Name: isolation of next-generation gene therapy vectors through engineering, barcoding, and screening of adeno-associated virus (aav) capsid variants
Uploaded: 2022-10-18T14:00:00
Description: Watch this Scientific Journal Video about Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants at JoVE.com

डी.जी. जर्मन रिसर्च फाउंडेशन (डीएफजी) द्वारा डीएफजी सहयोगी अनुसंधान केंद्रों एसएफबी 1129 (प्रोजेक्तनुमर 240245660) और टीआरआर 179 (प्रोजेक्तनुमर 272983813) के साथ-साथ जर्मन सेंटर फॉर इंफेक्शन रिसर्च (डीजेडआईएफ, बीएमबीएफ) द्वारा समर्थन की बहुत सराहना करता है; टीटीयू-एचआईवी 04.819)।

1. एएवी 2 यादृच्छिक 7-मेर पेप्टाइड डिस्प्ले लाइब्रेरी तैयारी
नोट: एएवी 2 यादृच्छिक पेप्टाइड डिस्प्ले लाइब्रेरी की तैयारी के लिए, पतित ऑलिगोन्यूक्लियोटाइड्स को एकल-फंसे डीएनए के रूप में ?...

<ol>
	<li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery.">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nature Reviews Drug Discovery. 18 (5), 358-378 (2019).</li><li>Muhuri, M., Levy, D. I., Schulz, M., McCarty, D., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Durability+of+transgene+expression+after+rAAV+gene+therapy.">Durability of transgene expression after rAAV gene therapy.</a> Molecular Therapy. 30 (4), 1364-1380 (2022).</li><li>Li, C., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+adeno-associated+virus+vectors+for+gene+therapy.">Engineering adeno-associated virus vectors for gene therapy.</a> Nature Reviews Genetics. 21 (4), 255-272 (2020).</li><li>Kuzmin, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+clinical+landscape+for+AAV+gene+therapies.">The clinical landscape for AAV gene therapies.</a> Nature Reviews Drug Discovery. 20 (3), 173-174 (2021).</li><li>Mullard, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+community+grapples+with+toxicity+issues,+as+pipeline+matures.">Gene therapy community grapples with toxicity issues, as pipeline matures.</a> Nature Reviews Drug Discovery. 20 (11), 804-805 (2021).</li><li>Nature Biotechnology. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+at+the+crossroads.">Gene therapy at the crossroads.</a> Nature Biotechnology. 40 (5), 621 (2022).</li><li>Becker, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fantastic+AAV+Gene+Therapy+Vectors+and+How+to+Find+Them-Random+Diversification,+Rational+Design+and+Machine+Learning.">Fantastic AAV Gene Therapy Vectors and How to Find Them-Random Diversification, Rational Design and Machine Learning.</a> Pathogens. 11 (7), 756 (2022).</li><li>Perabo, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Molecular Therapy. 8 (1), 151-157 (2003).</li><li>Muller, O. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nature Biotechnology. 21 (9), 1040-1046 (2003).</li><li>Dalkara, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo-directed+evolution+of+a+new+adeno-associated+virus+for+therapeutic+outer+retinal+gene+delivery+from+the+vitreous.">In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous.</a> Science Translational Medicine. 5 (189), (2013).</li><li>Sahel, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+recovery+of+visual+function+in+a+blind+patient+after+optogenetic+therapy.">Partial recovery of visual function in a blind patient after optogenetic therapy.</a> Nature Medicine. 27 (7), 1223-1229 (2021).</li><li>Adachi, K., Enoki, T., Kawano, Y., Veraz, M., Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drawing+a+high-resolution+functional+map+of+adeno-associated+virus+capsid+by+massively+parallel+sequencing.">Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing.</a> Nature Communications. 5, 3075 (2014).</li><li>Marsic, D., Mendez-Gomez, H. R., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-accuracy+biodistribution+analysis+of+adeno-associated+virus+variants+by+double+barcode+sequencing.">High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing.</a> Molecular Therapy-Methods &amp; Clinical Development. 2, 15041 (2015).