Name: isolation of next-generation gene therapy vectors through engineering, barcoding, and screening of adeno-associated virus (aav) capsid variants
Uploaded: 2022-10-18T14:00:00
Description: Watch this Scientific Journal Video about Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants at JoVE.com

D.G.는 DFG 공동 연구 센터 SFB1129 (Projektnummer 240245660) 및 TRR179 (Projektnummer 272983813)와 독일 감염 연구 센터 (DZIF, BMBF; TTU-HIV 04.819).

1. AAV2 무작위 7-mer 펩티드 디스플레이 라이브러리 준비
참고: AAV2 무작위 펩타이드 디스플레이 라이브러리의 준비를 위해 퇴행성 올리고뉴클레오티드를 단일 가닥 DNA로 합성하고, 이중 가닥 DNA로 변환하고, 소화하고, 수용체 플라스미드로 결찰하고, 전기포증합니다.
<ol><li>퇴행성 올리고뉴클레오타이드의 설계<ol><li>퇴행성 올리고뉴클레오티드를 주문하고 코돈 ...

<ol>
	<li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery.">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nature Reviews Drug Discovery. 18 (5), 358-378 (2019).</li><li>Muhuri, M., Levy, D. I., Schulz, M., McCarty, D., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Durability+of+transgene+expression+after+rAAV+gene+therapy.">Durability of transgene expression after rAAV gene therapy.</a> Molecular Therapy. 30 (4), 1364-1380 (2022).</li><li>Li, C., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+adeno-associated+virus+vectors+for+gene+therapy.">Engineering adeno-associated virus vectors for gene therapy.</a> Nature Reviews Genetics. 21 (4), 255-272 (2020).</li><li>Kuzmin, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+clinical+landscape+for+AAV+gene+therapies.">The clinical landscape for AAV gene therapies.</a> Nature Reviews Drug Discovery. 20 (3), 173-174 (2021).</li><li>Mullard, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+community+grapples+with+toxicity+issues,+as+pipeline+matures.">Gene therapy community grapples with toxicity issues, as pipeline matures.</a> Nature Reviews Drug Discovery. 20 (11), 804-805 (2021).</li><li>Nature Biotechnology. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+at+the+crossroads.">Gene therapy at the crossroads.</a> Nature Biotechnology. 40 (5), 621 (2022).</li><li>Becker, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fantastic+AAV+Gene+Therapy+Vectors+and+How+to+Find+Them-Random+Diversification,+Rational+Design+and+Machine+Learning.">Fantastic AAV Gene Therapy Vectors and How to Find Them-Random Diversification, Rational Design and Machine Learning.</a> Pathogens. 11 (7), 756 (2022).</li><li>Perabo, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Molecular Therapy. 8 (1), 151-157 (2003).</li><li>Muller, O. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nature Biotechnology. 21 (9), 1040-1046 (2003).</li><li>Dalkara, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo-directed+evolution+of+a+new+adeno-associated+virus+for+therapeutic+outer+retinal+gene+delivery+from+the+vitreous.">In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous.</a> Science Translational Medicine. 5 (189), (2013).</li><li>Sahel, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+recovery+of+visual+function+in+a+blind+patient+after+optogenetic+therapy.">Partial recovery of visual function in a blind patient after optogenetic therapy.</a> Nature Medicine. 27 (7), 1223-1229 (2021).</li><li>Adachi, K., Enoki, T., Kawano, Y., Veraz, M., Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drawing+a+high-resolution+functional+map+of+adeno-associated+virus+capsid+by+massively+parallel+sequencing.">Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing.</a> Nature Communications. 5, 3075 (2014).</li><li>Marsic, D., Mendez-Gomez, H. R., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-accuracy+biodistribution+analysis+of+adeno-associated+virus+variants+by+double+barcode+sequencing.">High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing.</a> Molecular Therapy-Methods &amp; Clinical Development. 2, 15041 (2015).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pulmonary+targeting+of+adeno-associated+viral+vectors+by+next-generation+sequencing-guided+screening+of+random+capsid+displayed+peptide+libraries.">Pulmonary targeting of adeno-associated viral vectors by next-generation sequencing-guided screening of random capsid displayed peptide libraries.</a> Molecular Therapy. 24 (6), 1050-1061 (2016).</li><li>Deverman, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cre-dependent+selection+yields+AAV+variants+for+widespread+gene+transfer+to+the+adult+brain.">Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain.</a> Nature Biotechnology. 34 (2), 204-209 (2016).</li><li>Ravindra Kumar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Cre-dependent+selection+yields+systemic+AAVs+for+targeting+distinct+brain+cell+types.">Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types.</a> Nature Methods. 17 (5), 541-550 (2020).</li><li>Hanlon, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+efficient+AAV+vector+for+robust+CNS+transgene+expression.">Selection of an efficient AAV vector for robust CNS transgene expression.</a> Molecular Therapy-Methods &amp; Clinical Development. 15, 320-332 (2019).</li><li>Nonnenmacher, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+blood-brain-barrier-penetrating+AAV+capsids+by+RNA-driven+biopanning.">Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning.</a> Molecular Therapy-Methods &amp; Clinical Development. 20, 366-378 (2021).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+a+family+of+AAV+capsid+variants+enabling+potent+muscle-directed+gene+delivery+across+species.">Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species.</a> Cell. 184 (19), 4919-4938 (2021).</li><li>Davidsson, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+capsid+evolution+approach+performed+in+vivo+for+the+design+of+AAV+vectors+with+tailored+properties+and+tropism.">A systematic capsid evolution approach performed in vivo for the design of AAV vectors with tailored properties and tropism.