Name: engineering oncogenic heterozygous gain-of-function mutations in human hematopoietic stem and progenitor cells
Uploaded: 2023-03-10T14:50:00
Duration: 12 min 4 s
Description: Watch this Scientific Journal Video about Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells at JoVE.com

This work is supported by grants from the Austrian Science Fund (FWF; number P32783 and I5021) to A.R. Additional funding to A.R. is also provided by the Austrian Society of Internal Medicine (Joseph Skoda Fellowship), the Austrian Society of Hematology and Oncology (OeGHO; Clinical Research Grant), and MEFOgraz.&#160;T.K. is a Special Fellow of the Leukemia &#38; Lymphoma Society.

The authors have nothing to disclose.

The efficient and precise genetic manipulation of human primary HSPCs represents a great opportunity to explore and understand the processes influencing normal hematopoiesis, and most importantly, the leukemic transformation of hematopoietic cells.
In this protocol, an efficient strategy to engineer human HSPCs to express recurrent heterozygous GOF mutations was described. This procedure took advantage of CRISPR/Cas9 technology and rAAV6 vectors as donors for DNA templates to precisely insert WT and mutant DNA sequences into their endogenous gene loci. Coupling the engineered cDNAs (WT and mutant) with separated fluorescent reporter proteins allows for the enrichment and tracking of cells with a definitive heterozygous state.
This strategy presents several advantages in comparison to the frequently used lentiviral (LV)-based methods. One main advantage is that the CRISPR/Cas9-based system allows for precise editing in the endogenous loci, resulting in the preservation of the endogenous promoters and regulatory elements. This leads to homogeneity in the expression of the edited gene in the cells, a goal hardly achievable when an LV-based method is used. Gene transfer with LV vectors leads to semi-random integration of the gene with preference for transcriptionally active sites34. This can translate into overexpression of the transferred gene and heterogeneity between the edited cells, eventually resulting in difficulties to investigate and analyze the role of mutations and gene interactions. A second advantage is that the described system, being a site-specific editing system, eliminates the risks of insertional mutagenesis35.
The dual fluorescent reporter strategy allows for the precise enrichment and tracking of cells that were successfully edited on both alleles, with one allele integrating the WT cDNA and the other allele integrating the mutated cDNA sequences. Cells only expressing a single reporter represent either only monoallelic integration or biallelic integration of HDR templates with the same fluorescent reporter. Both scenarios can only be precisely distinguished if single cell-derived clones are produced and individually analyzed. However, HSPCs have only limited proliferative capacity in vitro, and when kept in culture for extended periods of time, HSPCs start differentiating into more mature progeny and lose their self-renewal and engraftment capacity. This makes selecting and expanding single-cell clones harboring the desired heterozygous mutation unfeasible. The application of the dual fluorescent protein strategy and enrichment by flow cytometry for cells bearing the heterozygous mutation allows for bypassing the problems induced by extended in vitro culture.
In this specific example, it was successfully demonstrated that HSPCs could be efficiently engineered and sorted in order to obtain pure populations of HSPCs carrying the heterozygous CALRDEL/WT&#160;mutation.
However, this system is not limited to engineering heterozygous frameshift mutations but can also easily be adopted to create other mutation types, including missense and nonsense mutations. By applying different combinations of AAVs containing WT or mutated sequences with different fluorescent reporter proteins, this system can also be utilized for the introduction of homozygous mutations (simultaneous transduction with two rAAVs both carrying mutant cDNA but different fluorescent reporters) or even the correction of mutations (simultaneous transduction with two AAVs both carrying WT cDNA but different fluorescent reporters). Additionally, it is important to mention that this strategy is not limited to the introduction of oncogenic GOF mutations. In fact, the described protocol can be utilized for multiple alternative strategies including gene knock-out, gene replacement36,37, targeted knock-in of transgenes (i.e., chimeric antigen receptors)38, and even for the correction of disease-causing mutations11,39.