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pulmonary+targeting+of+adeno-associated+viral+vectors+by+next-generation+sequencing-guided+screening+of+random+capsid+displayed+peptide+libraries.">Pulmonary targeting of adeno-associated viral vectors by next-generation sequencing-guided screening of random capsid displayed peptide libraries.</a> Molecular Therapy. 24 (6), 1050-1061 (2016).</li><li>Deverman, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cre-dependent+selection+yields+AAV+variants+for+widespread+gene+transfer+to+the+adult+brain.">Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain.</a> Nature Biotechnology. 34 (2), 204-209 (2016).</li><li>Ravindra Kumar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Cre-dependent+selection+yields+systemic+AAVs+for+targeting+distinct+brain+cell+types.">Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types.</a> Nature Methods. 17 (5), 541-550 (2020).</li><li>Hanlon, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+efficient+AAV+vector+for+robust+CNS+transgene+expression.">Selection of an efficient AAV vector for robust CNS transgene expression.</a> Molecular Therapy-Methods &amp; Clinical Development. 15, 320-332 (2019).</li><li>Nonnenmacher, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+blood-brain-barrier-penetrating+AAV+capsids+by+RNA-driven+biopanning.">Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning.</a> Molecular Therapy-Methods &amp; Clinical Development. 20, 366-378 (2021).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+a+family+of+AAV+capsid+variants+enabling+potent+muscle-directed+gene+delivery+across+species.">Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species.</a> Cell. 184 (19), 4919-4938 (2021).</li><li>Davidsson, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+capsid+evolution+approach+performed+in+vivo+for+the+design+of+AAV+vectors+with+tailored+properties+and+tropism.">A systematic capsid evolution approach performed in vivo for the design of AAV vectors with tailored properties and tropism.</a> Proceedings of the National Academy of Sciences. 116 (52), 27053-27062 (2019).</li><li>Pekrun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+a+barcoded+AAV+capsid+library+to+select+for+clinically+relevant+gene+therapy+vectors.">Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors.</a> Journal of Clinical Investigation Insight. 4 (22), (2019).</li><li>Ogden, P. J., Kelsic, E. D., Sinai, S., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+AAV+capsid+fitness+landscape+reveals+a+viral+gene+and+enables+machine-guided+design.">Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design.</a> Science. 366 (6469), 1139-1143 (2019).</li><li>Kondratov, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+study+of+a+29-capsid+AAV+library+in+a+non-human+primate+central+nervous+system.">A comprehensive study of a 29-capsid AAV library in a non-human primate central nervous system.</a> Molecular Therapy. 29 (9), 2806-2820 (2021).</li><li>Weinmann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+myotropic+AAV+by+massively+parallel+in+vivo+evaluation+of+barcoded+capsid+variants.">Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants.</a> Nature Communications. 11 (1), 5432 (2020).</li><li>Kremer, L. P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+screening+of+novel+AAV+capsids+identifies+variants+for+transduction+of+adult+NSCs+within+the+subventricular+zone.">High throughput screening of novel AAV capsids identifies variants for transduction of adult NSCs within the subventricular zone.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 33-50 (2021).</li><li>Borner, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pre-arrayed+pan-AAV+peptide+display+libraries+for+rapid+single-round+screening.">Pre-arrayed pan-AAV peptide display libraries for rapid single-round screening.</a> Molecular Therapy. 28 (4), 1016-1032 (2020).