</a> Proceedings of the National Academy of Sciences. 116 (52), 27053-27062 (2019).</li><li>Pekrun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+a+barcoded+AAV+capsid+library+to+select+for+clinically+relevant+gene+therapy+vectors.">Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors.</a> Journal of Clinical Investigation Insight. 4 (22), (2019).</li><li>Ogden, P. J., Kelsic, E. D., Sinai, S., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+AAV+capsid+fitness+landscape+reveals+a+viral+gene+and+enables+machine-guided+design.">Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design.</a> Science. 366 (6469), 1139-1143 (2019).</li><li>Kondratov, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+study+of+a+29-capsid+AAV+library+in+a+non-human+primate+central+nervous+system.">A comprehensive study of a 29-capsid AAV library in a non-human primate central nervous system.</a> Molecular Therapy. 29 (9), 2806-2820 (2021).</li><li>Weinmann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+myotropic+AAV+by+massively+parallel+in+vivo+evaluation+of+barcoded+capsid+variants.">Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants.</a> Nature Communications. 11 (1), 5432 (2020).</li><li>Kremer, L. P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+screening+of+novel+AAV+capsids+identifies+variants+for+transduction+of+adult+NSCs+within+the+subventricular+zone.">High throughput screening of novel AAV capsids identifies variants for transduction of adult NSCs within the subventricular zone.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 33-50 (2021).</li><li>Borner, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pre-arrayed+pan-AAV+peptide+display+libraries+for+rapid+single-round+screening.">Pre-arrayed pan-AAV peptide display libraries for rapid single-round screening.</a> Molecular Therapy. 28 (4), 1016-1032 (2020).</li><li>Kienle, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+evolution+of+synthetic+adeno-associated+virus+(AAV)+gene+therapy+vectors+via+DNA+family+shuffling.">Engineering and evolution of synthetic adeno-associated virus (AAV) gene therapy vectors via DNA family shuffling.</a> Journal of Visualized Experiments. (62), e3819 (2012).</li><li>Furuta-Hanawa, B., Yamaguchi, T., Uchida, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+droplet+digital+PCR+as+a+tool+for+titration+and+integrity+evaluation+of+recombinant+adeno-associated+viral+vectors.">Two-dimensional droplet digital PCR as a tool for titration and integrity evaluation of recombinant adeno-associated viral vectors.</a> Human Gene Therapy Methods. 30 (4), 127-136 (2019).</li><li>Lyons, E., Sheridan, P., Tremmel, G., Miyano, S., Sugano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+DNA+barcode+library+generation+for+biomolecule+identification+in+high-throughput+screens.">Large-scale DNA barcode library generation for biomolecule identification in high-throughput screens.</a> Scientific Reports. 7 (1), 13899 (2017).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+design+and+production+strategies+for+novel+adeno-associated+viral+display+peptide+libraries.">Optimization of design and production strategies for novel adeno-associated viral display peptide libraries.</a> Gene Therapy. 24 (8), 470-481 (2017).</li><li>Korbelin, J., Trepel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+successfully+screen+random+adeno-associated+virus+display+peptide+libraries+in+vivo.">How to successfully screen random adeno-associated virus display peptide libraries in vivo.</a> Human Gene Therapy Methods. 28 (3), 109-123 (2017).</li><li>Herrmann, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+all-inclusive+pipeline+for+shuffling+of+adeno-associated+viruses.">A robust and all-inclusive pipeline for shuffling of adeno-associated viruses.</a> American Chemical Society Synthetic Biology. 8 (1), 194-206 (2019).</li><li>Choudhury, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+selection+yields+AAV-B1+Capsid+for+central+nervous+system+and+muscle+gene+therapy.">In vivo selection yields AAV-B1 Capsid for central nervous system and muscle gene therapy.</a> Molecular Therapy. 24 (7), 1247-1257 (2016).</li><li>Buschmann, T., Bystrykh, L. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Levenshtein+error-correcting+barcodes+for+multiplexed+DNA+sequencing.">Levenshtein error-correcting barcodes for multiplexed DNA sequencing.</a> BMC Bioinformatics. 14, 272 (2013).</li><li>Buschmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNABarcodes:+an+R+package+for+the+systematic+construction+of+DNA+sample+tags.">DNABarcodes: an R package for the systematic construction of DNA sample tags.</a> Bioinformatics. 33 (6), 920-922 (2017).</li><li>Li, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+mouse+transcriptomic+BodyMap+across+17+tissues+by+RNA-seq.">A comprehensive mouse transcriptomic BodyMap across 17 tissues by RNA-seq.</a> Scientific Reports. 7 (1), 4200 (2017).</li><li>Clarner, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+one-step+RT-ddPCR+method+to+determine+the+expression+and+potency+of+AAV+vectors.">Development of a one-step RT-ddPCR method to determine the expression and potency of AAV vectors.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 68-77 (2021).</li><li>Zolotukhin, S., Vandenberghe, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV+capsid+design:+A+Goldilocks+challenge.">AAV capsid design: A Goldilocks challenge.</a> Trends in Molecular Medicine. 28 (3), 183-193 (2022).</li><li>Brown, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=deep+parallel+characterization+of+AAV+tropism+and+AAV-mediated+transcriptional+changes+via+single-cell+RNA+sequencing.">deep parallel characterization of AAV tropism and AAV-mediated transcriptional changes via single-cell RNA sequencing.</a> Frontiers in Immunology. 12, 730825 (2021).</li></ol>