The strategy of combining CRISPR/Cas9 and AAV6 with multiple fluorescent reporters has also been shown to be applicable in many other cell types including T-cells, plasmacytoid dendritic cells, induced pluripotent stem cells, neuronal stem cells, and airway stem cells24,38,40,41,42,43,44. This strategy can be implemented for the production of superior chimeric antigen receptor (CAR) T cells. For example, it was recently published that CRISPR/Cas9-mediated knock-out of the TGFBR2 gene in CAR T cells greatly increases their function in the suppressive TGF-&#946; rich tumor microenvironment45. Such an approach could provide a one-step protocol to both engineer the T cells to express the CAR and to knock out the TGFBR2 gene by site specifically inserting the CAR into both alleles of the TGFBR2 gene. Moreover, this approach could also be useful to generate universal CAR T cells by integrating the CAR in the T cell receptor alpha constant (TRAC) gene46,47.
To increase the reproducibility and to guarantee efficient editing of the cells, some important considerations need to be taken care of. The main critical points for ensuring successful editing of the cells reside in (i) the selection of the sgRNA, (ii) the design of the HDR template, and (iii) the rAAV6 production.
The selection of a good-performing sgRNA is crucial as it will determine the maximum number of alleles in which the HDR template can be integrated. Due to numerous software that are now available, the search for candidate sgRNAs has been simplified. By selecting the region of interest, the software can propose a series of sgRNAs with an on-target score and an off-target score that indicate the chances for editing at the desired locus and unwanted loci, respectively. These scores are calculated based on previously published scoring models48,49. Although this is a good starting point for selecting a good-performing sgRNA, the performance of the sgRNA needs to be confirmed as its predicted performance in silico does not always correspond to an efficient sgRNA in vitro. Therefore, it is highly recommended to design and test out at least three sgRNAs to increase the chances of finding the best sgRNA. Once a true good-performing sgRNA has been identified, then it is suggested to proceed with the design of the HDR template.
Precautions should be taken into consideration when designing the HDR template. The left and right homology arms (LHA and RHA, respectively) should each span 400 bp upstream and downstream of the sgRNA cut site, respectively, as shorter HAs could result in reduced HDR frequencies. The size of the cDNA that can be introduced via HDR is dependent on the packaging capabilities of AAVs, which is roughly 4.7 kb. Due to the numerous elements mandatory within the HDR template (LHA, RHA, SA, PolyA, promoter, and fluorescent reporter sequence), the remaining space for the mutated or WT cDNA is limited. This is unproblematic if the desired mutation is located near the 3&#39; end of a gene or in genes with an overall short CDS. However, in cases where the mutation is located near the transcriptional start side (TSS) of the genes with a long CDS (exceeding the remaining packing space of the AAV), this described approach may not be feasible. To circumvent this problem, a strategy that relies on splitting the HDR template into two AAVs has been recently developed by Bak and colleagues. This strategy relies on two separate HDR-mediated integrations to obtain the final seamless integration of a large gene50.
The quality of the virus and its titer are additional factors that can make or break the successful genome engineering of the cells. For an optimal yield, it is important to not let the HEK293T reach full confluency while being maintained in culture. Ideally, the HEK293T cells should be split when 70%-80% confluency is reached. Additionally, the HEK293T should not be cultured for long periods of time as this can decrease their ability to produce virus. New HEK293T cells need to be thawed after 20 passages. Obtaining high virus titers is important for increasing the efficiency and reproducibility of the experiments. Low viral titers will translate to large volumes of rAAV solution required for the transduction of the HSPCs. As a general rule, the rAAV solution added to the nucleofected cells should not exceed 20% of the total volume of the HSPC retention medium. Higher volumes of AAV solution may lead to increased cell death, lower proliferation, and impaired transduction efficiencies. In the case of low virus titers, it is, therefore, recommended to further concentrate the virus.
In summary, this protocol offers a reproducible approach to manipulate human HSPCs precisely and efficiently through the simultaneous use of CRIPSR/Cas9 and rAAV6 donor templates with additional dual fluorescent reporters. This approach has proven to be a great tool in studying normal hematopoietic stem cell biology and the contributions that mutations make to leukemogenesis.

