Name: Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates (Video) | JoVE
Uploaded: 2023-05-12T13:40:00
Duration: 54 s
Description: Watch this Scientific Journal Video about Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates at JoVE.com

이 작업은 보조금 번호 P20GM103430에 따라 국립 보건원 (National Institutes of Health)의 국립 일반 의학 연구소 (National Institute of General Medical Sciences)와 브라이언트 보건 및 행동 과학 센터 (Bryant Center of Health and Behavioral Sciences)의 로드 아일랜드 기관 개발 상 (IDeA) 생물 의학 연구 우수 네트워크에 의해 부분적으로 지원되었습니다.

Chromosome Conformation Capture (3C) for Undergraduate Research and Teaching

<ol>
	<li>McBryant, S. J., Adams, V. H., Hansen, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+architectural+proteins.">Chromatin architectural proteins.</a> Chromosome Research. 14 (1), 39-51 (2006).</li><li>Nalabothula, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chromatin+architectural+proteins+HMGD1+and+H1+bind+reciprocally+and+have+opposite+effects+on+chromatin+structure+and+gene+regulation.">The chromatin architectural proteins HMGD1 and H1 bind reciprocally and have opposite effects on chromatin structure and gene regulation.</a> BMC Genomics. 15, 92 (2014).</li><li>John, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+accessibility+pre-determines+glucocorticoid+receptor+binding+patterns.">Chromatin accessibility pre-determines glucocorticoid receptor binding patterns.</a> Nature Genetics. 43 (3), 264-268 (2011).</li><li>Fawcett, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+occurrence+of+a+fibrous+lamina+on+the+inner+aspect+of+the+nuclear+envelope+in+certain+cells+of+vertebrates.">On the occurrence of a fibrous lamina on the inner aspect of the nuclear envelope in certain cells of vertebrates.</a> The American Journal of Anatomy. 119 (1), 129-145 (1966).</li><li>Reddy, K. L., Zullo, J. M., Bertolino, E., Singh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+repression+mediated+by+repositioning+of+genes+to+the+nuclear+lamina.">Transcriptional repression mediated by repositioning of genes to the nuclear lamina.</a> Nature. 452 (7184), 243-247 (2008).</li><li>Finlan, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+to+the+nuclear+periphery+can+alter+expression+of+genes+in+human+cells.">Recruitment to the nuclear periphery can alter expression of genes in human cells.</a> PLoS Genetics. 4 (3), e1000039 (2008).</li><li>Chambeyron, S., Da Silva, N. R., Lawson, K. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+re-organisation+of+the+Hoxb+complex+during+mouse+embryonic+development.">Nuclear re-organisation of the Hoxb complex during mouse embryonic development.</a> Development. 132 (9), 2215-2223 (2005).</li><li>Chambeyron, S., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+decondensation+and+nuclear+reorganization+of+the+HoxB+locus+upon+induction+of+transcription.">Chromatin decondensation and nuclear reorganization of the HoxB locus upon induction of transcription.</a> Genes and Development. 18 (10), 1119-1130 (2004).</li><li>Mahy, N. L., Perry, P. E., Gilchrist, S., Baldock, R. A., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+of+active+and+inactive+genes+and+noncoding+DNA+within+chromosome+territories.">Spatial organization of active and inactive genes and noncoding DNA within chromosome territories.</a> The Journal of Cell Biology. 157 (4), 579-589 (2002).</li><li>Mahy, N. L., Perry, P. E., Bickmore, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+density+and+transcription+influence+the+localization+of+chromatin+outside+of+chromosome+territories+detectable+by+FISH.">Gene density and transcription influence the localization of chromatin outside of chromosome territories detectable by FISH.</a> The Journal of Cell Biology. 159 (5), 753-763 (2002).</li><li>Li, B., Carey, M., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+chromatin+during+transcription.">The role of chromatin during transcription.</a> Cell. 128 (4), 707-719 (2007).</li><li>Chen, A., Chen, D., Chen, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+of+DNase-seq+for+mapping+active+gene+regulatory+elements+across+the+genome+in+animals.">Advances of DNase-seq for mapping active gene regulatory elements across the genome in animals.</a> Gene. 667, 83-94 (2018).</li><li>Hughes, A. L., Rando, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+underlying+nucleosome+positioning+in+vivo.">Mechanisms underlying nucleosome positioning in vivo.</a> Annual Review of Biophysics. 43, 41-63 (2014).</li><li>Weiner, A., Hughes, A., Yassour, M., Rando, O. J., Friedman, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+nucleosome+mapping+reveals+transcription-dependent+promoter+packaging.">High-resolution nucleosome mapping reveals transcription-dependent promoter packaging.</a> Genome Research. 20 (1), 90-100 (2010).