이 프로토콜에서는 펩타이드 디스플레이 AAV 캡시드 엔지니어링 및 바코드 AAV 라이브러리 스크리닝, 라이브러리 구성 및 캡시드 성능의 생물정보학적 분석에 필요한 단계를 간략하게 설명합니다. 이 프로토콜은 대부분의 바이러스학 실험실이 분자 생물학 기술에 대한 숙련도에 맞게 프로그래밍 기술이 뒤쳐져 있기 때문에 이러한 유형의 라이브러리에 대한 생물정보학적 분석을 용이하게 하는 단...

유전자 전달 요법은 질병을 예방, 치료, 치료 또는 개선하기 위해 세포 유전 물질을 복구, 교체 또는 변경하기 위해 세포에 유전 물질을 도입하는 것입니다. 생체 내 및 생체 외 모두에서 유전자 전달은 비바이러스 및 바이러스의 서로 다른 전달 시스템에 의존합니다. 바이러스는 표적 세포를 효율적으로 형질도입하기 위해 자연적으로 진화했으며 전달 벡터로 사용될 수 있습니다. 유전자 치료에 사용되는 다양한 유형의 바이러스 벡터 중에서, 아데노 관련 바이러스는 병원성, 안전성, 낮은 면역원성, 그리고 가장 중요하게는 장기간의 비통합 발현을 유지하는 능력의 부족으로 인해 점점 더 많이 사용되고 있다 1,2,3. AAV 유전자 치료는 지난 10년 동안 상당한 성과를 거두었습니다. 유럽 의약품 청 (European Medicines Agency)과 미국 식품의 약국 (Food and Drug Administration)은 3,4. 혈우병, 근육, 심장, 신경계 질환과 같은 다양한 질병을 치료하기 위한 여러 임상 시험도 진행 중이다3. 유전자 치료 분야는 수십 년에 걸친 발전에도 불구하고 최근 몇 년 동안 일련의 차질을 빚어왔다.4 가장 중요한 것은 임상 시험5에서 용량 제한 독성으로 인해 사망이 보류되었는데, 이는 특히 근육과 같이 거대하거나 뇌와 같이 접근하기 어려운 조직에서 발생했다6.
현재 임상 시험에 사용되고 있는 AAV 벡터는 몇 가지 예외를 제외하고 천연 혈청형에 속한다1. AAV 엔지니어링은 우수한 장기 또는 세포 특이성과 효율성을 가진 벡터를 개발할 수 있는 기회를 제공합니다. 지난 20년 동안 펩타이드 디스플레이, 루프 스왑, 캡시드 DNA 셔플링, 오류가 발생하기 쉬운 PCR 및 표적 설계와 같은 여러 접근 방식이 성공적으로 적용되어 다양한 특성을 가진 개별 AAV 변이체 또는 라이브러리를 생성했습니다7. 그런 다음 이들은 다른 곳에서 검토된 바와 같이 원하는 특성을 가진 변이체를 선택하기 위해 여러 차례의 지시된 진화를 거칩니다 1,3. 모든 캡시드 진화 전략 중에서 펩타이드 디스플레이 AAV 라이브러리는 몇 가지 고유한 특성으로 인해 가장 널리 사용되었습니다: 상대적으로 생성하기 쉽고 높은 다양성과 높은 처리량 시퀀싱을 달성할 수 있어 진화를 추적할 수 있습니다.
최초의 성공적인 펩타이드 삽입 AAV 라이브러리는 거의 20년 전에 설명되었습니다. 첫 번째 중 하나에서, Perabo et al.8 은 무작위로 생성된 올리고뉴클레오티드 풀이 캡시드로부터 돌출된 3중 축에서 VP1 캡시드 단백질의 아미노산 587에 해당하는 위치의 플라스미드에 삽입된 변형된 AAV2 캡시드의 라이브러리를 구성했습니다. 아데노바이러스 동시 감염을 사용하여 AAV 라이브러리는 여러 차례의 선택을 통해 진화되었으며, 최종 재표적 변이체는 부모 AAV2에 불응성인 세포주를 형질도입할 수 있는 것으로 나타났다8. 그 후 얼마 지나지 않아 Müller et al.9 는 라이브러리 제작을 위한 2단계 시스템을 도입하여 프로토콜을 크게 개선했습니다. 처음에는 플라스미드 라이브러리가 아데노바이러스 헬퍼 플라스미드와 함께 키메라 캡시드를 포함하는 AAV 라이브러리를 생성하는 데 사용됩니다. 이 AAV 셔틀 라이브러리는 세포당 하나의 바이러스 게놈을 도입하는 것을 목표로 낮은 감염 다중도(MOI)에서 세포를 감염시키는 데 사용됩니다. 아데노 바이러스와의 동시 감염은 일치하는 게놈과 캡시드9를 가진 AAV의 생산을 보장합니다. 약 10 년 후, Dalkara10 은 생체 내 진화를 사용하여 7m8 변종을 만들었습니다. 이 변이체는 10개의 아미노산 삽입(LALGETTRPA)을 가지며, 그 중 3개는 링커로 작용하고, 유리체강내 주사 후 외부 망막을 효율적으로 표적으로 한다10. 이 조작된 캡시드는 지금까지 클리닉에 도착한 몇 안 되는 조작된 캡시드 중 하나이기 때문에 탁월한 성공 사례입니다11.
이 분야는 차세대 염기서열 분석(NGS) 기술의 도입으로 두 번째 성장을 경험했습니다. 2014년 Adachi et al.12와 2015년 Marsic et al.13의 두 간행물은 바코드화된 AAV 캡시드 라이브러리의 분포를 높은 정확도로 추적하는 NGS의 힘을 보여주었습니다. 몇 년 후, 바코드 영역의 NGS는 캡시드 진화를 따르기 위해 펩티드 삽입 영역에 적응되었습니다. Körbelin et al.14는 폐 표적 AAV2 기반 캡시드를 식별하기 위해 NGS 유도 스크리닝을 수행했습니다. NGS 분석은 선택 라운드 간의 농축 점수, 조직 특이성을 결정하기 위한 일반 특이도 점수, 마지막으로 결합 점수14의 세 가지 평가 점수를 계산하는 데 도움이 되었습니다. Gradinaru 실험실15는 같은 해에 Cre-recombination-based AAV 표적 진화 (CREATE) 시스템을 발표하여 세포 유형별 선택을 용이하게했습니다. 이 시스템에서 캡시드 라이브러리는 polyA 신호가 두 개의 loxP 사이트 옆에 있기 때문에 Cre-반전 가능한 스위치를 전달합니다. 그런 다음 AAV 라이브러리를 Cre 마우스에 주입하여 polyA 신호가 Cre+ 세포에서만 반전되어 캡시드 유전자 내의 정방향 프라이머와 역방향 PCR 프라이머의 결합을 위한 주형을 제공합니다. 이 매우 특이적인 PCR 구조를 통해 AAV-PHP를 식별할 수 있었습니다. 혈액뇌장벽을 통과할 수 있는 B 변이체15. 이 시스템은 M-CREATE(Multiplexed-CREATE)로 더욱 발전했으며, 여기서 NGS와 합성 라이브러리 생성은 파이프라인(16)에 통합되었다.
맥과이어 연구실(Maguire lab)17의 개선된 RNA 기반 버전인 iTransduce는 세포를 기능적으로 형질도입하고 게놈을 발현하는 캡시드의 DNA 수준에서 선택할 수 있습니다. 펩티드 디스플레이 라이브러리의 바이러스 게놈은 유비쿼터스 프로모터의 제어 하에 Cre 유전자 및 p41 프로모터의 제어 하에 캡시드 유전자를 포함한다. 라이브러리는 tdTomato의 상류에 loxP-STOP-loxP 카세트를 갖는 마우스에 주입됩니다. 바이러스 게놈을 발현하는 AAV 변이체로 형질도입된 세포는 Cre가 tdTomato를 발현하고, 세포 마커와 결합하여 분류 및 선택될 수 있다17. 유사하게, Nonnenmacher et al.18 및 Tabebordbar et al.19는 캡시드 유전자 라이브러리를 조직 특이적 프로모터의 제어 하에 두었습니다. 상이한 동물 모델에 주사한 후, 바이러스 RNA를 사용하여 캡시드 변이체를 분리하였다.
또 다른 방법은 바코드를 사용하여 캡시드 라이브러리에 태그를 지정하는 것입니다. Björklund lab20 은 바코드 펩타이드 삽입 캡시드 라이브러리에 이 접근 방식을 사용하고 바코드 합리적 AAV 벡터 진화(BRAVE)를 개발했습니다. 한 플라스미드에서 Rep2Cap 카세트는 ITR(Inverted Terminal Repeats) 측면에 노란색 형광 단백질(YFP) 발현, 바코드 태그가 부착된 이식유전자 옆에 클로닝됩니다. 캡 끝과 바코드 시작 부분 사이의 loxP 부위를 사용하여 시험관 내 Cre 재조합은 NGS에 충분히 작은 단편을 생성함으로써 펩타이드 삽입과 고유한 바코드(룩업 테이블, LUT)의 결합을 허용합니다. AAV 생산은 플라스미드 라이브러리를 사용하여 수행되고 mRNA에서 발현된 바코드는 생체 내 적용 후 NGS20으로 다시 스크리닝됩니다. 캡시드 라이브러리가 전체 캡시드 유전자의 변이체(즉, 섞인 라이브러리)로 구성된 경우 긴 읽기 시퀀싱을 사용해야 합니다. 여러 그룹이 바코드를 사용하여 이러한 다양한 라이브러리에 태그를 지정했으며, 이를 통해 더 높은 판독 깊이의 NGS를 사용할 수 있습니다. Kay lab21 은 캡 polyA 신호의 다운스트림에 바코드가 있는 매우 다양한 캡 시드 셔플 라이브러리에 태그를 지정했습니다. 첫 번째 단계에서, 바코드화된 플라스미드 라이브러리가 생성되었고, 섞인 캡시드 유전자 라이브러리가 그 안에 클로닝되었다. 그런 다음 MiSeq(짧은 읽기, 더 높은 읽기 깊이) 및 PacBio(긴 읽기, 더 낮은 읽기 깊이) NGS와 Sanger 시퀀싱의 조합을 사용하여 LUT21을 생성했습니다. 2019년에 Church Lab22 의 Ogden과 동료들은 모든 위치에서 단일 지점 돌연변이, 삽입 및 결실이 있는 라이브러리를 사용하여 여러 기능에 대한 AAV2 캡시드 적합성을 설명했으며, 이는 궁극적으로 기계 유도 설계를 가능하게 했습니다. 라이브러리의 생성을 위해 캡시드 유전자의 더 작은 단편을 합성하고, 바코드로 태그를 지정하고, 차세대 시퀀싱한 다음, 전체 캡시드 유전자에 클로닝했습니다. NGS 데이터는 LUT를 생성하는 데 사용되었습니다. 그런 다음 라이브러리는 바코드와 짧은 판독 시퀀싱만을 사용하여 스크리닝되었으며, 이는 차례로 더 높은 판독 깊이(22)를 허용합니다.
바코드 라이브러리는 캡시드 라이브러리를 여러 차례 선택하거나 캡시드 진화 연구와 무관하게 알려진 자연적 및 조작된 변이체 풀을 스크리닝하는 데 주로 사용되었습니다. 이러한 라이브러리의 장점은 여러 캡시드를 스크리닝하는 동시에 동물 수를 줄이고 동물 간의 변동을 최소화할 수 있다는 것입니다. 이 기술을 AAV 분야에 도입한 첫 번째 연구는 거의 10년 전에 발표되었습니다. Nakai lab12 는 한 쌍의 12-뉴클레오티드 바코드를 사용하여 AAV9의 VP1에서 아미노산 356 내지 736을 포함하는 191개의 이중 알라닌 돌연변이체에 태그를 붙였습니다. NGS를 사용하여, 라이브러리는 갈락토오스 결합 및 기타 특성에 대해 생체 내에서 스크리닝되었다12. Marsic과 동료들은 1 년 후 이중 막대 분석을 사용하여 AAV 변이체의 생체 분포를 설명했다13. 인간이 아닌 영장류에 대한 보다 최근의 연구에서는 서로 다른 전달 경로를 사용하여 29개의 캡시드의 중추신경계 내 생체 분포를 비교했습니다23. 우리 연구실은 최근 천연 및 엔지니어링 AAV를 포함하는 183 가지 변형의 바코드 AAV 라이브러리 스크린을 발표했습니다. DNA 및 RNA 수준에 대한 이러한 스크리닝은 마우스에서 고도의 근친화성 AAV 변이체(24)를 식별하게 했으며, 마우스 뇌(25)에서 높은 세포 유형 특이성을 나타내는 다른 변이체를 식별했습니다.