With the development of the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology, a new and extremely powerful instrument has been added to the toolkit of scientists. This technology allows for the precise engineering of the genome and has proven itself to be extremely useful not only for research purposes (reviewed in Hsu et al.1) but more recently has also been successfully translated into the clinical setting2,3,4. CRISPR/Cas9 editing strategies rely on the activity of a Cas9 protein and a single-guide RNA (sgRNA)5,6,7. In the host cell, the Cas9 protein is guided to a specific site in the DNA that is complementary to the sgRNA sequence and will introduce a DNA double-strand break (DSB). Once a DSB is generated, there are two main and competing repair mechanisms that can occur: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ is an error-prone, predominantly used repair mechanism leading to insertions and deletions (indels), whereas HDR, by using the sister chromatid as a repair template, is very precise but limited to the S or G2 phase of the cell cycle8. In genome engineering, HDR can be utilized for the targeted modification of DNA by providing a donor template that is flanked by homology arms identical to both DNA ends of the Cas9-induced DSB (Figure 1). The type of donor template that is used for HDR can greatly impact editing efficiency. For genetic engineering in human HSPCs, adeno-associated virus serotype 6 (AAV6) has recently been described to be an excellent vehicle for the delivery of single-stranded DNA templates9,10.
CRISPR/Cas9 genome engineering can be employed therapeutically to correct deleterious mutations11 but can also be utilized to introduce pathogenic mutations into the DNA to model cancer development12. Blood cancer, such as leukemia, develops via the sequential acquisition of somatic mutations in healthy HSPCs13,14. Early genetic events lead to a clonal proliferative advantage, resulting in clonal hematopoiesis of indeterminate potential (CHIP)15,16. Further acquisition of mutations will eventually lead to leukemic transformation and the development of the disease. Somatic mutations can be found in genes controlling self-renewal, survival, proliferation, and differentiation17.
Introducing individual mutations via genome engineering into healthy HSPCs allows for precisely modeling this stepwise leukemogenic process. The limited number of recurrent mutations found in myeloid neoplasms such as acute myeloid leukemia (AML)18,19 makes this disease particularly amenable to being recapitulated using genome engineering tools.
Somatic mutations can emerge on only one allele (monoallelic/heterozygous mutations) or on both alleles (biallelic/homozygous mutations) and can have profound effects on the gene&#39;s function, which could cause a loss-of-function (LOF) or a gain-of-function (GOF). LOF mutations lead to a reduced (if one allele is affected) or complete (if both alleles are affected) LOF of the gene, whereas GOF mutations lead to an increased activation or novel function of the gene. GOF mutations are typically heterozygous20.
Importantly, the zygosity (hetero- vs. homozygous) has major implications for the attempt to faithfully model a mutation; therefore, the targeted manipulation of only one allele of a gene is necessary to engineer heterozygous hotspot GOF mutations. Error-prone NHEJ leads to indels of different lengths21 that can lead to varying, unpredictable biological consequences. However, since NHEJ is the predominant repair program employed by cells after the introduction of a DSB, most CRISPR/Cas9 platforms currently used to manipulate HSPCs do not allow for precisely predicting the genetic outcome22,23. In contrast, the introduction of a CRISPR/Cas9-mediated double-strand break (DSBs), combined with the use of recombinant adeno-associated virus (rAAV) vector-based DNA donor templates for genome engineering via HDR, allows for the allele-specific insertion of mutations in human HSPCs11,24. The simultaneous integration of a mutant and a wild-type (WT) sequence coupled with distinct fluorescent reporters on the individual alleles can be performed to select for a heterozygous genotype (Figure 2). This strategy can be leveraged as a powerful tool to precisely characterize the effects of recurrent, leukemic, heterozygous GOF hotspot mutations on HSPC function, disease initiation, and progression.
