ΔH-TΔS
משמעות הדבר היא ש-ITC מציע פרופיל תרמודינמי מלא של האינטראקציה המולקולרית כדי להבהיר את מנגנוני הקשירה (איור 1B). קביעת זיקת הקשירה למולקולות קטנות עם אפטמר קשה בשל הגדלים השונים באופן דרסטי בין אפטמר למטרה. בינתיים, ITC יכול לספק מדידה רגישה ללא תיוג ושיתוק מולקולות, מה שמספק אמצעי לשמירה על המבנה הטבעי של האפטמר והמטרה במהלך המדידה. עם התכונות שהוזכרו, ITC יכול לשמש כשיטה סטנדרטית לאפיון קשירה בין aptamer לבין מטרות קטנות.
לאחר בחירה על ידי קבוצת Gu, אפטמר זה שולב עם פלטפורמות שונות, כולל ביוסנסורים מבוססי אפטמר אלקטרוכימיים, בדיקת אפטמר תחרותית הקשורה לאנזים, וצלחת מיקרוטיטר, שיכולה להשיג זיהוי תפוקה גבוהה של טטרציקלין 8,9,10. עם זאת, המאפיינים המחייבים שלה לא הובהרו מספיק טוב כדי לבחור את הפלטפורמה הנכונה8; כדאי לאפיין את הכריכה של aptamer לטטרציקלין באמצעות ITC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG 
			C TTGGGTTGGTCCCACTGCGCG 
			TGGATCCGAGCTCCAC GTG-3&#39;</td>
			<td>Integrated DNA Technologies, Inc</td>
			<td></td>
			<td>The sequence is adopted from Gu&#39;s research, which has not identified Kd using ITC (refer references 8 and 9)</td>
		</tr>
		<tr>
			<td>Affinity ITC Auto Low Volume (190 &#181;L) System Complete&#8211;Gold Cells</td>
			<td>TA Instruments</td>
			<td>61000.901</td>
			<td>Isothermal titration calorimetry system</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Avantor (VWR)</td>
			<td>E506-100ML</td>
			<td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417R</td>
			<td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td>
		</tr>
		<tr>
			<td>Complete Degassing Station (110/230V)</td>
			<td>TA Instruments</td>
			<td>6326</td>
			<td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>TekNova</td>
			<td>E0375</td>
			<td>EDTA 500 mM, pH 7.5</td>
		</tr>
		<tr>
			<td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>UV-Vis Spectrophotometer</td>
		</tr>
		<tr>
			<td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td>
			<td>Pall Laboratory</td>
			<td>OD030C34</td>
			<td>3 kDa molecular weight cutoff concentrator</td>
		</tr>
		<tr>
			<td>PBS pH 7.4</td>
			<td>IBI Scientific</td>
			<td>IB70165</td>
			<td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &#181;m filter. Autoclaved at 121 &#176;C for greater than 20 min.</td>
		</tr>
		<tr>
			<td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td>
			<td>labForce (a Thomas Scientific Brand)</td>
			<td>1149K01</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline, Hydrochoride</td>
			<td>EMD Millipore Corperation</td>
			<td>CAS64-75-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

קביעת זיקה והתנהגות מחייבת בין אפטמר לבין מטרתו היא השלב המכריע ביותר בבחירת אפטמר ליישום ובשימוש בו. בשל ההבדלים הדרסטיים בין האפטמר למולקולות קטנות, מדענים צריכים להשקיע מאמץ רב באפיון תכונות הקשירה שלהן. קלורימטריה איזותרמית של טיטרציה (ITC) היא גישה רבת עוצמה למטרה זו. ITC חורג מקביעת קבועי ההתנתקות (Kd) ויכול לספק את השינויים האנתלפיים ואת הסטויכיומטריה המחייבת של האינטראקציה בין שתי מולקולות בשלב התמיסה. גישה זו מבצעת טיטרציה רציפה באמצעות מולקולות נטולות תוויות ומתעדת חום המשתחרר לאורך זמן על אירועי הקשירה המיוצרים על ידי כל טיטרציה, כך שהתהליך יכול למדוד ברגישות את הקשירה בין מקרומולקולות לבין המטרות הקטנות שלהן. כאן, המאמר מציג הליך שלב אחר שלב של מדידת ITC של אפטמר נבחר עם מטרה קטנה, טטרציקלין. דוגמה זו מוכיחה את הרבגוניות של הטכניקה ואת הפוטנציאל שלה ליישומים אחרים.