</li><li>Kienle, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+evolution+of+synthetic+adeno-associated+virus+(AAV)+gene+therapy+vectors+via+DNA+family+shuffling.">Engineering and evolution of synthetic adeno-associated virus (AAV) gene therapy vectors via DNA family shuffling.</a> Journal of Visualized Experiments. (62), e3819 (2012).</li><li>Furuta-Hanawa, B., Yamaguchi, T., Uchida, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+droplet+digital+PCR+as+a+tool+for+titration+and+integrity+evaluation+of+recombinant+adeno-associated+viral+vectors.">Two-dimensional droplet digital PCR as a tool for titration and integrity evaluation of recombinant adeno-associated viral vectors.</a> Human Gene Therapy Methods. 30 (4), 127-136 (2019).</li><li>Lyons, E., Sheridan, P., Tremmel, G., Miyano, S., Sugano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+DNA+barcode+library+generation+for+biomolecule+identification+in+high-throughput+screens.">Large-scale DNA barcode library generation for biomolecule identification in high-throughput screens.</a> Scientific Reports. 7 (1), 13899 (2017).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+design+and+production+strategies+for+novel+adeno-associated+viral+display+peptide+libraries.">Optimization of design and production strategies for novel adeno-associated viral display peptide libraries.</a> Gene Therapy. 24 (8), 470-481 (2017).</li><li>Korbelin, J., Trepel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+successfully+screen+random+adeno-associated+virus+display+peptide+libraries+in+vivo.">How to successfully screen random adeno-associated virus display peptide libraries in vivo.</a> Human Gene Therapy Methods. 28 (3), 109-123 (2017).</li><li>Herrmann, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+all-inclusive+pipeline+for+shuffling+of+adeno-associated+viruses.">A robust and all-inclusive pipeline for shuffling of adeno-associated viruses.</a> American Chemical Society Synthetic Biology. 8 (1), 194-206 (2019).</li><li>Choudhury, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+selection+yields+AAV-B1+Capsid+for+central+nervous+system+and+muscle+gene+therapy.">In vivo selection yields AAV-B1 Capsid for central nervous system and muscle gene therapy.</a> Molecular Therapy. 24 (7), 1247-1257 (2016).</li><li>Buschmann, T., Bystrykh, L. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Levenshtein+error-correcting+barcodes+for+multiplexed+DNA+sequencing.">Levenshtein error-correcting barcodes for multiplexed DNA sequencing.</a> BMC Bioinformatics. 14, 272 (2013).</li><li>Buschmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNABarcodes:+an+R+package+for+the+systematic+construction+of+DNA+sample+tags.">DNABarcodes: an R package for the systematic construction of DNA sample tags.</a> Bioinformatics. 33 (6), 920-922 (2017).</li><li>Li, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+mouse+transcriptomic+BodyMap+across+17+tissues+by+RNA-seq.">A comprehensive mouse transcriptomic BodyMap across 17 tissues by RNA-seq.</a> Scientific Reports. 7 (1), 4200 (2017).</li><li>Clarner, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+one-step+RT-ddPCR+method+to+determine+the+expression+and+potency+of+AAV+vectors.">Development of a one-step RT-ddPCR method to determine the expression and potency of AAV vectors.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 68-77 (2021).</li><li>Zolotukhin, S., Vandenberghe, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV+capsid+design:+A+Goldilocks+challenge.">AAV capsid design: A Goldilocks challenge.</a> Trends in Molecular Medicine. 28 (3), 183-193 (2022).</li><li>Brown, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=deep+parallel+characterization+of+AAV+tropism+and+AAV-mediated+transcriptional+changes+via+single-cell+RNA+sequencing.">deep parallel characterization of AAV tropism and AAV-mediated transcriptional changes via single-cell RNA sequencing.</a> Frontiers in Immunology. 12, 730825 (2021).</li></ol>