In this article, a detailed protocol for the efficient engineering of recurrently mutated heterozygous GOF mutations in primary human HSPCs is provided. This strategy combines the use of CRISPR/Cas9 and a dual AAV6 transduction to provide WT and mutant DNA donor templates for the prospective generation of the heterozygous GOF mutation. As an example, engineering of the recurrent type 1 mutations (52 bp deletion) in the calreticulin (CALR) gene will be shown25. The heterozygous GOF mutation in exon 9 of CALR is recurrently found in myeloproliferative disorders such as essential thrombocythemia (ET) and primary myelofibrosis (PMF)26. CALR is an endoplasmic reticulum resident protein that has primarily a quality control function in the folding process of newly synthesized proteins. Its structure can be divided into three main domains: an amino (N)-terminal domain and a proline-rich P domain, which are involved in the chaperone function of the protein, and a C-domain, which is involved in calcium storage and regulation27,28. CALR mutations cause a +1 frameshift, leading to the transcription of a novel extended C-terminal end and the loss of the endoplasmic reticulum (ER)-retention signal (KDEL). Mutant CALR has been shown to bind the thrombopoietin (TPO) receptor, thereby leading to TPO-independent signaling with increased proliferation29.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/64558/64558fig01v2.jpg" /> 
Figure 1: NHEJ and HDR repair. Simplified schematic representation of NHEJ and HDR repair mechanisms following the introduction of a double-stranded break in the DNA. <a href="https://www.jove.com/files/ftp_upload/64558/64558fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/64558/64558fig02.jpg" /> 
Figure 2: Schematic overview of biallelic HDR editing strategy. Schematic representation showing the integration of the donor templates into the targeted alleles followed by their translation into functioning mRNAs. The orange dotted boxes indicate the regions corresponding to the left homology arm (LHA) and right homology arm (RHA). The ideal size of the HAs is 400 bp each. The green dotted box represents the region corresponding to the SA sequence. The size of the SA is 150 bp. <a href="https://www.jove.com/files/ftp_upload/64558/64558fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>175 cm2 Cell Culture Flask, Vent Cap, TC-treated</td>
			<td>Corning</td>
			<td>431080</td>
			<td></td>
		</tr>
		<tr>
			<td>150 mm x 25 mm dishes</td>
			<td>Corning</td>
			<td>430599</td>
			<td></td>
		</tr>
		<tr>
			<td>293T</td>
			<td>DSMZ</td>
			<td>ACC 635</td>
			<td>https://www.dsmz.de/collection/catalogue/details/culture/ACC-635</td>
		</tr>
		<tr>
			<td>4D Nucleofector Core Unit</td>
			<td>Lonza</td>
			<td>-</td>
			<td>For nucleofection of human HSPCs use the DZ-100 program.</td>
		</tr>
		<tr>
			<td>4D Nucleofector X Unit</td>
			<td>Lonza</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>500 ml Centrifuge Tube</td>
			<td>Corning</td>
			<td>431123</td>
			<td></td>
		</tr>
		<tr>
			<td>7-AAD</td>
			<td>BD Biosciences</td>
			<td>559925</td>
			<td></td>
		</tr>
		<tr>
			<td>AAVpro Purification Kit</td>
			<td>Takara</td>
			<td>6666</td>
			<td></td>
		</tr>
		<tr>
			<td>Alt-R S.p. Cas9 Nuclease V3</td>
			<td>Integrated DNA Technologies (IDT)</td>
			<td>1081058</td>
			<td></td>
		</tr>
		<tr>
			<td>Avanti JXN-30 Ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Benchling sgRNA design tool</td>
			<td></td>
			<td></td>
			<td>Online tool for sgRNA design: http://www.benchling.com/crispr</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A7906-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>C1000 Touch Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemically modified synthetic sgRNA</td>
			<td>Synthego</td>
			<td></td>
			<td>Website: https://www.synthego.com/products/crispr-kits/synthetic-sgrna Sequence for the sgRNA targeting intron 7 of CALR: 5&#8217;-CGCCTGTAATCCTCGCCCAG-3&#8217;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; An 80 nucleotide SpCas9 scaffold is added to the 20 nucleotide RNA sequence to complete the sgRNA. Chemical modifications of 2&#39;-O-Methyl are added to the first and last 3 bases and 3&#39; phosphorothioate bonds are added in the first 3 and last 2 bases.&#160;&#160;&#160;&#160; *Alternatively chemically modified synthetic sgRNAs can be acquired from IDT (https://eu.idtdna.com/site/order/oligoentry/index/crispr) and Trilink (https://www.trilinkbiotech.com/custom-oligos)</td>
		</tr>
		<tr>