ITC מספק קבוע התנתקות מדויק (Kd), את הסטויכיומטריה המחייבת ואת הפרמטרים התרמודינמיים של אינטראקציות דו-מולקולות6. בדוגמה זו, האפטמר שנבחר על ידי Kim et al.9,11 נקשר לטטרציקלין עם זיקות קשירה של K d 1 = 13 μM, Kd 2 = 53 nM. מעניין לצי...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

הפרוטוקול הנוכחי מתאר את השימוש בקלורימטריית טיטרציה איזותרמית (ITC) כדי לנתח את קינטיקה של הקשר והדיסוציאציה של הקשירה בין אפטמר DNA לטטרציקלין, כולל הכנת דגימות, הפעלת תקנים ודגימות, ופענוח הנתונים המתקבלים.

קביעת הקשר התרמודינמי והקינטי של אפטמר DNA וטטרציקלין באמצעות קלורימטריה איזותרמית טיטרציה

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

פרוטוקול זה מאפשר לחוקרים לקבוע את זיקות הקשירה של אפטמרים כנגד מטרות חופשיות בתמיסה, תוך מתן תובנה לגבי מנגנון הקשירה. מכיוון ש- ITC מודד שינויים בחום עקב קשירה, לא aptamer ולא ligand צריך להיות מתויג או פונקציונלי, כפי שהיה במקרה של טכניקות כגון SPR. משתמשים חדשים צריכים לשים לב למאגרים תואמים בכל רכיבי הכריכה.בנוסף, שימו לב שלטכניקה יש דרישות דגימה גבוהות שעשויות להיות קשות לעמידה עבור ליגנדות גדולות יותר כגון חלבונים. כדי להתחיל, להפעיל את הממברנה של עמודת הדיאליזה, למלא עם מאגר PBS, שיווי משקל במשך 10 דקות בטמפרטורת החדר, צנטריפוגה ב 5, 000 פעמים G במשך 15 דקות. הסר את המאגר וטען 500 מיקרוליטר של דגימות aptamer לתוך העמודה.צנטריפוגה ב 5, 000 פעמים G ולחזור על זה ארבע פעמים כדי להחליף את המאגר המקורי עבור PBS. לאסוף את ה- DNA aptamer dialyzed באמצעות פיפטה ולהעביר אותו לצינור החדש 1.5 מיליליטר. אסוף את מאגר הזרימה האחרון כדי להמיס טטרציקלין.ודא שהמאגר של הניסוי במזרק תואם למאגר בתא הייחוס. קבע שוב את ריכוז האפטמר באמצעות ספקטרומטר הנראה לעין UV. השתמש במאגר החליפין האחרון כדי להתאים את הריכוז לטטרציקלין 40-מיקרומולרי ואפטמר דו-מיקרומולרי.מקפלים את ה-DNA aptamer על ידי חימום ב-90 מעלות צלזיוס למשך 10 דקות, קירור ב-4 מעלות צלזיוס למשך 10 דקות, ולאחר מכן חוזרים לטמפרטורת החדר למשך 20 דקות. דגה את האפטמר המקופל והטטרציקלין המקופל באמצעות תחנת degassing או משאבת ואקום למשך 25 דקות כדי לחסל גזים מומסים. לאחר ניקוי ואישור ניקיון המכונה, בדוק את דיוק המכונה עם ערכה סטנדרטית הכוללת EDTA וסידן כלורי באמצעות תוכנית ברירת המחדל ופעל לפי הוראות היצרן.הגדר את הפרמטרים הפועלים. בדוק את אמצעי האחסון הדרושים באמצעות מחשבון תוכנית פועלת. עם פרמטר ריצה זה, בצע מדידת ITC עם 230 מיקרוליטרים של טטרציקלין 40-micromolar במזרק ITC ו 485 מיקרוליטר של שני מיקרומולר aptamer בתא מדגם ITC באמצעות ITC.העמיסו את לוחות המזרק טטרציקלין המקופלים ואת האפטמר המקופל לתוך תא הדגימה, תוך הימנעות מבועות, באמצעות פיפטה. התחל להפעיל את מכשיר ה- ITC על ידי לחיצה על התחלה כפתור בתוכנה. פתח את תוכנת ניתוח הנתונים על ידי לחיצה כפולה כדי להתחיל לנתח את הנתונים.פתח את הנתיב של הנתונים הגולמיים שנשמרו כדי לדעת את הנטייה של כריכה. פתח את הכרטיסיה מידול והשתמש במודלי איגוד שונים כדי למצוא את ההתאמה הטובה ביותר לעקומת הנתונים. לאחר מכן, התוכנה מחשבת באופן אוטומטי את התרמוגרמה של ITC ופרמטרים תרמודינמיים שונים, כולל אנתלפיה, אנטרופיה, אנרגיה חופשית, קבוע קשירה של שיווי משקל וסטויכיומטריה.אסוף את הפרמטרים התרמודינמיים שנקבעו מהנתונים וממידע המודל המתאים. צור דוח הכולל תמונות של התרמוגרמה ITC ופרמטרים תרמודינמיים שונים. האפטמר שנבחר על ידי קים, et al נקשר לטטרציקלין עם זיקות מחייבות של קבוע דיסוציאציה אחד שווה 13 מיקרומולר וקבוע דיסוציאציה שני שווה 53 ננו-מולר.המודל המתאים והסטויכיומטריה של ITC משקפים כי האפטמר נקשר לטטרציקלין באמצעות יחס קשירה של 2:1 עם מודל הקשירה הרציפה. הפרמטרים התרמודינמיים שנקבעו על ידי מדידת ITC עבור אתר שני הצביעו על כך שהתגברות על אנתלפיה משמעותית יחסית של אובדן אנטרופי מניעה את הקשירה החזקה. הקשירה מונעת האנתלפיה עם אובדן האנטרופיה מתייחסת לשינויים קונפורמיים של חומצות גרעין, שדווחו כהתנהגויות קשירה בין רנ"א למולקולה קטנה.האפטמר והליגנד חייבים להיות באותו חיץ. יש לקפל מחדש את האפטאמר אם פותח עם refolding, ודגימות חייבות להיות degassed. טיפול בשיקולים אלה יבטיח שרק אינטראקציות אפטמר-ליגנד יתרמו לאות הנמדד.בשל גודלו של יעד האפטמר, שיטת מעקב מתאימה יכולה להיות תרמופורזה בקנה מידה זעיר כדי לאשר את זיקת הקשירה הנמדדת ללא תמיסה.