इस प्रोटोकॉल में, पेप्टाइड डिस्प्ले एएवी कैप्सिड इंजीनियरिंग और बारकोडेड एएवी लाइब्रेरी स्क्रीनिंग के साथ-साथ लाइब्रेरी संरचना और कैप्सिड प्रदर्शन के जैव सूचना विज्ञान विश्लेषण के लिए आवश्यक चरणो?...

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amplification primer</td>
			<td>ELLA Biotech (Munich, Germany)</td>
			<td>-</td>
			<td>Second-strand synthesis of oligonucleotide insert</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Reagents</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>5067-1504</td>
			<td>DNA fragment validation</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer System</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>G2938C</td>
			<td>DNA fragment validation</td>
		</tr>
		<tr>
			<td>AllPrep DNA/RNA Mini Kit&#160;</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>80204</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Reagents</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>5067-1504</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer System</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>G2938C</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>BC-seq fw:&#160;</td>
			<td>IDT (San Joce, CA, CA, USA)</td>
			<td>ATCACTCTCGGCATGGACGAGC&#160;</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>BC-seq rv:&#160;&#160;</td>
			<td>IDT (San Joce, CA, CA, USA)</td>
			<td>GGCTGGCAACTAGAAGGCACA&#160;</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Millipore Sigma (Burlington, MA, USA)</td>
			<td>44-420-3250ML</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>BglI</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>R0143</td>
			<td>Digestion of double-stranded insert</td>
		</tr>
		<tr>
			<td>C1000 Touch Thermal Cycler</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1851196</td>
			<td>dd-PCR cycler</td>
		</tr>
		<tr>
			<td>dNTPS&#160;</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>N0447S</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>ddPCR Supermix for probes (no dUTP)</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863024</td>
			<td>dd-PCR supermix</td>
		</tr>
		<tr>
			<td>Droplet Generation Oil for Probes</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863005</td>
			<td>dd-PCR droplet generation oil</td>
		</tr>
		<tr>
			<td>DG8 Cartridges for QX100 / QX200 Droplet Generator</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864008</td>
			<td>dd-PCR droplet generation cartridge</td>
		</tr>
		<tr>
			<td>DG8 Cartridge Holder</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863051</td>
			<td>dd-PCR cartridge holder</td>
		</tr>
		<tr>
			<td>Droplet Generator DG8 Gasket</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863009</td>
			<td>dd-PCR cover for cartridge</td>
		</tr>
		<tr>
			<td>ddPCR Plates 96-Well, Semi-Skirted</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>12001925</td>
			<td>dd-PCR 96-well plate</td>
		</tr>
		<tr>
			<td>E.cloni 10G SUPREME Electrocompetent Cells</td>
			<td>Lucigen (Middleton, WI, USA)</td>
			<td>60081-1</td>
			<td>Electrocompetent cells</td>
		</tr>
		<tr>
			<td>Electroporation cuvettes, 1mm</td>
			<td>Biozym Scientific (Oldendorf, Germany)</td>
			<td>748050</td>
			<td>Electroporation</td>
		</tr>
		<tr>
			<td>GAPDH primer/probe mix</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>Mm00186825_cn</td>
			<td>Taqman qPCR primer</td>
		</tr>
		<tr>
			<td>Genepulser Xcell</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1652660</td>
			<td>Electroporation</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Applied Biosystems (Waltham, MA, USA)</td>
			<td>4368814</td>
			<td>cDNA reverse transcription</td>
		</tr>
		<tr>
			<td>ITR_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>ITR_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>ITR_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>Illumina NextSeq 500 system</td>
			<td>Illumina Inc (San Diego, CA, USA)</td>
			<td>SY-415-1001</td>
			<td>NGS Library sequencing</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)*</td>
			<td>Roche AG (Basel, Switzerland)</td>
			<td>KK2600 07958919001</td>
			<td>NGS sample prepration</td>
		</tr>
		<tr>
			<td>MagnaBot 96 Magnetic Separation Device</td>
			<td>Promega GmbH (Madison, WI, USA)</td>
			<td>V8151</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 spectrophotometer</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>ND-2000</td>
			<td>Digestion of double-stranded insert</td>
		</tr>
		<tr>
			<td>NGS_frw</td>
			<td>Sigma-Aldrich (Burlinght, MA, USA)</td>
			<td>GTT CTG TAT CTA CCA ACC TC</td>
			<td>NGS primer</td>
		</tr>
		<tr>
			<td>NGS_rev</td>
			<td>Sigma-Aldrich (Burlinght, MA, USA)</td>