			<td>CHOPCHOP sgRNA design tool</td>
			<td></td>
			<td></td>
			<td>Online tool for sgRNA design: http://chopchop.cbu.uib.no</td>
		</tr>
		<tr>
			<td>Costar 24-well Clear TC-treated Multiple Well Plates</td>
			<td>Corning</td>
			<td>3526</td>
			<td></td>
		</tr>
		<tr>
			<td>CRISPick sgRNA design tool</td>
			<td></td>
			<td></td>
			<td>Online tool for sgRNA design: https://portals.broadinstitute.org/gppx/crispick/public</td>
		</tr>
		<tr>
			<td>CRISPOR sgRNA design tool</td>
			<td></td>
			<td></td>
			<td>Online tool for sgRNA design: http://crispor.tefor.net</td>
		</tr>
		<tr>
			<td>ddPCR 96-Well Plates</td>
			<td>Bio-Rad</td>
			<td>12001925</td>
			<td></td>
		</tr>
		<tr>
			<td>ddPCR Supermix for Probes (no dUTP)</td>
			<td>Bio-Rad</td>
			<td>1863024</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Cartridges for QX200/QX100 Droplet Generator&#160;</td>
			<td>Bio-Rad</td>
			<td>1864008</td>
			<td></td>
		</tr>
		<tr>
			<td>DG8 Gaskets for QX200/QX100 Droplet Generator&#160;</td>
			<td>Bio-Rad</td>
			<td>1863009</td>
			<td></td>
		</tr>
		<tr>
			<td>DreamTaq Green PCR Master Mix (2X)</td>
			<td>Thermo Scientific</td>
			<td>K1081</td>
			<td></td>
		</tr>
		<tr>
			<td>Droplet Generation Oil for Probes</td>
			<td>Bio-Rad</td>
			<td>1863005</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM) with high glucose</td>
			<td>Sigma-Aldrich</td>
			<td>D6429-6X500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (DPBS)</td>
			<td>Sigma-Aldrich</td>
			<td>D8537-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>FACSAria Fusion</td>
			<td>BD Biosciences</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon 5 mL Round Bottom</td>
			<td>Corning</td>
			<td>352054</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS) Good Forte (heat inactivated), 500 ml</td>
			<td>Pan Biotech</td>
			<td>P40-47500</td>
			<td></td>
		</tr>
		<tr>
			<td>FlowJo 10.8.0</td>
			<td>BD Biosciences&#160;</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>GenAgarose L.E.</td>
			<td>Inno-train</td>
			<td>GX04090</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 100 bp Plus DNA Ladder</td>
			<td>Thermo Scientific</td>
			<td>SM0321</td>
			<td></td>
		</tr>
		<tr>
			<td>Gibson Assembly Master Mix</td>
			<td>New England Biolabs Inc. (NEB)</td>
			<td>E2611L</td>
			<td></td>
		</tr>
		<tr>
			<td>HEK293T</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES solution</td>
			<td>Sigma-Aldrich</td>
			<td>H0887-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>ICE</td>
			<td>Synthego</td>
			<td></td>
			<td>https://ice.synthego.com</td>
		</tr>
		<tr>
			<td>IDT codon optimization tool</td>
			<td>IDT</td>
			<td></td>
			<td>https://www.idtdna.com/pages/tools/codon-optimization-tool</td>
		</tr>
		<tr>
			<td>IDT sgRNA design tool</td>
			<td></td>
			<td></td>
			<td>Online tool for sgRNA design: https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM</td>
		</tr>
		<tr>
			<td>LB Broth (Lennox) EZMix powder microbial growth medium</td>
			<td>Sigma-Aldrich</td>
			<td>L7658-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Broth with agar (Lennox) EZMix powder microbial growth medium</td>
			<td>Sigma-Aldrich</td>
			<td>L7533-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Midori Green Advance</td>
			<td>Nippon Genetics</td>
			<td>MG04</td>
			<td></td>
		</tr>
		<tr>
			<td>Monarch Plasmid Miniprep Kit</td>
			<td>NEB</td>
			<td>T1010L</td>
			<td></td>
		</tr>
		<tr>
			<td>Monarch DNA Gel Extraction Kit</td>
			<td>NEB</td>
			<td>T1020L</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB 5-alpha Competent E. coli (High Efficiency)</td>
			<td>NEB</td>
			<td>C2987U</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-Free Water, 5X100 ml</td>
			<td>Ambion</td>
			<td>AM9939</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoBond Xtra Midi</td>
			<td>Macherey-Nagel</td>
			<td>740410</td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM, Reduced Serum Medium, 500 ml</td>
			<td>Gibco</td>
			<td>31985070</td>
			<td></td>
		</tr>
		<tr>
			<td>P3 Primary Cell 4D-Nucleofetor&#160; X Kit L</td>
			<td>Lonza</td>
			<td>V4XP-3024</td>
			<td>The Lonza Primary P3 solution is supplied as a 2.25 mL P3 Primary Cell Nucleofector Solution and 0.5 mL Supplement 1. To reconstitute, add the Supplement 1 to the P3 Primary Cell Nucleofector Solution and mix.</td>
		</tr>
		<tr>
			<td>pAAV-MCS2</td>
			<td>Addgene</td>
