This work was supported by the National Institutes of Health (NIH) Grants: RO1 EY012085 (to J.X.J) and F32DK134051 (to F.M.A), and Welch Foundation grant: AQ-1507 (to J.X.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The figures were partially created with Biorender.com.

This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and instruments used in this protocol.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg" /> 
Figure 1: Experimental outline. 1. The first step of the protocol is the determination of a specific target protein(s), the identification of the associated gene sequence(s), and DNA fragment generation. 2. Cloning of the gene sequence(s) into a retroviral vector by initial cloning into an adaptor vector, 3. followed by a viral vector. 4. Preparation of high-titer viral particles using packaging cells to harvest and concentrate. 5. The final step, and the focus of this protocol, is the chicken lens microinjection of the RCAS(A) viral particles into the lens lumen. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
1. Preparation of high-titer recombinant retroviruses
<ol>
	<li>Polymerase chain reaction (PCR) to make target protein DNA fragments 
	NOTE: This section aims to amplify the DNA sequence corresponding to the target lens protein. For more detail, see7,8.
	<ol>
		<li>Design primers for PCR, corresponding to the protein of interest, to make DNA fragments with their carboxyl termini in-frame with or without a FLAG epitope sequence (5&#39;-GACTACAAGGACGACGATGACAAG-3&#39;), a stop codon, and a restriction enzyme site (i.e., EcoRI) present inside the polylinker region of CLa12NCO)) according to the specifications noted in previously published protocols, with sequences for adequate restriction enzymes1,7,8,10,11.</li>
		<li>Perform the PCR reaction10. Combine 100 pmol of sense and antisense of the designed primers with 0.5 &#181;g of connexin cDNA (such as Cx50, Cx43, or chimeric Cx50*43L combinations), to the PCR reaction buffer of choice. Perform 30 cycles each consisting of 94 &#176;C for 1 min, 58 &#176;C for 1 min, and 72 &#176;C for 1 min, followed by a final extension for 10 min at 72 &#176;C.</li>
		<li>Isolate and purify PCR products with a gel purification kit.</li>
		<li>Digest the purified PCR products using restriction enzymes of choice according to the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Cloning of DNA inserts into adaptor plasmid 
	NOTE: Insertion of DNA fragments into an adaptor vector eliminates the need for helper cells/viruses to increase RCAS(A) vector stability14. For more detail, see7,8.
	<ol>
		<li>Subclone DNA fragments into an adapter plasmid, Cla12NCO using a sticky-end ligation reaction. Mix the PCR fragments with restriction enzymes and Cla12NCO at a 2-5:1 ratio. Perform ligation and DNA transformation using competent cells.</li>
		<li>Isolate DNA using a DNA isolation kit.</li>
		<li>Sequence the DNA to ensure accuracy.</li>
	</ol>
	</li>
	<li>Cloning into the RCAS(A) viral vector 
	NOTE: DNA fragments are inserted into a vehicle (RCAS(A) retrovirus) for the stable transduction of a gene into cells in the developing chick embryo14,15. For more detail, see7,8,15.
	<ol>
		<li>Digest the Cla12NCO-DNA fragment of interest-containing vector with ClaI (1 unit per 1 &#181;g of DNA) and gel-isolate the fragments.</li>
		<li>Subclone the DNA fragments into a ClaI-linearized RCAS(A) plasmid. Use the restriction enzyme SalI to distinguish the ClaI site on the RCAS(A) plasmid.</li>
		<li>Confirm the correct orientation of the inserted fragments on the constructs by digestion with ClaI and SalI restriction enzymes.</li>
		<li>Isolate DNA using a DNA isolation kit.</li>
		<li>Determine the DNA concentration.</li>
	</ol>
	</li>
	<li>Transfection of chick embryonic fibroblast (CEF) cells and RCAS(A) harvest 
	NOTE: Virus packaging cells, CEFs, are used to obtain/harvest cell culture media containing viral particles15,16. For more detail, see7,8,15.
	<ol>
		<li>Transfect CEF cells with recombinant retroviral DNA constructs using the transfection agent according to the manufacturer&#39;s instructions.</li>
		<li>Perform western blotting of the transfected cells to examine their expression of the protein of interest.</li>
		<li>When the transfected cells reach confluency, begin collecting the supernatant medium, processing/filtering it appropriately (to remove any cellular debris using a 0.22&#181;m filter), and store at -80 &#176;C until ready for concentration.</li>
	</ol>
	</li>
	<li>Concentration and titering of viral stocks 
	&#8203;NOTE: The pellet and large volumes of media derived from the cells containing the viral particles must be filtered. Additionally, a viral titer assay must be performed to establish the strength of the virus against the host cells. For more detail, see6,7,8,15.
	<ol>
		<li>Thaw the culture media containing the virions.</li>
		<li>Spin the culture media at 72,000 &#215; g for 2 h at 4 &#176;C.</li>
		<li>Decant the supernatant and resuspend the viral pellet with the residual (~50 &#181;L) medium and store at -80 &#176;C until use, in ~10 &#181;L viral stocks.</li>
		<li>For titering, using either QT-6 or CEF cells, transfect the cells with a serial dilution of the viral stocks.</li>
		<li>Post confluency, fix the cells using 4% formaldehyde.</li>
		<li>Immunostain for viral gag proteins or process for alkaline phosphatase histochemically to obtain the titer, defined as (colony-forming units) CFU per milliliter (CFU/mL).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg" /> 
Figure 2: Instruments and setup for chick lens microinjection. (A)&#160;P-30 manual vertical microelectrode micropipette puller. (1) inset showing a glass micropipette being pulled. (B)&#160;(2) Egg Incubator. Incubate chicken egg for ~65-68 h in a 37 &#176;C incubator to reach stage 18 (with a sealed, empty central lumen) for injection of retrovirus. (C) Microinjection setup. (3) lighting equipment, (4) Pico-Injector, (5) dissecting microscope, (6) Drummond micromanipulator, (7) computer/camera for visualization. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