Research

JoVE Journal

Biochemistry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

מיפוי אתר הקישור של Aptamer על ATP שימוש microscale Thermophoresis

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential Scanning Calorimetry ÃƒÆ’Ã‚Â¢ÃƒÂ¢Ã¢â‚¬Å¡Ã‚Â¬ÃƒÂ¢Ã¢â€šÂ¬Ã‚Â A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Calorimetry סריקה דיפרנציאל - שיטה להערכת יציבות תרמית ומבנה של Antigen חלבון

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Detection and Visualization of DNA Damage-induced Protein Complexes in Suspension Cell Cultures Using the Proximity Ligation Assay

איתור ויזואליזציה של DNA הנזק- Induced חלבון קומפלקסים ההשעיה תא תרבויות באמצעות Assay קשירת הקרבה

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

הגברה איזותרמי מרובבת מבוסס פלטפורמת אבחון לאיתור Zika Chikungunya, קדחת דנגה 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes

קביעה אם הדנ א מוכתם Cyanine צבע יכול להיות מתעכל עם אנזימי הגבלה

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

טיטור אליסה כשיטה לקבוע את קבוע דיסוציאציה של קולטן ליגנד אינטראקציה

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Proofreading and DNA Repair Assay Using Single Nucleotide Extension and MALDI-TOF Mass Spectrometry Analysis

הגהה ואת וזמינותו תיקון ה-DNA באמצעות ניתוח ספקטרומטר מסה MALDI-TOF והסיומת נוקלאוטיד יחיד

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have ...

Anaerobic Protein Purification and Kinetic Analysis via Oxygen Electrode for Studying DesB Dioxygenase Activity and Inhibition

חלבון אנאירובית טיהור וניתוח קינטי באמצעות אלקטרודה חמצן ללמוד DesB Dioxygenase פעילות וניגוד

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

רגישות גבוהה מדידה של שעתוק הזיקות איגוד מקדם-DNA על ידי טיטור תחרותי באמצעות מיקרוסקופ קרינה פלואורסצנטית

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...