			<td>46954</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Plate Heat Seal Foil, pierceable</td>
			<td>Bio-Rad</td>
			<td>1814040</td>
			<td></td>
		</tr>
		<tr>
			<td>pDGM6</td>
			<td>Addgene</td>
			<td>110660</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Gibco</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)</td>
			<td>Polysciences</td>
			<td>23966</td>
			<td>Add 50 mL of PBS 4.5 pH (made with HCl) to 50 mg of PEI in a tube. Dissolve by placing the tube in a 70&#176;C water bath and vortexing every 10 minutes until the solution is dissolved. After the solution has reached RT, filter sterilze through a 0.22 &#956;m filter, make 1120 &#956;L aliquots, and store at -80&#176;C.</td>
		</tr>
		<tr>
			<td>Polystyrene Test Tube, with Snap Cap</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primers&#160;</td>
			<td>Eurofins</td>
			<td>-</td>
			<td>Primers were ordered from Eurofins (eurofinsgenomics.eu) as unmodified salt free custom oligos. The primers were designed by using PRIMER-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; Primer 1 Fwd:&#160;&#160;&#160; AAGTGATCCGTTCGCCATGAC;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; Primer 2 Rev CALR WT specific: ACGTCCTCTTCCTCGTCCTC;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; Primer 2 Rev CALR DEL specific: CCAACCCTGGAGACACGCTTC</td>
		</tr>
		<tr>
			<td>PrimeTime qPCR Primer Assay</td>
			<td>IDT</td>
			<td>-</td>
			<td>PrimeTime qPCR Probe Assays (1 probe/2 primers)&#160; that can be ordered from IDT (https://eu.idtdna.com/site/order/qpcr/assayentry). Scale: Std - qPCR Assay 500 reactions; Primer 1 Forward (5&#39;-3&#39;) : GGAACCCCTAGTGATGGAGTT; Primer 2 Reverse (5&#39;-3&#39;): CGGCCTCAGTGAGCGA; Probe (5&#39;-3&#39;): CACTCCCTCTCTGCGCGCTCG; 5&#39; Dye/3&#39; Quencher: FAM/ZEN/IBFQ; Primer to probe ratio: 3.6</td>
		</tr>
		<tr>
			<td>PX1 PCR Plate Sealer</td>
			<td>Bio-Rad</td>
			<td>1814000</td>
			<td></td>
		</tr>
		<tr>
			<td>QuantaSoft Software</td>
			<td>Bio-Rad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Quick Extract DNA Extraction Solution</td>
			<td>Lucigen</td>
			<td>QE0905T</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 Droplet Generator&#160;</td>
			<td>Bio-Rad</td>
			<td>1864002</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 Droplet Reader</td>
			<td>Bio-Rad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant human Flt3-ligand</td>
			<td>Peprotech</td>
			<td>300-19</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant human IL-6</td>
			<td>Peprotech</td>
			<td>200-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human SCF</td>
			<td>Peprotech</td>
			<td>300-07</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human TPO</td>
			<td>Peprotech</td>
			<td>300-18</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640</td>
			<td>Sigma-Aldrich</td>
			<td>R8758-6X500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>SnapGene</td>
			<td>Dotmatics</td>
			<td></td>
			<td>Molecular cloning software https://www.snapgene.com *Alternatively also Benchling (https://www.benchling.com) and Geneious (https://www.geneious.com) can be used.</td>
		</tr>
		<tr>
			<td>Soc outgrowth medium</td>
			<td>NEB</td>
			<td>B9020S</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium-butyrate</td>
			<td>Sigma-Aldrich</td>
			<td>B5887-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>Stem Regenin 1 (SR1)</td>
			<td>Biogems</td>
			<td>1224999</td>
			<td></td>
		</tr>
		<tr>
			<td>StemSpan SFEM II</td>
			<td>STEMCELL Technologies</td>
			<td>9655</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE Buffer (Tris-acetate-EDTA) 50X</td>
			<td>Thermo Scientific&#160;</td>
			<td>B49</td>
			<td></td>
		</tr>
		<tr>
			<td>TIDE</td>
			<td></td>
			<td></td>
			<td>http://shinyapps.datacurators.nl/tide/</td>
		</tr>
		<tr>
			<td>Trypan blue 0.4%</td>
			<td>Sigma-Aldrich</td>
			<td>T8154-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>TrypLE (with phenol red), 500 ml</td>
			<td>Thermo Scientific</td>
			<td>16605-028</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure 0.5: EDTA, pH 8.0, 100 ml</td>
			<td>Thermo Scientific</td>
			<td>15575-038</td>
			<td></td>
		</tr>
		<tr>
			<td>UM171</td>
			<td>STEMCELL Technologies</td>
			<td>72914</td>
			<td></td>
		</tr>
		<tr>
			<td>Vector Builder codon optimization tool</td>
			<td>Vector Builder</td>
			<td></td>
			<td>https://en.vectorbuilder.com/tool/codon-optimization.html</td>
		</tr>
	</tbody>
</table>