2. Chick lens microinjection
<ol>
	<li>Preparation of supplies
	<ol>
		<li>Preparation of glass micropipettes for microinjection17 
		&#8203;NOTE: Glass capillaries are used to make glass micropipettes with a tip point and an outer diameter (OD) of ~11 &#181;m for microinjection. The setup is shown in Figure 2A.
		<ol>
			<li>Attach the borosilicate glass capillary to the rubber cushioned clips in the manual vertical micropipette puller.</li>
			<li>Set heat temperature (HEAT 1) to 950 &#176;C and perform prepulling to obtain a thinner and softer glass capillary.</li>
			<li>Set heat temperature (HEAT 2) to 790 &#176;C and perform a secondary pulling to produce final micropipettes.</li>
			<li>With a micropipette grinder, sharpen the tip opening to an OD of ~11 &#181;m.</li>
			<li>For future experiments, keep the glass micropipettes in a sponge clamping pad inside a glass jar.</li>
		</ol>
		</li>
		<li>Incubation of fertilized eggs until development stage 18 
		NOTE: During lens development, at ~65-68 h of embryonic development, the lens separates from the ectoderm and forms a sealed vesicle with a central lumen; injection into this empty lens lumen primes for restricted expression to proliferative lens cells7,8,18.
		<ol>
			<li>Incubate fertilized chicken eggs for ~65-68 h in a 37 &#176;C humidified rocking incubator (Figure 2B).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Opening of the chicken egg 
	NOTE: This step describes the identification and exposure of the embryo for microinjection. For more detail, see7,8.
	<ol>
		<li>Wipe down the work area thoroughly with 70% ethanol.</li>
		<li>Remove the eggs from the incubator, spray them down heavily with 70% ethanol, and let them air-dry.</li>
		<li>Place the egg, with the larger end of the egg facing upwards, on an egg holder.</li>
		<li>Using a pair of sharp-toothed forceps, produce a hole of ~2 cm diameter on the larger end of the egg by carefully tapping on the eggshell and removing fragments of the eggshell (Figure 3A).</li>
		<li>Using a dissecting microscope, locate the embryo.</li>
		<li>Once the embryo and chick lens are located, use the dissecting microscope and fine dissecting forceps and scissors to cut off the amnionic membrane immediately covering the top of the embryo (Figure 3B). 
		NOTE: Do not cut too widely (only enough to expose the embryo ~0.5 cm x 0.5 cm), or else the embryos might sink into the yolk mass; also avoid touching blood vessels, if possible.</li>
		<li>Cover the opening of the egg with a 60 mm Petri dish in preparation for the next steps.</li>
	</ol>
	</li>
	<li>Microinjection of concentrated viral stock 
	NOTE: Viral particles containing target protein DNA fragments for transduction are inserted into cells inside the lens lumen. The setup is shown in Figure 2C. For more detail, see6,7,8.
	<ol>
		<li>Thaw the viral stock stocks on ice.</li>
		<li>For visualization of the viral stock during injection, dilute 1 &#181;L of 10x Fast green into one vial of viral stock containing 10 &#181;L.</li>
		<li>To ensure there are no large chunks of undissolved material that could clog the glass micropipette, centrifuge the solutions for 10 s at 10,000 &#215; g at 4 &#176;C to pellet &#34;large chunks&#34; and transfer the supernatants into new tubes, all while keeping the solutions on ice.</li>
		<li>On a 35 mm x 10 mm culture dish, place a stretched laboratory parafilm and add 1 &#181;L of sterile saline (PBS) on top of the film (non-sterilized, with the covered side considered &#34;clean&#34;).</li>
		<li>Connect a prepared glass micropipette to an automatic pico-injector.</li>
		<li>Press the fill mode to fill the sterile saline (PBS) into a glass micropipette, and then use the inject mode to test the allocated 1 &#181;L of liquid.</li>
		<li>Place a second stretched laboratory parafilm on the surface of a new 35 mm x 10 mm cell culture dish and add 1 &#181;L of Fast green-stained viral stocks on top of the film.</li>
		<li>Lower the tip of the micropipette into the viral stock and press the fill-model to fill the glass micropipette with ~1 &#181;L of viral stock. 
		NOTE: To avoid drying out, put the tip of the filled micropipette in sterile saline (PBS) whenever there is a pause in the procedure.</li>
		<li>Lower the filled glass micropipette, connected to an automatic injector, into the target region of the embryo lens lumen with the assistance of a dissecting microscope.</li>
		<li>Adjust the light source to ensure clear visualization of the outline of the lens vesicle. 
		NOTE: The lumen of the right lens (facing up) is typically used for injection and the left (facing down) is kept intact as a contralateral control.</li>
		<li>Once sure that the placement of the micropipette is within the correct location inside the lens lumen, inject 5-40 nL of the viral stock (Figure 3C). 
		NOTE: Practice is very necessary for optimal injection placement.</li>
		<li>Wait for ~45 s and then gently remove the glass micropipette.</li>
		<li>Check for the successful microinjection into the lens lumen using the dissecting microscope by examining Fast Green dye that should stay in the empty lumen of the lens without any leakage.</li>
		<li>After the injection procedure, seal the eggshell opening with scotch tape.</li>
		<li>Return the embryo to the 37 &#176;C humidified incubator, without any rotating motion, until the desired embryonic age has been reached for lens dissection.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg" /> 
Figure 3: Microinjection chick prep and schematic. (A) Opening of a chicken egg. (B) Cutting of the amniotic membrane. (C) Chicken lens lumen microinjection schematic. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Studying Protein Expression During Chicken Lens Development