</li><li>Hughes, A. L., Jin, Y., Rando, O. J., Struhl, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+evolutionary+approach+to+identify+determinants+of+nucleosome+positioning:+A+unifying+model+for+establishing+the+genome-wide+pattern.">A functional evolutionary approach to identify determinants of nucleosome positioning: A unifying model for establishing the genome-wide pattern.</a> Molecular Cell. 48 (1), 5-15 (2012).</li><li>Dekker, J., Rippe, K., Dekker, M., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+chromosome+conformation.">Capturing chromosome conformation.</a> Science. 295 (5558), 1306-1311 (2002).</li><li>van Berkum, N. L., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+spatial+chromatin+organization+of+large+genomic+regions+using+5C+technology.">Determining spatial chromatin organization of large genomic regions using 5C technology.</a> Methods in Molecular Biology. 567, 189-213 (2009).</li><li>Smith, E. M., Lajoie, B. R., Jain, G., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invariant+TAD+boundaries+constrain+cell-type-specific+looping+interactions+between+promoters+and+distal+elements+around+the+CFTR+locus.">Invariant TAD boundaries constrain cell-type-specific looping interactions between promoters and distal elements around the CFTR locus.</a> American Journal of Human Genetics. 98 (1), 185-201 (2016).</li><li>Crane, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+inputs+into+C.+elegans+dosage+compensation:+Chromosome+conformation+and+the+miRNA-specific+argonaute+ALG-2.">Two inputs into C. elegans dosage compensation: Chromosome conformation and the miRNA-specific argonaute ALG-2.</a> University of California, Berkeley. , (2012).</li><li>Bell, A. C., West, A. G., Felsenfeld, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+protein+CTCF+is+required+for+the+enhancer+blocking+activity+of+vertebrate+insulators.">The protein CTCF is required for the enhancer blocking activity of vertebrate insulators.</a> Cell. 98 (3), 387-396 (1999).</li><li>Cuadrado, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+contributions+of+cohesin-SA1+and+cohesin-SA2+to+TADs+and+polycomb+domains+in+embryonic+stem+cells.">Specific contributions of cohesin-SA1 and cohesin-SA2 to TADs and polycomb domains in embryonic stem cells.</a> Cell Reports. 27 (12), 3500-3510 (2019).</li><li>Sarro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disrupting+the+three-dimensional+regulatory+topology+of+the+Pitx1+locus+results+in+overtly+normal+development.">Disrupting the three-dimensional regulatory topology of the Pitx1 locus results in overtly normal development.</a> Development. 145 (7), (2018).</li><li>Tolhuis, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+polycomb+domains+are+guided+by+chromosome+architecture.">Interactions among polycomb domains are guided by chromosome architecture.</a> PLoS Genetics. 7 (3), e1001343 (2011).</li><li>Splinter, E., de Wit, E., van de Werken, H. J. G., Klous, P., de Laat, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+long-range+chromatin+interactions+for+selected+genomic+sites+using+4C-seq+technology:+From+fixation+to+computation.">Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: From fixation to computation.</a> Methods. 58 (3), 221-230 (2012).</li><li>Fern&#225;ndez-Mi&#241;&#225;n, A., Bessa, J., Tena, J. J., G&#243;mez-Skarmeta, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+21+-+Assay+for+transposase-accessible+chromatin+and+circularized+chromosome+conformation+capture,+two+methods+to+explore+the+regulatory+landscapes+of+genes+in+zebrafish.">Chapter 21 - Assay for transposase-accessible chromatin and circularized chromosome conformation capture, two methods to explore the regulatory landscapes of genes in zebrafish.</a> Methods in Cell Biology. 135, 413-430 (2016).</li><li>Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+three+&amp;#34;C&amp;#34;+s+of+chromosome+conformation+capture:+controls,+controls,+controls.">The three &amp;#34;C&amp;#34; s of chromosome conformation capture: controls, controls, controls.</a> Nature Methods. 3 (1), 17-21 (2006).</li><li>Hag&#232;ge, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+chromosome+conformation+capture+assays+(3C-qPCR).">Quantitative analysis of chromosome conformation capture assays (3C-qPCR).</a> Nature Protocols. 2 (7), 1722-1733 (2007).</li><li>Lajoie, B. R., van Berkum, N. L., Sanyal, A., Dekker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=My5C:+Webtools+for+chromosome+conformation+capture+studies.">My5C: Webtools for chromosome conformation capture studies.</a> Nature Methods. 6 (10), 690-691 (2009).</li><li>Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolated+C.+elegans+germ+nuclei+exhibit+distinct+genomic+profiles+of+histone+modification+and+gene+expression.">Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.</a> BMC Genomics. 20 (1), 500 (2019).</li></ol>