engineering oncogenic heterozygous gain-of-function mutations in human hematopoietic stem and progenitor cells

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional properties such as proliferation and differentiation, thereby promoting the development of hematologic malignancies. Efficient and precise genetic manipulation of HSPCs is required to model, characterize, and better understand the functional consequences of recurrent somatic mutations. Mutations can have a deleterious effect on a gene and result in loss-of-function (LOF) or, in stark contrast, may enhance function or even lead to novel characteristics of a particular gene, termed gain-of-function (GOF). In contrast to LOF mutations, GOF mutations almost exclusively occur in a heterozygous fashion. Current genome-editing protocols do not allow for the selective targeting of individual alleles, hampering the ability to model heterozygous GOF mutations. Here, we provide a detailed protocol on how to engineer heterozygous GOF hotspot mutations in human HSPCs by combining CRISPR/Cas9-mediated homology-directed repair and recombinant AAV6 technology for efficient DNA donor template transfer. Importantly, this strategy makes use of a dual fluorescent reporter system to allow for the tracking and purification of successfully heterozygously edited HSPCs. This strategy can be employed to precisely investigate how GOF mutations affect HSPC function and their progression toward hematological malignancies.

By applying the above-described protocol, heterozygous type 1 CALR mutations were reproducibly introduced in cord-blood derived HSPCs. This mutation consists of a 52 bp deletion in exon 9 (the last exon of CALR), which results in a +1 frameshift, leading to the translation of a novel positively charged C-terminal domain26,33. To introduce the CALR mutation at the endogenous gene locus, an intronic targeting strategy upstream of exon 9 was adopted, since this would circumvent any unwanted changes in the coding sequence in cases where the Cas9-induced DSB was not repaired via the HDR mechanism. In this specific case, an sgRNA for intron 7 was designed due to the availability of high on-target and low off-target sequences in combination with favorable homology arms (lack of sequence repeats; Figure 5A).
Two donor templates were then designed and packaged in AAV6 vectors. In order to enable correct splicing from the endogenous exons to the integrated cDNA, the donor templates contain (i) a SA sequence including the 3&#39; splice-site, branch point, and the polypyrimidine tract, (ii) the codon-optimized cDNA sequence of exons 8-9, either containing the WT (CALRWT) or the mutated sequence (CALRDEL) including a stop codon, (iii) a simian virus 40 (SV40) polyA signal, (iv) a sequence encoding for a fluorescent protein under the control of the separate internal promoter, the spleen focus-forming virus (SFFV) promoter, followed by (v) a bovine growth hormone (bGH) polyA signal. The donor template containing the CALRWT cDNA was designed to contain a GFP cassette, whereas the donor template containing the CALRDEL cDNA sequence was designed to contain a BFP cassette. The whole construct was flanked by a left and right HA (Figure 5A).
Two days following transfection with the RNP complex and transduction with the rAAV6 viruses, the cells were analyzed by flow cytometry. Four main populations could be detected: (i) cells expressing neither the GFP nor the BFP, representing cells with no HDR-based genome editing, (ii) cells positive only for GFP, representing those that had integrated only the WT construct, (iii) cells positive only for BFP, representing those that had integrated only the mutated construct, and (iv) GFP and BFP double-positive cells, representing the cells that had integrated both the WT and mutated sequences (Figure 5B). In order to obtain pure populations of HSPCs bearing the heterozygous type 1 CALR mutation, the double-positive cells were sorted by flow cytometry. HSPCs in which two WT sequences were knocked-in were used as control cells (GFP+ mCherry+; Figure 5B). A valid alternative to use as control cells would be HSPCs with a biallelic integration of the fluorescent proteins in a safe harbor locus (i.e., AAVS1; not shown). Cell counting by trypan blue exclusion performed on the sorted HSPCs indicated that more than 90% of the cells were viable.
Seamless on-target integration of the constructs was confirmed by applying the in-out PCR strategy (Figure 6A). In this specific case, we performed two separate in-out PCRs, one for the knocked-in CALRWT sequence (lane 1 of the gel electrophoresis in Figure 6A) and one for the knocked-in CALRDEL sequence (lane 2 of the gel electrophoresis of Figure 6A). Sanger sequencing performed on the DNA extracted from the gel bands confirmed the correct insertion of the WT and mutated sequences in the CALRDEL/WT&#160;HSPCs (Figure 6B).
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/64558/64558fig05.jpg" /> 
Figure 5: Generation of HSPCs bearing the heterozygous CALR mutation. (A) Representative scheme depicting the editing strategy for the insertion of the heterozygous CALR mutation. The RNP complex targets the intron between exon 7 and exon 8 of the CALR gene. Two AAVs, one containing the mutated exons 8-9 and a BFP and the other containing the WT exons 8-9 and a GFP, will serve as donor repair templates and will promote the integration of the mutated sequence in one allele and the integration of the WT sequence in the remaining allele. (B) Representative flow cytometry plots depicting the expression of GFP and BFP or GFP and mCherry 48 h following the transfection and transduction of HSPCs. <a href="https://www.jove.com/files/ftp_upload/64558/64558fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/64558/64558fig06.jpg" /> 
Figure 6: Validation of successful heterozygous CALR mutation in HSPCs. (A) Gel electrophoresis from the products of the in-out PCR performed on genomic DNA extracted from AAV controls, CALRWT/WT, and CALRDEL/WT. A 100 bp DNA ladder was used. Abbreviation: NTC = non-template control. (B) Sanger sequencing results obtained from the in-out PCRs performed on CALRDEL/WT confirming successful integration of the WT and mutated sequences. <a href="https://www.jove.com/files/ftp_upload/64558/64558fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells at JoVE.com