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.6 and was further developed by Jiang et. al.8 and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides i...

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

After the determination of a specific target protein(s) and the identification of the associated gene sequence(s), the overall experimental approach involves the cloning of the gene sequence(s) into a retroviral RCAS(A) vector by the initial cloning into an adaptor vector, followed by a viral vector. Second, high-titer viral particles are prepared using packaging cells to harvest and concentrate the virions. These first two major steps have been largely described and representative results presented elsewhere<sup class="...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

Author Spotlight: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens 

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

microinjection-recombinant-rcas-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

891 Views.  University of Texas Health Science Center, San Antonio. This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Video: Author Spotlight: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens 

Windowing Chicken Eggs for Developmental Studies

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling.  In addition, it allows for molecular perturbations of several types, including placement of protein-coated beads and introduction of plasmid DNA using in ovo electroporation.  These experiments have yielded important data on the development of the central and peripheral nervous systems.  For many of these studies, it is necessary to open the eggshell and reclose it without perturbing the embryo's growth.  The embryo can be examined at successive developmental stages by re-opening the eggshell.  While there are several excellent methods for opening chicken eggs, in this article we demonstrate one method that has been optimized for long survival times.  In this method, the egg rests on its side and a small window is cut in the shell.  After the experimental procedure, the shell is used to cover the egg for the duration of its development.  Clear plastic tape overlying the eggshell protects the embryo and helps retain hydration during the remainder of the incubation period.  This method has been used beginning at two days of incubation and has allowed survival through mature embryonic ages.

The ease of accessibility of the embryo has allowed for experiments to map cell fates using several approaches, including chick quail chimeras and focal dye labeling. In this article we demonstrate one egg preparation method that has been optimized for long survival times.