			<td>CGC CTT GTG TGT TGA CAT C</td>
			<td>NGS primer</td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit (75 cycles)</td>
			<td>Illumina Inc (San Diego, CA, USA)</td>
			<td>FC-404-2005</td>
			<td>NGS Library sequencing</td>
		</tr>
		<tr>
			<td>Ovation Library System for Low Complexity Samples Kit&#160;</td>
			<td>NuGEN Technologies, Inc. (San Carlos, CA, USA)</td>
			<td>9092-256</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>PX1 Plate Sealer&#160;</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1814000</td>
			<td>dd-PCR plate sealer</td>
		</tr>
		<tr>
			<td>Pierceable Foil Heat Seal</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1814040</td>
			<td>dd-PCR sealing foil</td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity DNA-Polymerase</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>F530S</td>
			<td>Second-strand synthesis of oligonucleotide insert</td>
		</tr>
		<tr>
			<td>PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000)</td>
			<td>Polysciences, Inc. (Warrington, PA, USA)</td>
			<td>24765-1G</td>
			<td>AAV library preparation</td>
		</tr>
		<tr>
			<td>ProNex Size-Selective Purification System</td>
			<td>Promega GmbH (Madison, WI, USA)</td>
			<td>NG2002</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>Phusion Hot Start II Polymerase&#160;</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>F549L</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche AG (Basel, Switzerland)</td>
			<td>5963117103</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>pRep2Cap2_PIS</td>
			<td></td>
			<td></td>
			<td>ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab&#160;</td>
		</tr>
		<tr>
			<td>QX200 Droplet Generator</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864002</td>
			<td>dd-PCR droplet generator</td>
		</tr>
		<tr>
			<td>QX200 Droplet Reader</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864003</td>
			<td>dd-PCR droplet analysis</td>
		</tr>
		<tr>
			<td>QIAquick Nucleotide Removal Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28306</td>
			<td>Second-strand synthesis of oligonucleotide insert purification</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28704</td>
			<td>Plasmid vector purification</td>
		</tr>
		<tr>
			<td>QIAGEN Plasmid Maxi Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>12162</td>
			<td>Plasmid library DNA preparation</td>
		</tr>
		<tr>
			<td>Qiaquick PCR Purification kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28104</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>Qubit fluorometer</td>
			<td>Invitrogen (Waltham, MA, USA)</td>
			<td>Q32857</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>Q32851</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>QuantiFast PCR Master Mix</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>1044234</td>
			<td>Taqman qPCR</td>
		</tr>
		<tr>
			<td>rep_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>AAGTCCTCGGCCCAGATAGAC</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>rep_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>CAATCACGGCGCACATGT</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>rep_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>FAM-TGATCGTCACCTCCAACA-BHQ1</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>RNase-free DNase</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>79254</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>SfiI</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>R0123</td>
			<td>Digestion of vector</td>
		</tr>
		<tr>
			<td>5 mm, steel Beads</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>69989</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>TRIMER-oligonucleotides</td>
			<td>ELLA Biotech (Munich, Germany)</td>
			<td>-</td>
			<td>Degenerate oligonucleotide</td>
		</tr>
		<tr>
			<td>T4 Ligase</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>M0202L</td>
			<td>Plasmid library ligation</td>
		</tr>
		<tr>
			<td>TissueLyserLT</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>85600</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>YFP_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>GAGCGCACCATCTTCTTCAAG</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>YFP_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>TGTCGCCCTCGAACTTCAC</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>YFP_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>FAM-ACGACGGCAACTACA-BHQ1</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>Zymo DNA Clean &#38; Concentrator-5 (Capped)</td>
			<td>Zymo research (Irvine, CA, USA)</td>
			<td>D4013</td>
			<td>Vector and Ligation purification</td>
		</tr>
	</tbody>
</table>