저자는 이해 상충을 선언하지 않습니다.

3C는 기본 분자 기술에 뿌리를 둔 강력한 기술입니다. 3C를 학부생과 함께 사용할 수 있는 흥미로운 기술로 만드는 것은 이러한 기본 도구의 기초입니다. 광범위한 규모로 염색질 역학을 관찰하는 최근 연구가 너무 많기 때문에 이러한 결과를 사용하여 단일 유전자 또는 게놈 영역에 대한 좁은 초점을 맞춘 실험을 고안하면 학부 연구에서 독특하고 영향력 있는 실험을 만들 수 있는 잠재력이 있습니다. 종종 이와 같은 실험은 학부생에게 너무 진보된 것으로 간주되지만 신중한 계획을 통해 쉽게 달성할 수 있습니다. 3C 라이브러리에 의해 캡처된 염색질 연결을 조사하도록 설계된 분석은 반정량적 종말점 PCR에서 전체 게놈 시퀀싱에 이르기까지 다양할 수 있다는 점에 유의하는 것이 중요합니다. 실제로, 제1 3C 논문(16 )으로부터의 데이터는 qPCR로부터 생성되었다. 이 광범위한 분석은 모든 3C 기술이 동일한 제품, 즉 핵에서 3D 연결을 나타내는 DNA 단편 라이브러리를 생성하기 때문에 모두 사용할 수 있습니다.
여기에 제시된 것은 학부 연구원에게 더 적합한 보다 유연하고 수용적인 프로토콜의 적응입니다. 위에 나열된 일시 중지 기간은 야간 지연을 의미합니다. 그러나 이러한 일시 중지는 주말에 걸쳐 연장 될 수 있으며 세포와 핵의 경우 몇 주 동안 연장 될 수 있습니다. 가장 중요한 고려 사항은 작업이 완료되는 시기입니다. 프로토콜에는 일시 중지가 옵션이 아닌 경우 시간에 민감한 단계가 있는 경우가 많습니다. 몇 가지 지점(1일차와 2일차) 외에도 샘플을 멈추고 동결할 수 있는 곳이 많이 있습니다. 이는 실험실 작업의 일정과 타이밍이 유연해야 하는 학부생과 함께 작업할 때 매우 중요합니다. 이러한 중지를 프로토콜에 엔지니어링하는 것 외에도 학부생은 쌍 또는 3-4명의 소그룹으로 작업하는 것이 좋습니다. 학생들은 서로를 지원하고 모든 사람이 안전하게 작업할 수 있도록 친구 시스템을 만들 수 있기 때문에 그룹은 이 프로토콜에 적합합니다. 실험실 작업도 다른 사람들과 함께 하면 더 재미있습니다. 그룹을 통해 학생들은 동일한 프로토콜을 수행하면서 염색질 조직에 초점을 맞춘 다양한 질문에 대해 작업할 수도 있습니다. 따라서 학생들이 별도의 프로젝트를 진행하는 동안에도 프로토콜은 그들의 노력을 연결하고, 이로 인해 서로를 지원할 수 있습니다.
다른 적응은 특정 전문 도구와 장비가 모든 학부 기관에서 반드시 발견되는 것은 아니라는 사실을 해결하기 위한 것입니다. 이러한 장비에는 qPCR 열순환기, 겔 문서화 시스템 및 나노 부피 분광계가 포함되지만 이에 국한되지는 않습니다. 실제로 이러한 장비는 편리하지만 필수 사항은 아닙니다. 여기서, 3C의 고전적인 방법은 프라이머 디자인 부분에서도 설명됩니다. 여기에는 관심 있는 게놈 유전자좌를 식별하고 그로부터 더 멀리 떨어진 염색질 접촉점에 대한 다른 게놈 유전자좌를 평가하는 것이 포함됩니다. 이 기술은 알려진 양수(연결) 및 음수(비연결) 유전자좌가 식별되는 Hi-C를 사용하는 데이터 세트와 같이 게시된 데이터 세트를 사용하는 경우에도 잘 작동합니다. 이러한 공개된 데이터 세트를 사용하여 실험을 설계하는 것은 염색질 연결을 성공적으로 식별할 수 있는 기회가 일반적으로 더 크기 때문에 교육 실험실에 대한 또 다른 훌륭한 적응입니다. 또한 연구 논문은 수업 시간에 토론하고 참고 자료로 사용할 수 있습니다.
이 프로토콜은 수정된 qPCR 접근 방식을 사용하여 3C 생성물 형성을 시각화합니다. 제어는 3C 기술의 성공에 필수적입니다. 각 실험은 샘플 대조군과 프라이머 대조군을 모두 사용하여 3C 절차의 완료를 결정합니다. 샘플 대조군에는 소화되지 않은 대조군(게놈 DNA)과 소화된 대조군이 포함됩니다. 소화되지 않은 대조군은 프라이머 세트에 대한 기준선 신호를 결정하고, 분해 효율을 결정하기 위해 가교 분해 대조군과 함께 사용되며, 제한 부위를 가로질러 지시된 임의의 프라이머에 대해 생성물의 감소가 있을 것으로 예상된다. 이 값을 소화되지 않은 대조군과 비교하면 샘플이 얼마나 잘 소화되었는지를 알 수 있습니다.
상기 PCR용 프라이머는 대조군 프라이머 및 테스트 프라이머를 포함한다. 대조군 프라이머는 분석되는 게놈 영역 근처에 있고 제한 부위를 포함하지 않는 프라이머 세트입니다. 이는 테스트 프라이머 PCR 산물의 풍부도를 결정하기 위한 기준선을 제공합니다. 테스트 프라이머는 관심 있는 특정 게놈 유전자좌에 대한 제한 부위 옆에 있는 정방향 및 역방향 프라이머입니다(그림 3). 이러한 프라이머 세트를 사용하는 반응은 소화 효율을 결정하기 위해 비교되는데, 이는 제한 부위가 절단된 경우 제품 풍부도가 떨어져야 하기 때문이다. 염색질 조직을 결정할 때 한 유전자좌의 한 테스트 프라이머를 다른 게놈 유전자좌의 다른 테스트 프라이머와 쌍을 이루어 이 두 유전자좌가 3D 공간에서 서로 가까이 있는지 확인합니다. 이 경우 PCR 산물은 3C 샘플을 템플릿으로 사용하는 경우에만 발견될 것으로 예상됩니다.