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Novel strategies to faithfully model somatic mutations in hematopoietic stem and progenitor cells (HSPCs) are necessary to better study hematopoietic stem cell biology and hematological malignancies. Here, a protocol to model heterozygous gain-of-function mutations in HSPCs by combining the use of CRISPR/Cas9 and dual rAAV donor transduction is described.

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional ...

Research

JoVE Journal

Cancer Research

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. ...

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including ...

Flow Cytometric Analysis of Mitochondrial Reactive Oxygen Species in Murine Hematopoietic Stem and Progenitor Cells and MLL-AF9 Driven Leukemia

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from ...

Physiologic Patient Derived 3D Spheroids for Anti-neoplastic Drug Screening to Target Cancer Stem Cells

In this protocol, we outline the procedure for generation of tumor spheroids within 384-well hanging droplets to allow for high-throughput screening of ...

Using Human Induced Pluripotent Stem Cells for the Generation of Tumor Antigen-specific T Cells

The generation and expansion of functional T cells in vitro can lead to a broad range of clinical applications. One such use is for the treatment of ...

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide ...

Combined Conditional Knockdown and Adapted Sphere Formation Assay to Study a Stemness-Associated Gene of Patient-derived Gastric Cancer Stem Cells

Cancer stem cells (CSCs) are implicated in tumor initiation, development and recurrence after treatment, and have become the center of attention of many ...

In Vivo Targeting of Xenografted Human Cancer Cells with Functionalized Fluorescent Silica Nanoparticles in Zebrafish

Developing nanoparticles capable of detecting, targeting, and destroying cancer cells is of great interest in the field of nanomedicine. In vivo animal ...