isolation of next-generation gene therapy vectors through engineering, barcoding, and screening of adeno-associated virus (aav) capsid variants

एडेनो से जुड़े वायरस (एएवी) से प्राप्त जीन डिलीवरी वैक्टर आनुवंशिक रोगों के उपचार के लिए सबसे आशाजनक उपकरणों में से एक हैं, जो नैदानिक डेटा को प्रोत्साहित करने और कई एएवी जीन उपचारों के अनुमोदन से स्पष्ट हैं। एएवी वैक्टर की सफलता के दो प्रमुख कारण हैं (i) अलग-अलग गुणों के साथ विभिन्न स्वाभाविक रूप से पाए जाने वाले वायरल सीरोटाइप का पूर्व अलगाव, और (ii) उनके आणविक इंजीनियरिंग के लिए शक्तिशाली प्रौद्योगिकियों की स्थापना और उच्च थ्रूपुट में पुन: उत्पादन। इन तकनीकों की क्षमता को और बढ़ाने के लिए हाल ही में डीएनए और आरएनए स्तर पर चयनित एएवी कैप्सिड्स को बारकोडिंग करने के लिए रणनीतियों को लागू किया गया है, जिससे एक ही जानवर में सभी प्रमुख अंगों और सेल प्रकारों में विवो स्तरीकरण में उनके व्यापक और समानांतर की अनुमति मिलती है। यहां, हम उपलब्ध कैप्सिड इंजीनियरिंग प्रौद्योगिकियों के विविध शस्त्रागार का प्रतिनिधित्व करने के लिए एएवी पेप्टाइड डिस्प्ले का उपयोग करते हुए पूरक मार्गों के इस सेट को शामिल करते हुए एक बुनियादी पाइपलाइन प्रस्तुत करते हैं। तदनुसार, हम पहले वांछित गुणों वाले उम्मीदवारों के विवो चयन के लिए एएवी पेप्टाइड डिस्प्ले लाइब्रेरी की पीढ़ी के लिए निर्णायक चरणों का वर्णन करते हैं, इसके बाद विवो स्क्रीनिंग में माध्यमिक के लिए सबसे दिलचस्प कैप्सिड वेरिएंट को बारकोड करने का प्रदर्शन करते हैं। इसके बाद, हम एनजीएस डेटा विश्लेषण के दौरान सबसे महत्वपूर्ण चरणों के अवलोकन के साथ निष्कर्ष निकालने से पहले, बारकोड प्रवर्धन और एडाप्टर लिगेशन सहित अगली पीढ़ी के अनुक्रमण (एनजीएस) के लिए पुस्तकालयों के निर्माण के लिए पद्धति का उदाहरण देते हैं। चूंकि यहां बताए गए प्रोटोकॉल बहुमुखी और अनुकूलनीय हैं, शोधकर्ता आसानी से अपने पसंदीदा रोग मॉडल में और जीन थेरेपी अनुप्रयोगों के लिए इष्टतम एएवी कैप्सिड वेरिएंट को समृद्ध करने के लिए उनका उपयोग कर सकते हैं।

एक एएवी 2 पेप्टाइड डिस्प्ले लाइब्रेरी की पीढ़ी। इंजीनियर एएवी के चयन की दिशा में पहले कदम के रूप में, प्लास्मिड लाइब्रेरी की पीढ़ी का वर्णन किया गया है। पेप्टाइड इंसर्ट का उत्पादन पतित प्राइमरो?...

Watch this Scientific Journal Video about Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants at JoVE.com

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

एएवी पेप्टाइड अगली पीढ़ी के एएवी के निर्माण के लिए नए गुणों वाले उम्मीदवारों की बारकोडिंग के माध्यम से पुस्तकालय उत्पादन और बाद में सत्यापन प्रदर्शित करता है।

इंजीनियरिंग, बारकोडिंग और एडेनो-एसोसिएटेड वायरस (एएवी) कैप्सिड वेरिएंट की स्क्रीनिंग के माध्यम से अगली पीढ़ी के जीन थेरेपी वैक्टर का अलगाव

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

Research

JoVE Journal

Bioengineering

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Transplantation of Induced Pluripotent Stem Cell-derived Mesoangioblast-like Myogenic Progenitors in Mouse Models of Muscle Regeneration

मांसपेशियों के उत्थान के माउस मॉडल में प्रेरित Pluripotent स्टेम सेल-व्युत्पन्न मेसोंगियोब्लास्ट की तरह मायोजेनिक प्रोजेनिटर का प्रत्यारोपण

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells ...