The study of development has been greatly aided by the use of the chick embryo as an experimental model.  The ease of accessibility of the embryo has ...

Production of Replication-Defective Retrovirus by Transient Transfection of 293T cells

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, Bcr-PDGFR&#945;, etc.). We are able to model and study a human-like disease in our mouse model, by transplanting bone marrow cells previously infected with a retrovirus expressing the oncogene of interest. Replication-defective retrovirus encoding a human oncogene and a marker (GFP, RFP, antibiotic resistance gene, etc.) is produced by a transient transfection protocol using 293T cells, a human renal epithelial cell line transformed by the adenovirus E1A gene product. 293 cells have the unusual property of being highly transfectable by calcium phosphate (CaPO4), with up to 50-80% transfection efficiency readily attainable. Here, we co-transfect 293 cells with a retroviral vector expressing the oncogene of interest and a plasmid that expresses the gag-pol-env packaging functions, such as the single-genome packaging constructs kat or pCL, in this case the EcoPak plasmid. The initial transfection is further improved by use of chloroquine. Stocks of ecotropic virus, collected as culture supernatant 48 hrs. post-transfection, can be stored at -80&deg;C and used for infection of cell-lines in view of transformation and in vitro studies, or primary cells such as mouse bone marrow cells, that can then be used for transplant in our mouse model.

This technique demonstrates an efficient way to prepare replication-defective retroviral stocks encoding a human oncogene, and subsequently used for induction of myeloproliferative disease in the mouse model.

Our lab studies human myeloproliferative diseases induced by such oncogenes as Bcr-Abl or growth factor receptor-derived oncogenes (ZNF198-FGFR1, ...

Generation of Stable Transgenic C. elegans Using Microinjection

Transgenic Caenorhabditis elegans can be readily created via microinjection of a DNA plasmid solution into the gonad 1. The plasmid DNA rearranges to form extrachromosomal concatamers that are stably inherited, though not with the same efficiency as actual chromosomes 2. A gene of interest is co-injected with an obvious phenotypic marker, such as rol-6 or GFP, to allow selection of transgenic animals under a dissecting microscope. The exogenous gene may be expressed from its native promoter for cellular localization studies. Alternatively, the transgene can be driven by a different tissue-specific promoter to assess the role of the gene product in that particular cell or tissue. This technique efficiently drives gene expression in all tissues of C. elegans except for the germline or early embryo 3. Creation of transgenic animals is widely utilized for a range of experimental paradigms. This video demonstrates the microinjection procedure to generate transgenic worms. Furthermore, selection and maintenance of stable transgenic C. elegans lines is described.

This video demonstrates the technique of microinjection into the gonad of C. elegans to create transgenic animals.

Transgenic Caenorhabditis elegans can be readily created via microinjection of a DNA plasmid solution into the gonad 1.  The plasmid DNA rearranges to ...

Microinjection of Xenopus Laevis Oocytes

Microinjection of Xenopus laevis oocytes followed by thin-sectioning electron microscopy (EM) is an excellent system for studying nucleocytoplasmic transport. Because of its large nucleus and high density of nuclear pore complexes (NPCs), nuclear transport can be easily visualized in the Xenopus oocyte. Much insight into the mechanisms of nuclear import and export has been gained through use of this system (reviewed by Pant&eacute;, 2006). In addition, we have used microinjection of Xenopus oocytes to dissect the nuclear import pathways of several viruses that replicate in the host nucleus. 
Here we demonstrate the cytoplasmic microinjection of Xenopus oocytes with a nuclear import substrate. We also show preparation of the injected oocytes for visualization by thin-sectioning EM, including dissection, dehydration, and embedding of the oocytes into an epoxy embedding resin. Finally, we provide representative results for oocytes that have been microinjected with the capsid of the baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) or the parvovirus Minute Virus of Mice (MVM), and discuss potential applications of the technique.

Here we demonstrate cytoplasmic microinjection of Xenopus laevis oocytes with a nuclear import substrate, as well as preparation of the injected oocytes for visualization by thin-sectioning electron microscopy.

Microinjection of Xenopus laevis oocytes followed by thin-sectioning electron microscopy (EM) is an excellent system for studying nucleocytoplasmic ...