여기에서는 이 작업에 사용된 방법론을 설명하고 AAV 펩타이드 디스플레이 라이브러리의 스크리닝을 포함하도록 확장합니다. 이것은 AAV2 펩타이드 디스플레이 라이브러리의 생성, 정량화를 위한 디지털 액적 PCR(dd-PCR) 방법, 그리고 마지막으로 부분적으로 Weinmann과 동료24의 작업을 기반으로 AAV 변이체를 분석하기 위한 NGS 파이프라인으로 구성됩니다. 마지막으로, 동일한 간행물에 사용된 바코드 AAV 라이브러리 및 NGS 파이프라인의 생성에 대한 설명이 제공됩니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amplification primer</td>
			<td>ELLA Biotech (Munich, Germany)</td>
			<td>-</td>
			<td>Second-strand synthesis of oligonucleotide insert</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Reagents</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>5067-1504</td>
			<td>DNA fragment validation</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer System</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>G2938C</td>
			<td>DNA fragment validation</td>
		</tr>
		<tr>
			<td>AllPrep DNA/RNA Mini Kit&#160;</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>80204</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>Agilent DNA 1000 Reagents</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>5067-1504</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer System</td>
			<td>Agilent Technologies (Santa Clara, CA, USA)</td>
			<td>G2938C</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>BC-seq fw:&#160;</td>
			<td>IDT (San Joce, CA, CA, USA)</td>
			<td>ATCACTCTCGGCATGGACGAGC&#160;</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>BC-seq rv:&#160;&#160;</td>
			<td>IDT (San Joce, CA, CA, USA)</td>
			<td>GGCTGGCAACTAGAAGGCACA&#160;</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Millipore Sigma (Burlington, MA, USA)</td>
			<td>44-420-3250ML</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>BglI</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>R0143</td>
			<td>Digestion of double-stranded insert</td>
		</tr>
		<tr>
			<td>C1000 Touch Thermal Cycler</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1851196</td>
			<td>dd-PCR cycler</td>
		</tr>
		<tr>
			<td>dNTPS&#160;</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>N0447S</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>ddPCR Supermix for probes (no dUTP)</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863024</td>
			<td>dd-PCR supermix</td>
		</tr>
		<tr>
			<td>Droplet Generation Oil for Probes</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863005</td>
			<td>dd-PCR droplet generation oil</td>
		</tr>
		<tr>
			<td>DG8 Cartridges for QX100 / QX200 Droplet Generator</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864008</td>
			<td>dd-PCR droplet generation cartridge</td>
		</tr>
		<tr>
			<td>DG8 Cartridge Holder</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863051</td>
			<td>dd-PCR cartridge holder</td>
		</tr>
		<tr>
			<td>Droplet Generator DG8 Gasket</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1863009</td>
			<td>dd-PCR cover for cartridge</td>
		</tr>
		<tr>
			<td>ddPCR Plates 96-Well, Semi-Skirted</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>12001925</td>
			<td>dd-PCR 96-well plate</td>
		</tr>
		<tr>
			<td>E.cloni 10G SUPREME Electrocompetent Cells</td>
			<td>Lucigen (Middleton, WI, USA)</td>
			<td>60081-1</td>
			<td>Electrocompetent cells</td>
		</tr>
		<tr>
			<td>Electroporation cuvettes, 1mm</td>
			<td>Biozym Scientific (Oldendorf, Germany)</td>
			<td>748050</td>
			<td>Electroporation</td>
		</tr>
		<tr>
			<td>GAPDH primer/probe mix</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>Mm00186825_cn</td>
			<td>Taqman qPCR primer</td>
		</tr>
		<tr>
			<td>Genepulser Xcell</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1652660</td>
			<td>Electroporation</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Applied Biosystems (Waltham, MA, USA)</td>
			<td>4368814</td>
			<td>cDNA reverse transcription</td>
		</tr>
		<tr>
			<td>ITR_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>ITR_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>ITR_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>Illumina NextSeq 500 system</td>
			<td>Illumina Inc (San Diego, CA, USA)</td>
			<td>SY-415-1001</td>
			<td>NGS Library sequencing</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)*</td>
			<td>Roche AG (Basel, Switzerland)</td>
			<td>KK2600 07958919001</td>
			<td>NGS sample prepration</td>
		</tr>
		<tr>
			<td>MagnaBot 96 Magnetic Separation Device</td>
			<td>Promega GmbH (Madison, WI, USA)</td>
			<td>V8151</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 spectrophotometer</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>ND-2000</td>
			<td>Digestion of double-stranded insert</td>
		</tr>
		<tr>
			<td>NGS_frw</td>
			<td>Sigma-Aldrich (Burlinght, MA, USA)</td>
