Name: determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry
Uploaded: 2022-08-23T13:45:00
Description: Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

이 연구는 Aptagen LLC의 연구 개발 자금으로 지원되었습니다.

참고: 그림 2 는 DNA 앱타머와 테트라사이클린의 열역학적 및 동역학적 연관성을 결정하기 위한 ITC 실험의 주요 단계를 보여줍니다.
1. 시료 준비
참고: ITC용 샘플은 샘플 셀과 주사기의 다른 버퍼를 혼합하여 발생하는 열 방출을 방지하기 위해 압타머와 리간드 모두에 대해 동일한 버퍼에서 준비해야 합니다. 이는 일반적?...

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

여기에 제시된 방법은 TA Instruments의 지시에 따라 수정되었으며 당사 센터에서 선택된 많은 압타머 및 표적의 결합 친화도 및 열역학을 결정하기에 충분합니다. 이 절차의 중요한 단계에는 리간드와 일치하는 표적을 갖도록 버퍼를 교환하고, 적절한 매개 변수로 샘플을 실행하고, 데이터를 분석하기 위한 적절한 결합 피팅 모델을 찾는 것이 포함됩니다. 열 방출을 지속적으로 기록하려면 버퍼의 ?...

압타머는 원하는 표적 1,2에 대한 높은 결합 친화도 및 특이성을 갖는 진화 과정을 통해 선택된 ssDNA 또는 RNA 단편으로, 고급 인식 요소 또는 화학 항체 3,4,5로 작용할 수 있습니다. 따라서, 표적에 대한 압타머의 결합 친화도 및 특이성은 압타머의 선택 및 적용에 결정적인 역할을 하며, 등온 적정 열량측정법(ITC)이 이러한 특성화 목적으로 널리 사용되어 왔다. 압타머의 친화도를 측정하기 위해 ITC, 표면 플라즈몬 공명(SPR), 비색 적정, 마이크로 스케일 열영동(MST) 및 바이오층 간섭계(BLI)를 포함한 많은 접근법이 사용되었습니다. 그 중 ITC는 용액 단계에서 두 분자의 열역학적 및 운동 적 결합을 결정하는 최신 기술 중 하나입니다. 이 접근법은 표지가없는 분자를 사용하여 연속 적정을 수행하고 각 적정 6,7에 의해 생성 된 결합 이벤트에 따라 시간이 지남에 따라 방출 된 열을 기록합니다. 다른 방법과 달리 ITC는 결합 친화도, 여러 결합 부위, 열역학적 및 동역학적 연관성을 제공할 수 있습니다(그림 1A). 이러한 초기 매개 변수에서 Gibbs 자유 에너지 변화와 엔트로피 변화는 다음 관계를 사용하여 결정됩니다.
ΔG = ΔH-TΔS
이는 ITC가 결합 메커니즘을 설명하기 위해 분자 상호 작용의 완전한 열역학적 프로파일을 제공한다는 것을 의미합니다(그림 1B). 압타머를 사용한 소분자의 결합 친화도를 결정하는 것은 압타머와 표적 사이의 크기가 크게 다르기 때문에 어렵습니다. 한편, ITC는 분자를 표지하고 고정화하지 않고도 민감한 측정을 제공할 수 있으며, 이는 측정 중에 압타머와 표적의 자연 구조를 유지하는 수단을 제공합니다. 언급된 특성을 통해 ITC는 압타머와 소형 표적 간의 결합 특성화를 위한 표준 방법으로 사용할 수 있습니다.
Gu 그룹에 의한 선택 후, 이 압타머는 전기화학적 압타머 기반 바이오센서, 경쟁력 있는 효소 결합 압타머 분석법 및 테트라사이클린 8,9,10의 고처리량 검출을 달성할 수 있는 마이크로타이터 플레이트를 포함한 다양한 플랫폼과 통합되었습니다. 그러나, 그 결합 특성은 적절한 플랫폼8을 선택하기에 충분히 잘 밝혀지지 않았다. ITC를 사용하여 압타머와 테트라 사이클린의 결합을 특성화 할 가치가 있습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG 
			C TTGGGTTGGTCCCACTGCGCG 
			TGGATCCGAGCTCCAC GTG-3&#39;</td>
			<td>Integrated DNA Technologies, Inc</td>
			<td></td>
			<td>The sequence is adopted from Gu&#39;s research, which has not identified Kd using ITC (refer references 8 and 9)</td>
		</tr>
		<tr>
			<td>Affinity ITC Auto Low Volume (190 &#181;L) System Complete&#8211;Gold Cells</td>
			<td>TA Instruments</td>
			<td>61000.901</td>
			<td>Isothermal titration calorimetry system</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Avantor (VWR)</td>
			<td>E506-100ML</td>
			<td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417R</td>
			<td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td>
		</tr>
		<tr>
			<td>Complete Degassing Station (110/230V)</td>
			<td>TA Instruments</td>
			<td>6326</td>
			<td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>TekNova</td>
			<td>E0375</td>
			<td>EDTA 500 mM, pH 7.5</td>
		</tr>
		<tr>
			<td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>UV-Vis Spectrophotometer</td>
		</tr>
		<tr>
			<td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td>
			<td>Pall Laboratory</td>
			<td>OD030C34</td>
			<td>3 kDa molecular weight cutoff concentrator</td>
		</tr>
		<tr>
			<td>PBS pH 7.4</td>
			<td>IBI Scientific</td>
			<td>IB70165</td>
			<td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &#181;m filter. Autoclaved at 121 &#176;C for greater than 20 min.</td>
		</tr>
		<tr>
			<td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td>
			<td>labForce (a Thomas Scientific Brand)</td>
			<td>1149K01</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline, Hydrochoride</td>
			<td>EMD Millipore Corperation</td>
			<td>CAS64-75-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