Microinjection of Zebrafish Embryos to Analyze Gene Function

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic oligonucleotides with antisense complementarity to target RNAs, can be added to the embryo to reduce the expression of a particular gene product.  Conversely, processed mRNA can be added to the embryo to increase levels of a gene product.  The vehicle for adding either mRNA or morpholino to an embryo is microinjection.  Microinjection is efficient and rapid, allowing for the injection of hundreds of embryos per hour.  This video shows all the steps involved in microinjection.  Briefly, eggs are collected immediately after being laid and lined up against a microscope slide in a Petri dish.  Next, a fine-tipped needle loaded with injection material is connected to a microinjector and an air source, and the microinjector controls are adjusted to produce a desirable injection volume.  Finally, the needle is plunged into the embryo's yolk and the morpholino or mRNA is expelled.

This video shows how morpholino or mRNA can be injected into zebrafish embryos at the one-cell stage to decrease or increase the level of specific gene products during subsequent development.

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic ...

Intranuclear Microinjection of DNA into Dissociated Adult Mammalian Neurons

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to immortalized cell lines. However, the post-mitotic nature of primary neurons prevents effective heterologous protein expression using common procedures such as electroporation or chemically-mediated transfection. Thus, other techniques must be employed in order to effectively express proteins in these non-dividing cells.
In this article, we describe the steps required to perform intranuclear injections of cDNA constructs into dissociated adult sympathetic neurons. This technique, which has been applied to different types of neurons, can successfully induce heterologous protein expression. The equipment essential for the microinjection procedure includes an inverted microscope to visualize cells, a glass injection pipet filled with cDNA solution that is connected to a N2(g) pressure delivery system, and a micromanipulator. The micromanipulator coordinates the injection motion of microinjection pipet with a brief pulse of pressurized N2 to eject cDNA solution from the pipet tip. 
This technique does not have the toxicity associated with many other transfection methods and enables multiple DNA constructs to be expressed at a consistent ratio. The low number of injected cells makes the microinjection procedure well suited for single cell studies such as electrophysiological recordings and optical imaging, but may not be ideal for biochemical assays that require a larger number of cells and higher transfection efficiencies. Although intranuclear microinjections require an investment of equipment and time, the ability to achieve high levels of heterologous protein expression in a physiologically relevant environment makes this technique a very useful tool to investigate protein function.

Direct intranuclear injection of cDNA is an effective transfection technique for post-mitotic cells. This method provides high levels of heterologous protein expression from single or multiple cDNA constructs and enables protein function to be studied in a physiologically relevant environment with a variety of single cell assays.

Primary neuronal cell cultures are valuable tools to study protein function since they represent a more biologically relevant system compared to ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Xenotransplantation of Human Stem Cells into the Chicken Embryo

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the behavior of cells in a standardized in vivo environment. The main advantages of the chicken embryo include low cost, high accessibility, ease of surgical manipulation and lack of a fully developed immune system. Xenotransplantation into chicken embryos can provide valuable information about cell proliferation, differentiation and behavior, the responses of cells to signals in defined embryonic tissue niches, and tumorigenic potential. Transplanting cells into chicken embryos can also be a step towards transplantation experiments in other animal models. Recently the chicken embryo has been used to evaluate the neurogenic potential of human stem and progenitor cells following implantation into neural anlage1-6. In this video we document the entire procedure for transplanting human stem cells into the developing central nervous system of the chicken embryo. The procedure starts with incubation of fertilized eggs until embryos of the desired age have developed. The eggshell is then opened, and the embryo contrasted by injecting dye between the embryo and the yolk. Small lesions are made in the neural tube using microsurgery, creating a regenerative site for cell deposition that promotes subsequent integration into the host tissue. We demonstrate injections of human stem cells into such lesions made in the part of the neural tube that forms the hindbrain and the spinal cord, and into the lumen of the part of the neural tube that forms the brain. Systemic injections into extraembryonic veins and arteries are also demonstrated as an alternative way to deliver cells to vascularized tissues including the central nervous system. Finally we show how to remove the embryo from the egg after several days of further development and how to dissect the spinal cord free for subsequent physiological, histological or biochemical analyses.

In this paper we present a method for transplanting human stem cells into various regions of the central nervous system of the chicken embryo. This provides an in vivo model for assessing the proliferation and differentiation of various types of human stem cells in embryonic tissue environments.

The chicken embryo is a classical animal model for studying normal embryonic and fetal development and for xenotransplantation experiments to study the ...