검증된 프라이머도 실패하는 경향이 있다는 점에 유의해야 합니다(그림 4: r14 프라이머 세트). 또한, PCR 산물은 대조 반응 및 염색질 연결이 예측되지 않는 반응(예: 결찰되지 않기 때문에 분해된 대조군)에서 자주 식별됩니다. 이러한 인스턴스는 시퀀싱되어 Sanger QC에 실패하거나 정의된 시퀀스 없이 반환됩니다(그림 5). 또한 전통적인 3C 실험은 주어진 양의 DNA로 생성할 수 있는 모든 가능한 결찰 단편을 나타내는 가교되지 않은, 소화 및 결찰된 DNA 샘플인 "대조 주형"을 생성합니다. "제어 템플릿"은 두 게놈 유전자좌 사이의 qPCR 신호 강도를 비교하여 신호가 실제 상호 작용을 나타내는지 아니면 무작위 연관을 나타내는지 결정하는 데 중요한 역할을 합니다. "제어 템플릿"을 만드는 것은 분석되는 염색질의 상당 부분을 인공 염색체의 형태로 포획하고 3C 샘플과 함께 처리해야 하기 때문에 문제가 될 수 있습니다. 이러한 구조를 확보하는 것은 실현 가능하지 않을 수 있으며, 하나를 만드는 것은 학기 프로젝트의 범위를 벗어날 수 있습니다. 이러한 어려움으로 인해 대조군 프라이머를 사용하는 것이 좋습니다. 제어 입문서는 "제어 템플릿"의 모든 기능을 대체하지는 않지만 데이터를 분석하여 "존재" 또는 "부재" 결정을 내릴 수 있는 기회를 제공합니다.
qPCR을 수행할 때 동일한 양의 샘플을 사용하는 것이 중요합니다. 이는 나노드롭과 같은 나노분광광도계를 사용하더라도 알려진 농도의 게놈 DNA로부터 표준 곡선을 생성하고 3C 샘플을 해당 선에 피팅하여 결정해야 합니다. 이 양은 기록되어 후속 PCR에 사용되어야 합니다. PCR 반응의 품질 또한 중요합니다. PCR이 qPCR에서 실행됨에 따라 형광을 사용하여 제품 존재비를 측정하고 기록합니다. 이 기록은 증폭 플롯에서 액세스할 수 있습니다. 프로그램이 완료되면 증폭 플롯을 확인하고 반응(템플릿 제어 없음 제외)에 기준선, 지수 및 고원/포화 단계의 세 단계가 있는지 확인하는 것이 중요합니다. 특히 임계값을 설정하기 위해 반응에 지수 위상이 있는지 확인하는 것이 중요합니다(아래 참조). 또한 연속 희석된 샘플의 경우 샘플의 희석과 일치하는 Ct 값의 이동이 있어야 합니다(가장 높은 농도는 가장 낮은 Ct 값을 가지며 가장 낮은 농도는 가장 높은 Ct 값을 갖습니다). 증폭 플롯에서 이러한 변화를 반영하지 않는 샘플은 새로운 희석이 필요하거나 3C 샘플 형성에 더 큰 문제가 있음을 나타냅니다. 마지막으로, 표준 곡선을 생성하는 동안, PCR 소프트웨어는 PCR 효율 및R2 값을 계산할 것이다. PCR 효율은 90% 이상이어야 하고,R2 값은 0.99보다 커야 한다. 이러한 조건 중 하나라도 충족되지 않으면 샘플 또는 PCR 프라이머에 문제가 있을 수 있습니다.
qPCR 후, 소화 백분율 및 3C 상호작용의 존재는 각 반응에 대한 qPCR Ct를 사용하여 계산할 수 있습니다. 이를 결정하기 위해서는 먼저 PCR 반응에 대한 임계 값을 설정해야합니다. 이것은 일반적으로 qPCR 기계와 함께 제공되는 소프트웨어를 사용하여 수행됩니다. 임계값을 설정하면 샘플 Ct 값을 비교하는 데 사용할 PCR 산물의 농도가 정의됩니다. 임계값은 증폭의 지수 단계에서 PCR 반응의 증폭 곡선을 이등분해야 합니다. 지수 증폭이 있는 PCR 반응(이 경우 대조군 프라이머 및 테스트 프라이머 반응)만 비교할 수 있는데, 이는 반응이 동일한 속도로 DNA를 증폭하고 충실하게 비교할 수 있는 유일한 방법이기 때문입니다. 3C 그래프를 분석할 때 조건부 양성 반응은 대조군 샘플, 게놈 대조군 및 소화 대조군보다 더 많은 생성물을 가진 반응으로 식별됩니다(그림 4B). 그러나 이러한 샘플은 PCR 산물의 겔 정제 후 Sanger 염기서열 분석을 사용하여 추가로 검증해야 합니다.
Sanger 염기서열 분석 후 QC를 통과한 시료는 Blat를 사용하여 분석할 수 있습니다. 이 분석의 목표는 샘플이 제한 부위 옆에 있는 두 표적 게놈 유전자좌의 서열을 가지고 있는지 확인하는 것입니다(이 프로토콜의 경우 DpnII). 두 서열이 모두 확인되면 3C 단편이 검증된 것으로 간주될 수 있습니다. Blat의 결과가 예상된 서열을 반환하지 않는 경우, 이는 하나 또는 두 프라이머가 최적이 아님을 나타낼 수 있으며, 그 결과 위양성 qPCR 결과가 발생할 수 있습니다. 거짓 양성 샘플에 대한 추적 파일에는 정의되지 않은 기본 피크가 있으며 Seq 보고서에는 대부분 "n" 기본 호출이 포함됩니다.
Sanger 검증은 인공성 PCR 산물 형성으로 인한 위양성이 가능하기 때문에 필수적입니다. 이러한 위양성은 염기서열 분석 산물이 예상되는 표적 서열 또는 적절한 3C 단편의 DpnII 부위 특성을 가지고 있지 않을 때 식별할 수 있습니다(그림 5). PCR 단편의 시퀀싱은 또한 실험을 위한 또 다른 데이터 포인트를 제공하고 학생들에게 3C 기술이 핵 내의 3D 공간에서 함께 모이는 먼 게놈 유전자좌를 식별하고 있다는 사실을 알려줍니다.
3C 기술은 유연하고 간단한 절차로 학부생을 위한 풍부한 기초 분자 기술을 제공합니다. 이 3C 기술은 차세대 시퀀싱(NGS)을 통합하는 다른 3C 기술의 출발점이기도 합니다. 이러한 유형의 실험은 학부생을 생물 정보학의 중요한 측면에 노출시킬 수 있으며 여기에 설명 된 기본 원칙에 뿌리를두고 있습니다. 학부 경험과 참여는 젊은 과학자로서의 성공과 발전의 열쇠입니다. 이러한 기회를 제공함으로써 학부생은 기본 원리에 대한 이해를 강화하는 동시에 최첨단 기술과 질문에 대처할 수 있는 자신감을 키울 수 있습니다.