압타머와 그 표적 사이의 결합 친화도와 거동을 결정하는 것은 적용을 위해 압타머를 선택하고 사용하는 가장 중요한 단계입니다. 압타머와 저분자 사이의 급격한 차이로 인해 과학자들은 결합 특성을 특성화하는 데 많은 노력을 기울일 필요가 있습니다. 등온 적정 열량측정법(ITC)은 이러한 목적을 위한 강력한 접근 방식입니다. ITC는 분리 상수(Kd)를 결정하는 것 이상으로 용액 단계에서 두 분자 간의 상호 작용에 대한 엔탈피 변화 및 결합 화학량론을 제공할 수 있습니다. 이 접근법은 표지가 없는 분자를 사용하여 연속 적정을 수행하고 각 적정에 의해 생성된 결합 이벤트에 따라 시간이 지남에 따라 방출되는 열을 기록하므로 공정은 거대분자와 작은 표적 간의 결합을 민감하게 측정할 수 있습니다. 본 명세서에서는 선택된 압타머와 소형 표적인 테트라사이클린의 ITC 측정의 단계별 절차를 소개합니다. 이 예는 기술의 다양성과 다른 응용 분야에 대한 잠재력을 입증합니다.

ITC는 정확한 분리 상수 (Kd), 결합 화학 양론 및 2 분자 상호 작용의 열역학적 매개 변수를 제공합니다6. 이 예에서, Kim et al.9,11에 의해 선택된 압타머는 Kd1 = 13 μM, Kd2 = 53 nM의 결합 친화도를 갖는 테트라사이클린에 결합한다. 흥미롭게도, 이러한 결합은 평형 여과법 및 63.3 nM의 보고된Kd...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

본 프로토콜은 샘플 준비, 실행 표준 및 샘플을 포함하여 DNA 압타머와 테트라사이클린 간의 결합의 연관성 및 해리 역학을 분석하고 결과 데이터를 해석하기 위한 등온 적정 열량측정법(ITC)의 사용을 설명합니다.