Novel Atomic Force Microscopy Based Biopanning for Isolation of Morphology Specific Reagents against TDP-43 Variants in Amyotrophic Lateral Sclerosis

Amyotrophic पार्श्व स्केलेरोसिस में तेदेपा-43 वेरिएंट के खिलाफ आकृति विज्ञान विशिष्ट अभिकर्मकों के अलगाव के लिए उपन्यास परमाणु शक्ति माइक्रोस्कोपी के आधार Biopanning

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in ...

Robotic Mirror Therapy System for Functional Recovery of Hemiplegic Arms

हेमिप्लैजिक शस्त्र के कार्यात्मक वसूली के लिए रोबोट मिरर चिकित्सा प्रणाली

Mirror therapy has been performed as effective occupational therapy in a clinical setting for functional recovery of a hemiplegic arm after stroke. It is ...

Isolation of Murine Adipose Tissue-derived Microvascular Fragments as Vascularization Units for Tissue Engineering

ऊतक इंजीनियरिंग के लिए vascularization इकाइयों के रूप में म्यूरीन वसा ऊतक व्युत्पन्न माईक्रवैस्कुलर टुकड़े के अलगाव

A functional microvascular network is of pivotal importance for the survival and integration of engineered tissue constructs. For this purpose, several ...

Predicting Gene Silencing Through the Spatiotemporal Control of siRNA Release from Photo-responsive Polymeric Nanocarriers

फोटो-उत्तरदायी पॉलीमर नैनोकैरियर्स से सीआरएनए रिहाई के स्पैटिटमॉम्रल कंट्रोल के माध्यम से जीन मुंह की भविष्यवाणी करना

New materials and methods are needed to better control the binding vs. release of nucleic acids for a wide range of applications that require the precise ...

3D Microtissues for Injectable Regenerative Therapy and High-throughput Drug Screening

3 डी Microtissues इंजेक्शन अपक्षयी थेरेपी और उच्च प्रवाह दवा स्क्रीनिंग के लिए

To upgrade traditional 2D cell culture to 3D cell culture, we have integrated microfabrication with cryogelation technology to produce macroporous ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

वयस्क अस्थि मज्जा में MicroRNA हस्तांतरण के लिए प्रोटोकॉल-व्युत्पंन टेम स्टेम कोशिकाओं सेल इंजीनियरिंग चुंबकीय लक्ष्यीकरण के साथ संयुक्त सक्षम करने के लिए

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Studying Cavitation Enhanced Therapy

कैविटेशन एन्हांस्ड थेरेपी का अध्ययन

Interest in the therapeutic applications of ultrasound is significant and growing, with potential clinical targets ranging from cancer to ...

Reliably Engineering and Controlling Stable Optogenetic Gene Circuits in Mammalian Cells

मज़बूती से इंजीनियरिंग और स्तनधारी कोशिकाओं में स्थिर ऑप्टोजेनेटिक जीन सर्किट को नियंत्रित करना

Reliable gene expression control in mammalian cells requires tools with high fold change, low noise, and determined input-to-output transfer functions, ...

Photodegradable Hydrogel Interfaces for Bacteria Screening, Selection, and Isolation

बैक्टीरिया स्क्रीनिंग, चयन, और अलगाव के लिए Photodegradable हाइड्रोजेल इंटरफेस

Biologists have long attempted to understand the relationship between phenotype and genotype. To better understand this connection, it is crucial to ...