유기체의 게놈은 기능에 필요한 모든 유전자뿐만 아니라 언제 어떻게 사용해야 하는지에 대한 모든 지침을 담고 있습니다. 이것은 게놈에 대한 접근을 조절하는 것을 세포의 가장 중요한 기능 중 하나로 만듭니다. 유전자 기능을 제어하는 많은 메커니즘이 있습니다. 그러나 기본 수준에서 유전자 조절은 특정 DNA 서열(시스 조절 서열)에 결합하는 조절 전사 인자(트랜스 인자)의 능력으로 귀결됩니다. 이것은 타고난 능력이 아닙니다. 대신, 그것은 핵에서 게놈의 조직/구조에 의해 지배되며, 이는 트랜스인자 1,2,3에 대한 시스-조절 서열의 가용성/노출을 제어합니다. 트랜스 인자가 시스 조절 서열을 찾을 수 없으면 트랜스 인자가 규제 작업을 수행 할 수 없습니다. 이것은 게놈이 핵에서 어떻게 구성되어 있는지 이해하는 것을 중요한 탐구의 원천으로 만들었습니다.
간기 동안 핵의 진핵 염색체는 핵층과 핵 매트릭스에 고정된 자체 영역을 차지하므로 염색체를 스파게티 접시의 국수가 아니라 피자 조각처럼 만든다는 것이 널리 받아들여지고 있습니다. 염색체는 염색체의 일부를 비틀고 반복하는 단백질-DNA 상호 작용(염색질)에 의해 부분적으로 응축됩니다. 전자 현미경, 3차원 DNA 형광 제자리 혼성화(FISH) 및 DNA 태깅 기술(즉, 형광 및 인공 DNA 메틸화)을 통해 염색질의 비활성 도메인은 핵 주변을 따라 단단히 채워져 있는 것으로 밝혀졌습니다 4,5,6, 활성, 덜 응축된 염색질의 일부는 핵 내부에서 발견됩니다 7,8,9, 10입니다. 이 실험은 염색체 역학에 대한 광각 보기를 제공하지만 DNase 11,12 및 뉴클레오솜13,14,15 연구에서 관찰된 유전자 프로모터 주변에서 국부적으로 발생하는 변화를 포착하는 데는 거의 도움이 되지 않습니다.
고분해능 염색질 역학을 여는 열쇠는 3D 염색체 매핑 기술인 3C의 공식화였습니다. 3C 기법 자체는 염색질의 가교, 제한 효소에 의한 염색질 분해, 염색질 결찰 및 DNA 정제의 네 가지 주요 단계로 구성됩니다(그림 2). 이 과정에 의해 생성된 새로운 인공 DNA 단편은 선형적으로 멀리 떨어져 있는 DNA 조각들 사이의 밀접한 물리적 연관성을 나타내도록 특성화될 수 있다(16). 3C 기술은 3C의 초기 단계를 활용하여 더 광범위한 게놈 전체 질문(예: Hi-C, 4C, ChIP-C)을 하는 여러 스핀오프 기술을 만드는 기초가 되었습니다. 이 3C 기술 제품군은 염색체가 위상 관련 도메인(TAD)이라고 하는 여러 개별 단위로 구성되어 있음을 확인했습니다. TAD는 게놈에 암호화되어 있으며 고리가 없는 경계 16,17,18,19 옆에 있는 염색질 루프에 의해 정의됩니다. TAD 경계는 CCCT 결합 인자(CTCF) 및 응집력을 포함하여 진화적으로 보존되고 유비쿼터스한 두 가지 요인에 의해 유지되며, 이는 개별 TAD 내의 루프가 상호 작용하는 것을 방지합니다(16,20). 루프는 트랜스 인자와 조절 서열의 상호 작용, CTCF 및 응집력에 의해 매개됩니다21.
3C 기술을 사용하는 많은 연구가 광범위한 게놈 전반에 걸친 질문을 하고 복잡한 샘플 수집 기술을 사용하지만 3C 기술의 공식화는 기본 분자 생물학 기술을 기반으로 합니다. 따라서 3C는 학부 연구 및 교육 실험실 모두에 배포하기에 흥미로울 수 있습니다. 3C 기술은 더 작은 집중 질문에 사용할 수 있으며 질문의 초점과 방향에 따라 확장 또는 축소(단일 유전자22, 염색체16 및/또는 게놈18)에 본질적으로 유연합니다. 이 기술은 또한 광범위한 모델 시스템 7,16,19,23에 적용되었으며 그 용도에 있어 다재다능한 것으로 입증되었습니다. 따라서 3C는 학생들이 일반적인 분자 생물학 기술에 대한 경험을 쌓을 수 있는 동시에 지시된 질문에 답하는 데 귀중한 경험을 얻을 수 있다는 점에서 학부생에게 훌륭한 기술입니다.
여기에 제시된 것은 이전에 발표된 프로토콜24,25,26,27에 기초한 3C 라이브러리 준비를 위한 적응된 프로토콜이다. 이 프로토콜은 약 1 × 107 셀에 최적화되어 있지만 1 × 105 셀로 3C 라이브러리를 생성했습니다. 이 프로토콜은 다재다능한 것으로 입증되었으며 제브라피쉬 배아, 제브라피쉬 세포주 및 젊은 성인(YA) Caenorhabditis elegans(회충)에서 3C 라이브러리를 생성하는 데 사용되었습니다. 이 프로토콜은 또한 포유류 세포주와 추가 적응을 통해 효모에 적합해야 합니다.
이러한 적응의 목표는 학부생이 3C에 더 쉽게 접근할 수 있도록 하는 것입니다. 학부 교수 실험실에서 수행할 수 있는 것과 유사한 기술을 사용하도록 주의를 기울였습니다. 3C 기술은 학부생이 벤치, 교실 및 졸업 후 노력에서 발전에 도움이 될 기본 분자 생물학 기술을 배울 수 있는 많은 학습 기회를 제공합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>37% Formaldehyde&#160;</td>
			<td>Millapore-Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Millapore-Sigma</td>
			<td>E7023</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>MP Biomedical</td>
			<td>215350280</td>
			<td></td>
		</tr>
		<tr>
			<td>chloroform</td>
			<td>Millapore-Sigma</td>
			<td>C0549</td>
			<td></td>
		</tr>
		<tr>
			<td>cOmplete, EDTA-free Protease Inhibitor Cocktail</td>
			<td>Millapore-Sigma</td>
			<td>COEDTAF-RO</td>
			<td>mixed to 50x in water. Diluted to 1x in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Millapore-Sigma</td>
			<td>D0632</td>
			<td>1 M stock diluted to 500 &#181;M in Sucrose buffer and GB buffer fresh</td>
		</tr>
		<tr>
			<td>DpnII</td>
			<td>NEB</td>
			<td>R0543M</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Millapore-Sigma</td>
			<td>G9012</td>
			<td></td>
		</tr>
		<tr>
			<td>glycine</td>
			<td>Millapore-Sigma</td>
			<td>G8898</td>
			<td></td>
		</tr>
		<tr>
			<td>glycogen</td>
			<td>Millapore-Sigma</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Millapore-Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Millapore-Sigma</td>
			<td>P3911</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Millapore-Sigma</td>
			<td>P5655</td>
			<td></td>
		</tr>
		<tr>
			<td>methyl green pyronin&#160;&#160;</td>
			<td>Millapore-Sigma</td>
			<td>HT70116</td>
			<td></td>
		</tr>
		<tr>
			<td>MgAc2</td>
			<td>Thermoscientific</td>
			<td>1222530</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>Millapore-Sigma</td>
			<td>S5136</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Millapore-Sigma</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>phenol-chloroform&#160;</td>
			<td>Millapore-Sigma</td>
			<td>P3803</td>
			<td></td>
		</tr>
		<tr>
			<td>Pronase</td>
			<td>Millapore-Sigma</td>
			<td>11459643001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>IBI Scientific</td>
			<td>IB05406</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Ready mix (Phire Taq etc)</td>
			<td>Millapore-Sigma</td>
			<td>KCQS07</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A&#160;</td>
			<td>Millapore-Sigma</td>
			<td>R6148</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Millapore-Sigma</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>sodium dodecyl sulfate (SDS)</td>
			<td>Millapore-Sigma</td>
			<td>L3771</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Millapore-Sigma</td>
			<td>S0389</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>Promega</td>
			<td>M1804</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Millapore-Sigma</td>
			<td>108319</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Millapore-Sigma</td>
			<td>T9284</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA&#160;</td>
			<td>Millapore-Sigma</td>
			<td>T4049</td>
			<td></td>
		</tr>
	</tbody>
</table>