			<td>GTT CTG TAT CTA CCA ACC TC</td>
			<td>NGS primer</td>
		</tr>
		<tr>
			<td>NGS_rev</td>
			<td>Sigma-Aldrich (Burlinght, MA, USA)</td>
			<td>CGC CTT GTG TGT TGA CAT C</td>
			<td>NGS primer</td>
		</tr>
		<tr>
			<td>NextSeq 500/550 High Output Kit (75 cycles)</td>
			<td>Illumina Inc (San Diego, CA, USA)</td>
			<td>FC-404-2005</td>
			<td>NGS Library sequencing</td>
		</tr>
		<tr>
			<td>Ovation Library System for Low Complexity Samples Kit&#160;</td>
			<td>NuGEN Technologies, Inc. (San Carlos, CA, USA)</td>
			<td>9092-256</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>PX1 Plate Sealer&#160;</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1814000</td>
			<td>dd-PCR plate sealer</td>
		</tr>
		<tr>
			<td>Pierceable Foil Heat Seal</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1814040</td>
			<td>dd-PCR sealing foil</td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity DNA-Polymerase</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>F530S</td>
			<td>Second-strand synthesis of oligonucleotide insert</td>
		</tr>
		<tr>
			<td>PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000)</td>
			<td>Polysciences, Inc. (Warrington, PA, USA)</td>
			<td>24765-1G</td>
			<td>AAV library preparation</td>
		</tr>
		<tr>
			<td>ProNex Size-Selective Purification System</td>
			<td>Promega GmbH (Madison, WI, USA)</td>
			<td>NG2002</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>Phusion Hot Start II Polymerase&#160;</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>F549L</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche AG (Basel, Switzerland)</td>
			<td>5963117103</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>pRep2Cap2_PIS</td>
			<td></td>
			<td></td>
			<td>ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab&#160;</td>
		</tr>
		<tr>
			<td>QX200 Droplet Generator</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864002</td>
			<td>dd-PCR droplet generator</td>
		</tr>
		<tr>
			<td>QX200 Droplet Reader</td>
			<td>Bio-Rad (Hercules, CA, USA)</td>
			<td>1864003</td>
			<td>dd-PCR droplet analysis</td>
		</tr>
		<tr>
			<td>QIAquick Nucleotide Removal Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28306</td>
			<td>Second-strand synthesis of oligonucleotide insert purification</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28704</td>
			<td>Plasmid vector purification</td>
		</tr>
		<tr>
			<td>QIAGEN Plasmid Maxi Kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>12162</td>
			<td>Plasmid library DNA preparation</td>
		</tr>
		<tr>
			<td>Qiaquick PCR Purification kit</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>28104</td>
			<td>Sample prepration for NGS library</td>
		</tr>
		<tr>
			<td>Qubit fluorometer</td>
			<td>Invitrogen (Waltham, MA, USA)</td>
			<td>Q32857</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>Qubit dsDNA HS</td>
			<td>Thermo Fischer Scientific (Waltham, MA, USA)</td>
			<td>Q32851</td>
			<td>NGS Library preparation</td>
		</tr>
		<tr>
			<td>QuantiFast PCR Master Mix</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>1044234</td>
			<td>Taqman qPCR</td>
		</tr>
		<tr>
			<td>rep_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>AAGTCCTCGGCCCAGATAGAC</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>rep_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>CAATCACGGCGCACATGT</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>rep_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>FAM-TGATCGTCACCTCCAACA-BHQ1</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>RNase-free DNase</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>79254</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>SfiI</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>R0123</td>
			<td>Digestion of vector</td>
		</tr>
		<tr>
			<td>5 mm, steel Beads</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>69989</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>TRIMER-oligonucleotides</td>
			<td>ELLA Biotech (Munich, Germany)</td>
			<td>-</td>
			<td>Degenerate oligonucleotide</td>
		</tr>
		<tr>
			<td>T4 Ligase</td>
			<td>New England Biolabs (Ipswich, MA, USA)</td>
			<td>M0202L</td>
			<td>Plasmid library ligation</td>
		</tr>
		<tr>
			<td>TissueLyserLT</td>
			<td>Qiagen (Venlo, Netherlands)</td>
			<td>85600</td>
			<td>DNA/RNA extraction</td>
		</tr>
		<tr>
			<td>YFP_fw</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>GAGCGCACCATCTTCTTCAAG</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>YFP_rv</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>TGTCGCCCTCGAACTTCAC</td>
			<td>dd-PCR primer</td>
		</tr>
		<tr>
			<td>YFP_probe</td>
			<td>IDT (San Joce, CA, USA)</td>
			<td>FAM-ACGACGGCAACTACA-BHQ1</td>
			<td>dd-PCR probe</td>
		</tr>
		<tr>
			<td>Zymo DNA Clean &#38; Concentrator-5 (Capped)</td>
			<td>Zymo research (Irvine, CA, USA)</td>
			<td>D4013</td>
			<td>Vector and Ligation purification</td>
		</tr>
	</tbody>
</table>