Analyzing the Function of Small GTPases by Microinjection of Plasmids into Polarized Epithelial Cells

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces the 'free' surfaces and the basolateral membrane is in contact with the substrate and neighboring cells. Both membrane domains are separated by tight junctions, which form a diffusion barrier. Apical-basolateral polarization can be recapitulated successfully in culture when epithelial cells such as Madin-Darby Canine Kidney (MDCK) cells are seeded at high density on polycarbonate filters and cultured for several days 1 2. Establishment and maintenance of cell polarity is regulated by an array of small GTPases of the Ras superfamily such as RalA, Cdc42, Rab8, Rab10 and Rab13 3 4 5 6 7. Like all GTPases these proteins cycle between an inactive GDP-bound state and an active GTP-bound state. Specific mutations in the nucleotide binding regions interfere with this cycling 8. For example, Rab13T22N is permanently locked in the GDP-form and thus dubbed 'dominant negative', whereas Rab13Q67L can no longer hydrolyze GTP and is thus locked in a 'dominant active' state 7. To analyze their function in cells both dominant negative and dominant active alleles of GTPases are typically expressed at high levels to interfere with the function of the endogenous proteins 9. An elegant way to achieve high levels of overexpression in a short amount of time is to introduce the plasmids encoding the relevant proteins directly into the nuclei of polarized cells grown on filter supports using microinjection technique. This is often combined with the co-injection of reporter plasmids that encode plasma membrane receptors that are specifically sorted to the apical or basolateral domain. A cargo frequently used to analyze cargo sorting to the basolateral domain is a temperature sensitive allele of the vesicular stomatitis virus glycoprotein (VSVGts045) 10. This protein cannot fold properly at 39&deg;C and will thus be retained in the endoplasmic reticulum (ER) while the regulatory protein of interest is assembled in the cytosol. A shift to 31&deg;C will then allow VSVGts045 to fold properly, leave the ER and travel to the plasma membrane 11. This chase is typically performed in the presence of cycloheximide to prevent further protein synthesis leading to cleaner results. Here we describe in detail the procedure of microinjecting plasmids into polarized cells and subsequent incubations including temperature shifts that allow a comprehensive analysis of regulatory proteins involved in basolateral sorting.

This article details the procedures involved in overexpression and analysis of small GTPases in polarized epithelial cells using microinjection technique.

Epithelial cells polarize their plasma membrane into biochemically and functionally distinct apical and basolateral domains where the apical domain faces ...

Efficient Differentiation of Mouse Embryonic Stem Cells into Motor Neurons

Direct differentiation of embryonic stem (ES) cells into functional motor neurons represents a promising resource to study disease mechanisms, to screen new drug compounds, and to develop new therapies for motor neuron diseases such as spinal muscular atrophy (SMA) and amyotrophic lateral sclerosis (ALS). Many current protocols use a combination of retinoic acid (RA) and sonic hedgehog (Shh) to differentiate mouse embryonic stem (mES) cells into motor neurons1-4. However, the differentiation efficiency of mES cells into motor neurons has only met with moderate success. We have developed a two-step differentiation protocol5 that significantly improves the differentiation efficiency compared with currently established protocols. The first step is to enhance the neuralization process by adding Noggin and fibroblast growth factors (FGFs). Noggin is a bone morphogenetic protein (BMP) antagonist and is implicated in neural induction according to the default model of neurogenesis and results in the formation of anterior neural patterning6. FGF signaling acts synergistically with Noggin in inducing neural tissue formation by promoting a posterior neural identity7-9. In this step, mES cells were primed with Noggin, bFGF, and FGF-8 for two days to promote differentiation towards neural lineages. The second step is to induce motor neuron specification. Noggin/FGFs exposed mES cells were incubated with RA and a Shh agonist, Smoothened agonist (SAG), for another 5 days to facilitate motor neuron generation. To monitor the differentiation of mESs into motor neurons, we used an ES cell line derived from a transgenic mouse expressing eGFP under the control of the motor neuron specific promoter Hb91. Using this robust protocol, we achieved 51&plusmn;0.8% of differentiation efficiency (n = 3; p &lt; 0.01, Student's t-test)5. Results from immunofluorescent staining showed that GFP+ cells express the motor neuron specific markers, Islet-1 and choline acetyltransferase (ChAT). Our two-step differentiation protocol provides an efficient way to differentiate mES cells into spinal motor neurons.

We developed a new protocol to improve efficiency of in vitro differentiation of mouse embryonic stem cells into motor neurons. The differentiated ES cells acquired motor neurons features as evidenced by expression of neuronal and motor neuron markers using immunohistochemical techniques.

Direct differentiation of embryonic stem (ES) cells into functional  motor neurons represents a promising resource to study disease mechanisms, to  screen ...