getting an a with the 3cs: chromosome conformation capture for undergraduates

염색체 형태 포획(3C)은 염색질의 3차원 조직에 대한 자세한 정보를 제공하는 유사한 기술 제품군(예: Hi-C, 4C 및 5C, 여기서는 3C 기술이라고 함)을 생성한 강력한 도구입니다. 3C 기술은 암세포의 염색질 조직 변화를 모니터링하는 것부터 유전자 프로모터와의 인핸서 접촉 식별에 이르기까지 광범위한 연구에 사용되었습니다. 이러한 기술을 사용하는 많은 연구가 복잡한 샘플 유형 (즉, 단일 세포 분석)으로 게놈 전반에 걸친 큰 질문을하고 있지만, 종종 손실되는 것은 3C 기술이 광범위한 연구에 적용 할 수있는 기본 분자 생물학 방법에 기반을두고 있다는 것입니다. 염색질 조직에 대한 긴밀한 초점을 맞춘 문제를 해결함으로써 이 최첨단 기술을 사용하여 학부 연구 및 교육 실험실 경험을 향상시킬 수 있습니다. 이 논문은 3C 프로토콜을 제시하고 학부 연구 및 교육 경험에서 주로 학부 기관에서 구현하기 위한 적응 및 강조점을 제공합니다.