isolation of next-generation gene therapy vectors through engineering, barcoding, and screening of adeno-associated virus (aav) capsid variants

아데노 관련 바이러스(AAV)에서 파생된 유전자 전달 벡터는 임상 데이터를 장려하고 여러 AAV 유전자 요법을 승인함으로써 입증된 유전 질환 치료를 위한 가장 유망한 도구 중 하나입니다. AAV 벡터의 성공에 대한 두 가지 주요 이유는 (i) 뚜렷한 특성을 가진 다양한 자연 발생 바이러스 혈청형의 사전 분리와 (ii) 분자 공학 및 높은 처리량의 용도 변경을 위한 강력한 기술의 후속 확립입니다. 이러한 기술의 잠재력을 더욱 강화하는 것은 최근 DNA 및 RNA 수준에서 선택된 AAV 캡시드를 바코딩하기 위한 전략으로 구현되어 단일 동물의 모든 주요 기관 및 세포 유형에서 포괄적이고 평행한 생체 내 계층화를 허용합니다. 여기에서는 사용 가능한 캡시드 엔지니어링 기술의 다양한 무기고를 나타내기 위해 AAV 펩타이드 디스플레이를 사용하여 이러한 보완 방법을 포함하는 기본 파이프라인을 제시합니다. 따라서, 우리는 먼저 원하는 특성을 가진 후보의 생체 내 선택을 위한 AAV 펩타이드 디스플레이 라이브러리의 생성을 위한 중추적인 단계를 설명한 다음, 2차 생체 내 스크리닝을 위해 가장 흥미로운 캡시드 변이체를 바코드화하는 방법에 대한 시연을 설명합니다. 다음으로, NGS 데이터 분석 중 가장 중요한 단계에 대한 개요로 마무리하기 전에 바코드 증폭 및 어댑터 결찰을 포함한 차세대 염기서열 분석(NGS)을 위한 라이브러리 생성 방법론을 예시합니다. 여기에 보고된 프로토콜은 다재다능하고 적응력이 뛰어나기 때문에 연구자들은 이를 쉽게 활용하여 선호하는 질병 모델 및 유전자 치료 응용 분야에서 최적의 AAV 캡시드 변이체를 풍부하게 할 수 있습니다.