등온 적정 열량계를 사용하여 DNA 압타머와 테트라사이클린의 열역학적 및 동역학적 연관성 결정

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

이 프로토콜을 통해 연구자들은 용액에서 자유로운 표적에 대한 압타머의 결합 친화도를 결정하는 동시에 결합 메커니즘에 대한 통찰력을 제공할 수 있습니다. ITC는 결합으로 인한 열 변화를 측정하기 때문에 SPR과 같은 기술의 경우처럼 압타머나 리간드를 표지하거나 기능화할 필요가 없습니다. 새 사용자는 모든 바인딩 구성 요소에서 일치하는 버퍼에 세심한 주의를 기울여야 합니다.또한 이 기술에는 단백질과 같은 더 큰 리간드에 대해 충족하기 어려울 수 있는 높은 샘플 요구 사항이 있습니다. 시작하려면 투석 컬럼의 막을 활성화하고 PBS 버퍼로 채우고 실온에서 10 분 동안 평형을 이루고 5, 000 배 G에서 15 분 동안 원심 분리합니다. 완충액을 제거하고 500마이크로리터의 앱타머 샘플을 컬럼에 로드합니다.5, 000배 G에서 원심분리하고 4회 반복하여 원래의 완충액을 PBS로 교환한다. 피펫을 사용하여 투석된 DNA 앱타머를 수집하고 새로운 1.5밀리리터 튜브로 옮깁니다. 테트라 사이클린을 용해시키기 위해 마지막 유동 완충액을 수집하십시오.주사기의 실험용 버퍼가 기준 셀의 버퍼와 일치하는지 확인합니다. UV 가시광선 분광기를 사용하여 압타머 농도를 다시 결정합니다. 마지막 교환 완충액을 사용하여 농도를 40 마이크로 몰 테트라 사이클린 및 2 마이크로 몰 압타머로 조정합니다.DNA 압타머를 접어서 섭씨 90도에서 10분간 가열하고 섭씨 4도에서 10분간 냉각한 다음 다시 실온으로 20분간 가열한다. 폴딩된 압타머를 탈기하고 투석된 테트라사이클린을 탈기소 스테이션 또는 진공 펌프를 사용하여 25분 동안 용해된 가스를 제거하였다. 기계를 청소하고 청결도를 확인한 후 기본 프로그램을 사용하고 제조업체의 지침에 따라 EDTA 및 염화칼슘이 포함 된 표준 키트로 기계의 정확도를 테스트하십시오.실행 중인 매개 변수를 설정합니다. 실행중인 프로그램 계산기를 사용하여 필요한 볼륨을 확인하십시오. 이 실행 파라미터를 사용하여 ITC 주사기에 230 마이크로 리터의 40 마이크로 몰 테트라 사이클린과 ITC를 사용하여 ITC 샘플 셀에서 485 마이크로 리터의 2 마이크로 몰 압타머로 ITC 측정을 수행합니다.투석된 테트라사이클린 주사기 플레이트와 접힌 압타머를 피펫을 사용하여 기포를 피하면서 샘플 셀에 넣습니다. 소프트웨어에서 시작 버튼을 클릭하여 ITC 기기 실행을 시작합니다. 두 번 클릭하여 데이터 분석 소프트웨어를 열어 데이터 분석을 시작합니다.저장된 원시 데이터의 경로를 열어 바인딩 경향을 파악합니다. 모델링 탭을 열고 다양한 바인딩 모델을 사용하여 데이터 곡선에 가장 적합한 모델을 찾습니다. 그런 다음 소프트웨어는 ITC 서모그램과 엔탈피, 엔트로피, 자유 에너지, 평형 결합 상수 및 화학량론을 포함한 다양한 열역학 파라미터를 자동으로 계산합니다.데이터 및 피팅 모델 정보에서 결정된 열역학적 파라미터를 수집합니다. ITC 서모그램 사진과 다양한 열역학적 파라미터가 포함된 보고서를 작성합니다. Kim 등이 선택한 압타머는 결합 친화도가 13 마이크로 몰이고 분리 상수 2가 53 나노 몰과 같은 테트라 사이클린에 결합합니다.ITC의 피팅 모델과 화학량론은 압타머가 순차 결합 모델과 2:1 결합비를 통해 테트라사이클린에 결합한다는 것을 반영합니다. 사이트 2에 대한 ITC 측정에 의해 결정된 열역학적 매개 변수는 상대적으로 중요한 엔트로피 손실을 극복하는 엔탈피가 강한 결합을 유도한다는 것을 나타냅니다. 엔트로피 손실과의 엔탈피 구동 결합은 RNA와 소분자 사이의 결합 거동으로보고되는 핵산 구조적 변화와 관련이 있습니다.압타머와 리간드는 동일한 완충액에 있어야 합니다. 압타머는 리폴딩으로 개발된 경우 리폴딩해야 하며 샘플은 탈기되어야 합니다. 이러한 고려 사항을 해결하면 압타머-리간드 상호 작용만 측정된 신호에 기여할 수 있습니다.압타머 표적의 크기 때문에, 적절한 후속 방법은 용액에서 측정된 결합 친화도가 없음을 확인하기 위한 마이크로스케일 열영동일 수 있다.

Research

JoVE Journal

Biochemistry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

마이크로 열 영동을 사용하여 ATP에 앱 타머의 결합 부위를 매핑

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

연구

생화학

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential Scanning Calorimetry ÃƒÆ’Ã‚Â¢ÃƒÂ¢Ã¢â‚¬Å¡Ã‚Â¬ÃƒÂ¢Ã¢â€šÂ¬Ã‚Â A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

시차 주사 열량 - 단백질 항원의 열 안정성과 형태를 평가하기위한 방법

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Detection and Visualization of DNA Damage-induced Protein Complexes in Suspension Cell Cultures Using the Proximity Ligation Assay

Proximity Ligation Assay를 이용한 현탁 세포 배양에서의 DNA 손상 유발 단백질 복합체의 검출 및 가시화

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

멀티플렉스 등온 증폭 Zika, Chikungunya, 뎅 그 열의 1 감지 진단 플랫폼을 기반으로

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes

DNA는 Cyanine 염료 수 소화 수 제한 효소로 얼룩진 경우 결정

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

적정 수용 체 Ligand 상호 작용의 분리 상수를 결정 하는 방법으로 ELISA

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Proofreading and DNA Repair Assay Using Single Nucleotide Extension and MALDI-TOF Mass Spectrometry Analysis

교정 및 DNA 복구 분석 결과 단일 뉴클레오티드 확장 및 TOF MALDI 질량 분석 분석을 사용 하 여

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have ...

Anaerobic Protein Purification and Kinetic Analysis via Oxygen Electrode for Studying DesB Dioxygenase Activity and Inhibition

혐 기성 단백질 정화 및 DesB Dioxygenase 활동을 연구 하 고 억제를 위한 산소 전극을 통해 운동 분석

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

경쟁 적정 형광 현미경 검사 법을 사용 하 여 녹음 방송 요인 DNA 바인딩 선호도의 높은 감도 측정

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...