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

이 절차는 하나의 실험 3C 샘플과 두 개의 대조군 샘플(소화되지 않은 및 소화됨)을 생성합니다. 이들 3개의 샘플을 이용하여, qPCR을 수행하였다. 이러한 결과로부터, 소화 효율을 계산하고(수학식 1) 기록하였다(표 1). 이러한 계산으로부터, 3C 샘플은 시험된 7개의 게놈 유전자좌에 걸쳐 대략 88%의 소화 효율(표 1의 평균)을 갖는 것으로 결정되었다.
다음으로, 샘플은 유전자좌 특이적 프라이머(표 2)와 qPCR의 조합을 사용하여 서로 다른 게놈 유전자좌 사이의 장거리 염색질 접촉의 존재에 대해 테스트되었습니다. 이러한 결과를 사용하여 대조군 프라이머 세트에 대한 제품 존재비를 계산하고(방정식 2) 비교를 위해 그래프로 표시했습니다(그림 4). 이 데이터는 10 개의 반응 중 8 개가 장거리 상호 작용에 대한 조건부 양성임을 나타냅니다.
이어서, PCR 반응을 아가로스 겔 상에서 실행하였다. 8개의 조건부 양성 반응과 1개의 음성 반응에 대해 예상되는 PCR 산물을 겔 정제하고 Sanger 시퀀싱을 위해 보냈습니다. 대표적인 양성(파란색 화살표, 파란색 상자) 및 음성(빨간색 화살표, 빨간색 상자) 반응에 대한 결과가 표시됩니다(그림 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65213/65213fig01.jpg"> 그림 1: 핵의 염색체 구조. 핵 내부의 가상의 염색체 조직. (A) 핵 외피, 검은 선; (b) 핵층, 오렌지색; (c) 헤테로크로마틴, 압축선; (D) 유크로마틴, 느슨한 루프. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65213/65213fig02.jpg"> 그림 2: 3C 프로토콜의 개략도. 선형 염색체의 먼 부분(파란색, 노란색, 분홍색)은 조절 루프를 통해 핵 내에서 서로 가깝게 연결됩니다. (A) 루프 구조는 전사 인자(회색 원 및 검은색 별)에 의해 매개됩니다. 이러한 상호 작용은 화학적 가교를 통해 보존됩니다. (B) 루프는 효소 소화를 통해 끊어집니다(검은색 선). (C) 멀리 있는 염색질 조각은 소화에 의해 생성된 접착 말단을 통해 함께 결찰됩니다. (D) DNA는 단백질로부터 정제된다. (E) 단편 내의 서열이 식별되고 게놈에 다시 매핑됩니다. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65213/65213fig03.jpg"> 그림 3: 3C 프라이머 구성표. 3C 프라이머는 관심 게놈 위치에서 다양한 거리에 있는 제한 부위를 중심으로 설계되었습니다. 분홍색 화살표는 DpnII 부위를 둘러싼 실험용 프라이머 세트를 나타냅니다. 실험 프라이머를 혼합하고 일치시켜 해당 영역의 염색질 루핑을 평가할 수 있습니다. 주황색 프라이머는 DpnII 부위가 없는 음성 대조군을 나타냅니다. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/65213/65213fig04.jpg"> 그림 4: 3C 실험에 대한 대표적인 qPCR 데이터. 3C 테스트 프라이머 세트의 상대적 풍부도. (A) 소화되지 않은 대조군(파란색), 소화된 대조군(회색) 및 3C 샘플(주황색)에서 생성물의 상대적 풍부도를 보여주는 대조군 그래프. (b) 3C 실험; 소화되지 않은 대조군(파란색), 분해된 대조군(회색) 및 3C 샘플(주황색)에서 테스트 프라이머 조합으로 인한 제품의 상대적 풍부도. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig04large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/65213/65213fig05.jpg"> 그림 5: 3C qPCR 산물의 시각화. 상단, qPCR 종말점 제품이 표시된 젤amples와 함께. 하단, 표시된 반응에 대한 대표적인 Sanger 서열 추적 파일. 주황색 샘플은 거짓 양성의 예이며( 그림 4, r38/34 참조), 파란색 샘플은 추적 위에 표시된 DpnII 부위가 있는 참 양성의 예입니다. <a href="https://www.jove.com/files/ftp_upload/65213/65213fig05large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>사이트</td>
			<td>% 소화</td>
		</tr><tr><td>R8</td>
			<td>86.98</td>
		</tr><tr><td>R3 (알3)</td>
			<td>88.44</td>
		</tr><tr><td>R38 (영어)</td>
			<td>89.64</td>
		</tr><tr><td>R34 (영어)</td>
			<td>87.55</td>
		</tr><tr><td>R33 (알33)</td>
			<td>87.85</td>
		</tr><tr><td>R14 (영어)</td>
			<td>86.97</td>
		</tr><tr><td>R47 (영어)</td>
			<td>89.45</td>