AAV2 펩타이드 디스플레이 라이브러리의 생성. 조작된 AAV를 선택하기 위한 첫 번째 단계로, 플라스미드 라이브러리의 생성에 대해 설명합니다. 펩티드 삽입물은 퇴화 프라이머를 사용하여 생산된다. 64에서 20으로 코돈의 조합을 줄이면 단백질 수준이 아닌 DNA의 라이브러리 다양성을 감소시킴으로써 정지 코돈을 제거하고 NGS 분석을 용이하게 하는 이점이 있습니다. 올리고뉴클레오티?...

Watch this Scientific Journal Video about Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants at JoVE.com

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

AAV 펩타이드 디스플레이 라이브러리 생성 및 차세대 AAV 생성을 위한 새로운 특성을 가진 후보 물질의 바코딩을 통한 후속 검증.

아데노 관련 바이러스(AAV) 캡시드 변이체의 엔지니어링, 바코드 및 스크리닝을 통한 차세대 유전자 치료 벡터의 분리

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

이 프로토콜은 바이러스의 공학, 다양화 및 계층화를 가능하게 함으로써 바이러스의 자연적 진화와 인간 유전자 치료를 위한 재조합 벡터로서의 사용 사이의 상당한 격차를 해소합니다. 이 기술을 사용하면 짧은 AAV 변이체에서 신규, 분리 또는 조작된 아데노 관련 바이러스에 대한 고처리량 병렬 스크리닝이 가능하므로 동물 수, 작업, 비용 및 시간을 절약할 수 있습니다. 확인된 AVV 캡시드 변이체는 치료적 이식유전자의 AAV 기반 전달의 효능 및 특이성을 증가시켜 필요한 바이러스 용량을 감소시킬 수 있습니다.이것은 유전자 치료의 안전성과 적용 가능성을 향상시킬 수 있습니다. 동일한 접근법이 다른 유전자 전달 비히클의 캡시드 또는 프로모터 엔지니어링에도 사용될 수 있으며, 이는 생물학 및 유전자 치료에서의 사용에 대한 이해를 향상시킵니다. 이 절차를 시연하는 데 도움이되는 박사 과정 학생 인 Jonas Becker와 Jixin Liu, 박사후 연구원 Joanna Szumska와 Margarita Zayas, 그리고 연구 조교 인 Emma Gerstmann과 Ellen Widtke가 내 실험실에서 나올 것입니다.먼저 Python 3 및 Biopython을 사용하여 NGS 염기서열 분석 데이터를 분석합니다. NGS 분석은 두 단계로 구성됩니다. 첫 번째 단계에서는 스크립트 1을 사용하여 측면 시퀀스, 길이 및 위치와 같은 특정 기준을 충족하는 시퀀스와 필요한 정보를 제공하는 구성 파일을 시퀀스 파일에서 검색합니다.두 번째 단계의 경우, 스크립트 번호 2와 구성 및 zuordnung을 사용하여 AGWGGC 시퀀스에서 시작하여 추출된 시퀀스를 번역합니다. 필요한 정보를 제공하는 txt 파일입니다. 스크립트와 데이터라는 두 개의 폴더를 준비합니다.시퀀싱으로 인한 Gzip 압축 파일을 데이터 폴더에 복사합니다. 그런 다음 Python 및 구성 파일을 텍스트 원고에 설명된 대로 스크립트 폴더에 복사합니다. 스크립트를 실행하기 전에 zuordnung을 엽니다.txt 파일을 열고 두 개의 탭으로 구분된 열을 추가합니다. 1열에 Gzip 파일의 이름을 입력하고 2열에 원하는 최종 이름을 입력합니다. 텍스트 원고에 설명된 대로 구성 파일의 변수를 변경합니다.특정 명령을 사용하여 변이 서열 검출 및 추출을 시작합니다. 출력은 추출된 DNA 서열과 판독 횟수가 포함된 TXT 파일입니다. 이 파일의 헤더에는 통계 데이터가 포함되어 있으며 이러한 데이터는 다음 파일로 전송됩니다.이 TXT 데이터는 DNA 서열이 번역, 순위 지정 및 분석되는 스크립트 번호 2의 입력 파일이 됩니다. 특정 명령을 사용하여 텍스트 원고에 설명된 대로 스크립트 1의 텍스트 출력 파일에 대한 PV 변환 및 분석을 시작합니다. 스크립트 번호 2의 출력 파일은 zuordnung에 있는 조회 테이블의 두 번째 열을 사용하여 이름이 지정됩니다.분석 유형에 따라 확장자가 있는 txt입니다. 세 개의 출력 파일의 첫 번째 행과 입력 텍스트 파일의 각 DNA 서열 색인이 있는 첫 번째 열에 통계 데이터가 포함되어 있는지 확인합니다. 나머지 컬럼은 DNA 서열, 판독 횟수, 순방향 또는 역방향 판독 및 번역된 펩타이드 서열로 구성되어야 합니다.유효하지 않은 시퀀스에는 NA가 있어야 하며 마지막 두 열에서 유효하지 않아야 합니다. 사용자의 필요에 따라 사용 가능한 소프트웨어를 사용하여 출력 파일을 시각화합니다. Python 3에서 사용자 지정 코드를 사용하여 NGS 염기서열 분석 데이터 분석을 수행하기 위한 워크플로우는 측면 염기서열, 길이 및 위치에 따라 안내되는 바코드 염기서열 검출, 조직 세트에 대한 바코드 농축 및 분포 분석으로 구성됩니다.스크립트와 데이터라는 두 개의 폴더를 준비합니다. 시퀀싱으로 인한 Gzip 압축 파일을 데이터 폴더에 복사합니다. 그런 다음 python 및 구성 파일을 텍스트 원고에 설명된 대로 script 폴더에 복사합니다.스크립트를 실행하기 전에 탭으로 구분된 두 개의 텍스트 파일인 capsidvariance를 만듭니다. txt 파일에 AAV 캡시드 변형 이름에 할당된 바코드 시퀀스와 오염이 있습니다. 오염 가능성으로 인한 바코드 시퀀스가 있는 TXT 파일.마지막으로, 시퀀싱 데이터가 있는 폴더 경로, 바코드의 측면 영역 순서, 바코드 위치 및 바코드 감지를 위한 창 크기 정보를 포함하도록 구성 파일을 편집합니다. 해당 명령을 사용하여 제공된 경로 및 구성 파일로 바코드 감지 스크립트를 실행합니다. 이 명령 실행의 출력은 캡시드 변형당 재카운트와 원시 데이터에서 복구된 총 읽기 수가 있는 TXT 파일입니다.zuordnung에서 조직 또는 기관 사이에 바코드화된 AAV 캡시드의 분포를 평가합니다. TXT 파일, 바코드 검출 실행에서 얻은 각 텍스트 파일의 이름을 조직 또는 장기 이름에 할당합니다. 첫 번째 열에 텍스트 파일의 이름을 추가하고 탭으로 구분된 할당에 해당 조직 또는 장기 이름을 추가합니다.장기를 만듭니다. TXT 파일에 on-target 및 off-target 기관의 이름 목록이 포함되어 있으며, 이는 Zuordnung 과제에 주어진 이름에 해당합니다. txt 파일.그런 다음 normalization_organ 만듭니다. txt 및 normalization_variant. TXT 탭은 모든 캡시드 변이체와 모든 장기 및 조직에 대해 정규화된 값으로 구분된 텍스트 파일입니다.normalization_organ가 있는 첫 번째 열에서. txt 파일에 각 장기에 대해 주어진 이름을 쓰고 두 번째 열에는 해당 조직에 대한 정규화 값을 씁니다. normalization_variant의 첫 번째 열을 채웁니다.txt 파일에 캡시드 이름 목록이 있고 두 번째 열에는 풀링된 라이브러리의 각 캡시드에 대한 정규화된 읽기 횟수 값이 있습니다. 모든 추가 파일의 전체 경로를 지정하여 구성 파일을 편집하고 이 특정 명령을 사용하여 바코드 분석 스크립트를 실행합니다. 바코드 분석 스크립트는 앞서 설명한 여러 정규화 단계를 기반으로 서로 다른 조직 내에서 캡시드 분포의 상대 농도 또는 RC 값을 갖는 텍스트 파일과 텍스트 파일 데이터를 병합된 매트릭스 데이터로 결합하는 스프레드시트 파일과 같은 여러 파일을 출력합니다.데이터를 시각화하고 텍스트 원고에 설명된 대로 행렬 데이터의 군집 분석을 수행합니다. 스크립트는 relativeconcentration을 입력합니다. XLS 파일을 생성하고 계층적 클러스터 히트 맵과 주성분 분석의 두 플롯을 생성합니다.플롯 또는 PNG 매개 변수를 수정하려면 R 스크립트를 열고 주석 섹션의 지침을 따릅니다. AAV2 rep 유전자의 정량화된 영역은 99.2%가 ITR에 대해 양성임을 보여주었으며, 이는 AAV 캡시드가 전체 바이러스 게놈을 함유하고 있음을 시사합니다. 세 세트 모두에서 라이브러리와 관련된 서명 시퀀스를 기반으로 추출된 읽기는 전체 읽기의 약 94%를 차지하여 좋은 품질을 나타냅니다.이 중 99% 이상이 유효한 PV 읽기였고 99% 이상이 유효한 PV 읽기가 고유하여 라이브러리가 높은 내부 다양성과 균형을 이루고 있음을 시사합니다. 히트 맵 계층의 두 가지 주요 분기는 캡시드 변이체의 형질도입 효율의 차이를 반영했습니다. 캡시드 변이체의 대다수를 갖는 왼쪽 가지에는 대부분의 조직에서 높은 상대 농도 값을 나타내는 모든 캡시드가 포함되었습니다.현저하게 높은 간 특이성 외에도 3개의 다른 캡시드는 횡격막, 골격근, 이두근 및 뇌에서 특이성을 나타냈습니다. 계층적 클러스터링의 오른쪽 지점에는 십이지장과 췌장에서 가장 분명하게 나타나는 전반적으로 낮은 형질도입 효율을 가진 캡시드 변이체가 포함되었습니다. 원래 하위 집합에 대한 주성분 분석은 높은 간 특이성을 가진 캡시드 변이체의 클러스터를 형성하고 VAR60 캡시드 뛰어난 근육 친화성을 설명합니다.이 프로토콜을 시도할 때 입력 오류에 주의해야 합니다. Windows 명령 프롬프트를 사용하는 경우와 Linux를 사용하는 경우 구문도 다릅니다. 새로운 AAV 변이체를 식별한 후 사망하거나 더 큰 동물 모델에서 치료 및 번역 가능성을 확인해야 합니다.이 기술은 동일한 조건에서 AAV 변이체를 직접 나란히 비교할 수 있으며 매우 다재다능하여 대형 동물 또는 인간에서도 번역할 수 있는 길을 열어줍니다.

Research

JoVE Journal

Bioengineering

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Transplantation of Induced Pluripotent Stem Cell-derived Mesoangioblast-like Myogenic Progenitors in Mouse Models of Muscle Regeneration

근육 재생의 마우스 모델에서 유도 만능 줄기 세포 유래 메소안지오블라스트 와 같은 근생 성 전구의 이식

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells ...

연구

생체공학

Novel Atomic Force Microscopy Based Biopanning for Isolation of Morphology Specific Reagents against TDP-43 Variants in Amyotrophic Lateral Sclerosis

루게릭 병에 TDP-43 변종 형태론 특정 시약의 분리에 대한 소설 원자 힘 현미경 기반 Biopanning

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in ...

Robotic Mirror Therapy System for Functional Recovery of Hemiplegic Arms

반신 불수 팔의 기능 복구를위한 로봇 미러 치료 시스템

Mirror therapy has been performed as effective occupational therapy in a clinical setting for functional recovery of a hemiplegic arm after stroke. It is ...

Isolation of Murine Adipose Tissue-derived Microvascular Fragments as Vascularization Units for Tissue Engineering

조직 공학 혈관 신생 단위로 쥐 지방 조직 유래 미세 혈관 조각의 분리

A functional microvascular network is of pivotal importance for the survival and integration of engineered tissue constructs. For this purpose, several ...

Predicting Gene Silencing Through the Spatiotemporal Control of siRNA Release from Photo-responsive Polymeric Nanocarriers

광 반응성 고분자 나노 캐리어로부터의 siRNA 방출의 시공간 조절을 통한 유전자 침묵 예측

New materials and methods are needed to better control the binding vs. release of nucleic acids for a wide range of applications that require the precise ...

3D Microtissues for Injectable Regenerative Therapy and High-throughput Drug Screening

주 사용 재생 치료와 높은 처리량 마약 검사에 대 한 3D Microtissues

To upgrade traditional 2D cell culture to 3D cell culture, we have integrated microfabrication with cryogelation technology to produce macroporous ...

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

성인 골 수 유래 조 혈 줄기 세포로 세포 공학 자기 대상으로 함께 있도록 예측에 관한 전송을 위한 프로토콜

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Studying Cavitation Enhanced Therapy

캐비테이션 강화 치료 연구

Interest in the therapeutic applications of ultrasound is significant and growing, with potential clinical targets ranging from cancer to ...

Reliably Engineering and Controlling Stable Optogenetic Gene Circuits in Mammalian Cells

포유류 세포에서 안정적인 광유전학적 유전자 회로를 안정적으로 엔지니어링하고 제어합니다.

Reliable gene expression control in mammalian cells requires tools with high fold change, low noise, and determined input-to-output transfer functions, ...

Photodegradable Hydrogel Interfaces for Bacteria Screening, Selection, and Isolation

박테리아 스크리닝, 선택 및 격리를 위한 광분해성 하이드로겔 인터페이스

Biologists have long attempted to understand the relationship between phenotype and genotype. To better understand this connection, it is crucial to ...