		</tr></tbody></table>표 1: 계산된 소화 효율.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>이름</td>
			<td colspan="3">순서</td>
			<td>게놈 유전자좌</td>
		</tr><tr><td>r3 FWD</td>
			<td colspan="3">ACGCAAGTAAAATTCTGGTTTTTGACC</td>
			<td>chrX:11361475</td>
		</tr><tr><td>r3 RVS</td>
			<td colspan="3">TTTCCTGAGCTCTCTAACCATGTTTGC</td>
			<td>chrX:11361561</td>
		</tr><tr><td>r38 FWD</td>
			<td colspan="3">TTACTTCTGAAGTAATCTTTTCTTATCCCC</td>
			<td>chrX:5859700</td>
		</tr><tr><td>r38 RVS</td>
			<td colspan="3">AGACGAGCTGATTAAAAGTAGTTGAGAG</td>
			<td>chrX:5859775</td>
		</tr><tr><td>r34 FWD (전륜)</td>
			<td colspan="3">ATTTGTGGATTGCGTGGAGACG</td>
			<td>chrX:5429702</td>
		</tr><tr><td>r34 RVS</td>
			<td colspan="3">AATAATCCTCTTAACAAACGTGGCC</td>
			<td>chrX:5429777</td>
		</tr><tr><td>r33 FWD</td>
			<td colspan="3">아가그트그ccaaaataaattgagctaac</td>
			<td>chrX:6296704</td>
		</tr><tr><td>r33 RVS</td>
			<td colspan="3">TTCAGAAAAGTAAACTTTGACTTGGAACG</td>
			<td>chrX:6296807</td>
		</tr><tr><td>r14 FWD</td>
			<td colspan="3">AATTATCGATTTTTCCATCGCGCAG</td>
			<td>chrX:8036367</td>
		</tr><tr><td>r14 RVS</td>
			<td colspan="3">ATTTCAATGAAAATGTAAAAATGTTCCTTC</td>
			<td>chrX:8036427</td>
		</tr><tr><td>r47 FWD</td>
			<td colspan="3">ATCTAGACTTGATAATATTTGTGTGTCCTC</td>
			<td>chrX:9464939</td>
		</tr><tr><td>r47 RVS</td>
			<td colspan="3">AAGTTCTGCAACTGTTAGATGAATAACAC</td>
			<td>chrX:9465064</td>
		</tr><tr><td>r8 FWD</td>
			<td colspan="3">GAGAATGTTGTTCTGTAACTGAAAACTTG</td>
			<td>chrX:11094257</td>
		</tr><tr><td>r8 RVS</td>
			<td colspan="3">TTACGAAATTTGGTAGTTTTGGACC</td>
			<td>chrX:11094362</td>
		</tr><tr><td>제어 프라이머 FWD</td>
			<td colspan="3">CAATCGTCTCGCTCACTTGTC</td>
			<td>chrX:7608049</td>
		</tr><tr><td>제어 프라이머 RVS</td>
			<td colspan="3">갓트가그카아카그카크캉</td>
			<td>chrX:7608166</td>
		</tr></tbody></table>표 2: 대표적인 3C 실험을 위한 프라이머.

Watch this Scientific Journal Video about Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates at JoVE.com

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates (Video) | JoVE 

여기에서는 학부 참여 및 학습에 중점을 두고 염색체 형태 캡처(3C) 기술의 적응을 자세히 제시합니다.

3C로 A 받기: 학부생을 위한 염색체 형태 캡처

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

우리의 연구는 염색질 조직이 유전자 발현을 제어하는 방법을 밝히는 것을 목표로 합니다. 초점은 유전자 활성을 제어하기 위해 유전자 수준에서 염색질을 조절하는 요인을 결정하는 것입니다. 현재 염색체 확인 캡처(3C)와 유사한 기술이 이 분야에서 발전하는 데 사용됩니다.시료 채취 및 염기서열 분석 기술에 대한 투자는 3C 기술이 우리에게 보여줄 수 있는 것을 밀어붙였습니다. 현재 가장 큰 실험 과제는 균일한 염색질 구조를 가진 샘플을 수집하는 것입니다. 샘플의 이질성은 혼란스러운 결과를 초래합니다.앞으로 우리는 염색질 조직의 변화가 암에서 어떤 역할을 하는지에 초점을 맞출 것입니다.